ID: 902712212

View in Genome Browser
Species Human (GRCh38)
Location 1:18248229-18248251
Sequence CTGTGTACACAGTGGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 257}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902712205_902712212 9 Left 902712205 1:18248197-18248219 CCTTTTGTTTCTTCAACACTCCC 0: 1
1: 0
2: 2
3: 29
4: 360
Right 902712212 1:18248229-18248251 CTGTGTACACAGTGGGAGCCTGG 0: 1
1: 0
2: 1
3: 23
4: 257
902712204_902712212 10 Left 902712204 1:18248196-18248218 CCCTTTTGTTTCTTCAACACTCC 0: 1
1: 0
2: 1
3: 40
4: 427
Right 902712212 1:18248229-18248251 CTGTGTACACAGTGGGAGCCTGG 0: 1
1: 0
2: 1
3: 23
4: 257
902712203_902712212 19 Left 902712203 1:18248187-18248209 CCTCTACTTCCCTTTTGTTTCTT 0: 1
1: 0
2: 4
3: 110
4: 1316
Right 902712212 1:18248229-18248251 CTGTGTACACAGTGGGAGCCTGG 0: 1
1: 0
2: 1
3: 23
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902712212 Original CRISPR CTGTGTACACAGTGGGAGCC TGG Intronic
900792905 1:4691474-4691496 CTGGGTACACAGTGGGGCTCGGG + Intronic
900800513 1:4734291-4734313 CTGCGTCCATACTGGGAGCCAGG + Intronic
901847701 1:11994640-11994662 CTAGGCACACAGTGGTAGCCTGG + Intronic
901878321 1:12179611-12179633 CTGTGAACACACTGTGAGCAGGG - Intronic
902103073 1:14009909-14009931 ATGTGTACACACTGGGAAACCGG + Intergenic
902712212 1:18248229-18248251 CTGTGTACACAGTGGGAGCCTGG + Intronic
902728998 1:18356472-18356494 CTGTGAATACAGTGGGACACAGG + Intronic
902866933 1:19285876-19285898 CTGTGTACCAGGTGAGAGCCAGG - Exonic
903005518 1:20295648-20295670 CTGTCTCCACAGTGGCACCCAGG - Intronic
906279729 1:44544889-44544911 CTCTGTACCCAGTGGGAGAATGG - Intronic
906940561 1:50251785-50251807 CTGTAAATACAGTGGGAACCTGG + Intergenic
907444977 1:54501669-54501691 ATGGGTACACAGTGGGGTCCCGG - Intergenic
907706815 1:56839612-56839634 ATGGGTACAGAGTGGGAGGCTGG + Intergenic
909259908 1:73474367-73474389 CTGTGTTCCCAATGGGATCCTGG + Intergenic
911194576 1:94980749-94980771 CTGTGTACTCATTCAGAGCCAGG - Exonic
916071210 1:161171116-161171138 CTGTATAGAGAGTGGGCGCCAGG + Exonic
916179861 1:162073832-162073854 CTGTGTTCAGAGTGGGTACCTGG + Intronic
917271019 1:173274517-173274539 GTGTGTACACAGTGGGAAGAGGG - Intergenic
917592820 1:176494732-176494754 CTCTGCACACACTGGGAGCTGGG + Intronic
917787708 1:178476784-178476806 CTGAGAACACAGTGAAAGCCAGG - Intronic
920028963 1:203024590-203024612 CTGTTCACACAGAGTGAGCCTGG + Exonic
920358196 1:205391701-205391723 AGGTGTCCCCAGTGGGAGCCTGG + Intronic
920530842 1:206701162-206701184 CTGTATTCTCAGTGGGATCCAGG - Intronic
920847905 1:209608887-209608909 CTGTGTATACAGTGGGAGCTTGG + Intronic
920848619 1:209613426-209613448 GTGTGTGCAGAGTGGGAGTCTGG - Exonic
921710938 1:218372389-218372411 ATGTGTTCACAGTGGCAGCAGGG + Intronic
922072337 1:222207113-222207135 TTTTGTATACGGTGGGAGCCAGG + Intergenic
923498555 1:234545458-234545480 CTGTCTCCCCAGTGTGAGCCTGG - Intergenic
924522578 1:244817700-244817722 CTCTTTCCACAGTGGCAGCCTGG + Intergenic
1063334430 10:5198327-5198349 CTGTTTTCAAAGTTGGAGCCTGG + Intronic
1066281222 10:33920029-33920051 CTGTGCACACAGTGGGATTGAGG + Intergenic
1067131106 10:43566228-43566250 CTCAGTCCACAGTGGGACCCTGG - Intronic
1067148817 10:43712861-43712883 CTGTGTGCAAGGTGGGATCCTGG - Intergenic
1068186879 10:53596474-53596496 CTCTGCCCACAGTGGGAGGCAGG + Intergenic
1069566526 10:69467032-69467054 CTGTGCAGAAAGTGGCAGCCGGG - Intronic
1069725042 10:70572017-70572039 TTGTGGACCCAGGGGGAGCCAGG + Intergenic
