ID: 902711756

View in Genome Browser
Species Human (GRCh38)
Location 1:18244678-18244700
Sequence CCTGGTGGAATAAAGGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 183}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902711748_902711756 -7 Left 902711748 1:18244662-18244684 CCACAGAGGCCCCTGCCCTGGTG 0: 1
1: 0
2: 4
3: 57
4: 465
Right 902711756 1:18244678-18244700 CCTGGTGGAATAAAGGAAACTGG 0: 1
1: 0
2: 3
3: 15
4: 183
902711743_902711756 25 Left 902711743 1:18244630-18244652 CCTCTGTGTCTCAGGCCTGGTGC 0: 1
1: 0
2: 1
3: 45
4: 382
Right 902711756 1:18244678-18244700 CCTGGTGGAATAAAGGAAACTGG 0: 1
1: 0
2: 3
3: 15
4: 183
902711745_902711756 10 Left 902711745 1:18244645-18244667 CCTGGTGCTGGATGCTGCCACAG 0: 1
1: 0
2: 2
3: 31
4: 300
Right 902711756 1:18244678-18244700 CCTGGTGGAATAAAGGAAACTGG 0: 1
1: 0
2: 3
3: 15
4: 183
902711742_902711756 26 Left 902711742 1:18244629-18244651 CCCTCTGTGTCTCAGGCCTGGTG 0: 1
1: 0
2: 4
3: 33
4: 416
Right 902711756 1:18244678-18244700 CCTGGTGGAATAAAGGAAACTGG 0: 1
1: 0
2: 3
3: 15
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902711756 Original CRISPR CCTGGTGGAATAAAGGAAAC TGG Intronic