1070395528 10:76008602-76008624 GTGTGTACCCGGTGGGAGGCAGG - Intronic
1070630566 10:78081777-78081799 CTGTGTAGAGAGCGGGAGCAAGG + Intergenic
1070648764 10:78220084-78220106 CTGTGGACACAATGGGAGTCTGG + Intergenic
1071564141 10:86662919-86662941 ATGTGCTCACTGTGGGAGCCTGG + Intronic
1072411247 10:95203986-95204008 CTGGGGAAACACTGGGAGCCTGG - Intronic
1073180286 10:101579254-101579276 CTGGGCAGACACTGGGAGCCGGG + Exonic
1074545515 10:114399314-114399336 GAGGGTACACAGTGGGAGTCAGG + Intronic
1076526783 10:131117123-131117145 CTGTGTTCAGGGTGGGAGGCTGG + Intronic
1076764872 10:132627541-132627563 CTGGGGACACAGAGGGAGTCGGG - Intronic
1078198286 11:9155451-9155473 CTCTGTAAACATTGTGAGCCAGG - Intronic
1082011677 11:47453895-47453917 CTGCGGACACAGTGGGATCTCGG + Intergenic
1083278180 11:61609207-61609229 CTGTGGACACAGTGAGGCCCCGG - Intergenic
1083720835 11:64602776-64602798 CTGTGGACACTGTGGGCCCCTGG - Intergenic
1084604650 11:70165458-70165480 CTCTGTCCACAGTGTGCGCCAGG + Exonic
1084909030 11:72372805-72372827 CTGGGCACACAGTGGGTGCTGGG + Intronic
1085751702 11:79167816-79167838 CTGTGGACACAGAAGGAGCCTGG - Intronic
1087452879 11:98346910-98346932 CTCTGTTCAAAATGGGAGCCAGG - Intergenic
1089900737 11:121981024-121981046 CTGTGTACACAAGGGGATCTTGG + Intergenic
1090608455 11:128449283-128449305 TTGTGTGCAAAATGGGAGCCTGG + Intergenic
1090652300 11:128817729-128817751 CTCTGTACACTGAGGGAGCCTGG - Intergenic
1096115883 12:49054741-49054763 GTGTGTCCACAGTGGGGGTCCGG - Exonic
1096237833 12:49942098-49942120 CTGTCCCCACAGTGGGAGCAAGG - Intergenic
1096559919 12:52428789-52428811 CTGTGTGCACAGCGAGTGCCTGG - Intronic
1096924665 12:55130261-55130283 CTGTGTACTCAGTTGGTGGCTGG + Exonic
1100721986 12:97368959-97368981 ATGGGTGCACAGTGGGAGTCCGG - Intergenic
1101015082 12:100491732-100491754 CTGTGTCCACTGTGGGTTCCAGG - Intronic
1103180339 12:118905827-118905849 CTGGGTACAAAGTGGAAGGCAGG - Intergenic
1103850576 12:123930335-123930357 CTGTGTGCACCCTGGGGGCCCGG - Exonic
1104742389 12:131188279-131188301 CTATGGAGCCAGTGGGAGCCAGG + Intergenic
1110134474 13:72048370-72048392 CTATGTACAGAGTGGGAGAAAGG + Intergenic
1110500844 13:76226112-76226134 GTGTGTGCACAGTGGGAACAAGG - Intergenic
1112398271 13:99053146-99053168 ATGTGAACACAGTGGCAGCTGGG - Intronic
1112842890 13:103601389-103601411 CTGAGTCCACAGTGGCAGCCCGG + Intergenic
1113454997 13:110442171-110442193 CTGTGTAAACAGTGGCCACCTGG + Intronic
1113675106 13:112201821-112201843 CTGTGTGCACATTGGAAGCTGGG + Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114547763 14:23514775-23514797 CTGTGCACATAGTGGTGGCCAGG + Intergenic
1118725670 14:68627387-68627409 GTGTGTCCACAGTTGGAGCAGGG + Intronic
1121007664 14:90500646-90500668 ATGTGAGCACAGTGGGGGCCTGG + Intergenic
1122573873 14:102728390-102728412 CTGTGTACACCGAGGGCGGCAGG + Exonic
1122605386 14:102944606-102944628 CTGTGTGCACAGCCTGAGCCCGG + Intronic
1122772351 14:104103038-104103060 CAGTGGGCACAGTGGGTGCCTGG + Intronic
1122890171 14:104728591-104728613 GTGTGTGCACACTGGGCGCCAGG + Intronic
1124139958 15:27068381-27068403 CTCTGTGCACTGTAGGAGCCTGG + Intronic
1124442612 15:29698246-29698268 CTGTGTACACAGATGCATCCGGG - Intergenic
1125477393 15:40056194-40056216 CTGAGTACACAGTGGACTCCTGG - Intergenic
1125518862 15:40337447-40337469 CTGTGTAGACAGAGGGAGTCAGG + Intronic
1126486546 15:49187752-49187774 TTGGGTAAACAGTGGGAGCCAGG - Intronic
1127028994 15:54840773-54840795 CTGTGTTCCCAGTGTGAGCTAGG - Intergenic
1127883067 15:63174957-63174979 CTCTCTACACAGTGGGCCCCAGG + Intergenic
1128335128 15:66780896-66780918 CTGTCTGCACAGTGGGAGCTGGG - Intronic
1129361927 15:75029708-75029730 CTGGGTACACAGCGGGTGGCTGG - Intronic
1129392994 15:75229749-75229771 CTGTGCACCCGGTGGGGGCCAGG + Intergenic
1129436792 15:75547959-75547981 CTCTGTACCCAGTAGGGGCCAGG - Intronic
1129681429 15:77660536-77660558 CTCTGTACCAAGTGGGAGCAGGG + Intronic
1131069259 15:89454937-89454959 CGGGGAACACAATGGGAGCCAGG + Intergenic
1134122849 16:11596871-11596893 CTGAGTACCCACTGGGTGCCAGG + Intronic
1137724547 16:50648147-50648169 CTGGGTTCACAGTGGGGCCCAGG - Intergenic
1139551378 16:67674932-67674954 CTGTGCACACCGTGGTAACCTGG + Exonic
1140558892 16:75954424-75954446 CGGTGCACACAGAGGGAGCCTGG + Intergenic
1140663698 16:77211008-77211030 CTGTGTAGAAAGTGGGAACAGGG + Intronic
1141027446 16:80561545-80561567 TTGTGTTCACACTGGGATCCAGG - Intergenic
1141461167 16:84179588-84179610 CTGTCCACACAGGAGGAGCCAGG + Exonic
1141798569 16:86291610-86291632 CTGGGTTCACAGTGGGTGGCAGG - Intergenic
1141805906 16:86341343-86341365 CTGTGGACACACAGGGAGCGCGG + Intergenic
1141895569 16:86956769-86956791 CTGAGTGCACAGTGGGCACCCGG + Intergenic
1141912697 16:87070837-87070859 CTGTGCACACAGGGAGAGGCTGG + Intergenic
1142030906 16:87838053-87838075 CTCTGGCCACAGTGGGAACCAGG + Intronic
1142144310 16:88486445-88486467 CTGAGTGCACAGTGGGTGCTGGG + Intronic
1142144325 16:88486519-88486541 CTGGGTGCACAGTGGGTGCTAGG + Intronic
1142144333 16:88486559-88486581 CTGGGTACACAGTGGGTGCTAGG + Intronic
1142144353 16:88486657-88486679 CTGGGTGCACAGTGGGTGCTAGG + Intronic
1142144357 16:88486675-88486697 CTAGGTACACAGTGGGTGCTGGG + Intronic
1142358502 16:89615318-89615340 CTCTGTACCCAGTGGGAGCTGGG - Intronic
1142571682 17:878646-878668 CTGTGTAGACAGGGTGAGACTGG + Intronic
1143181304 17:4986156-4986178 CTGTGGCCACATTGGGAACCTGG + Intronic
1144839642 17:18177983-18178005 CATTGTGCACTGTGGGAGCCAGG + Intronic
1146621474 17:34401845-34401867 CTGAGTGCCCAGTGGGTGCCAGG - Intergenic
1147342915 17:39765646-39765668 CTGTGTTCACAGGGGTAGCCAGG - Exonic
1147940215 17:44041481-44041503 CTGTGCTCACATAGGGAGCCAGG + Intronic
1147979966 17:44268241-44268263 CTGGGCACCCAGTGGGAGCGGGG - Intergenic
1148784999 17:50141807-50141829 CTGTGTGGGCAGTGAGAGCCAGG + Intronic
1148909772 17:50935198-50935220 CTGTTTTCACAGTGGGAAGCAGG - Intergenic
1150459253 17:65333528-65333550 CTATGTACAATGTGGGAGCATGG - Intergenic
1150788666 17:68182834-68182856 CTGTGTTCCCAGTGGAATCCTGG - Intergenic
1154331240 18:13430524-13430546 CGTTGTACACAGTGAGATCCCGG + Intronic
1156030256 18:32704849-32704871 CTGTCTACACAGTGGGCTCTGGG - Intronic
1156497780 18:37537336-37537358 CTGTGTACACGCTGAGAGCCTGG + Intronic
1157087657 18:44598025-44598047 ATGTGAACACAGTCTGAGCCTGG - Intergenic
1157779752 18:50427768-50427790 CTGGGGACATAGTGGGAGGCAGG + Intergenic
1158235075 18:55303210-55303232 GTGTGTACGTACTGGGAGCCAGG - Intronic
1158445692 18:57518522-57518544 CCTTGGAGACAGTGGGAGCCTGG - Intergenic
1160031940 18:75269556-75269578 CTGACTCCACAGAGGGAGCCTGG + Intronic
1160125252 18:76165717-76165739 CTGTGTTCCAAGTGGGAGCTGGG + Intergenic
1160480618 18:79236895-79236917 CTGTGTACACAGTGGGGAAGGGG - Intronic
1160480627 18:79236946-79236968 CTGTGTACACAGTGGGGAAGGGG - Intronic
1160480650 18:79237055-79237077 CTGTGTACACAGTGGGGAAGGGG - Intronic
1160480673 18:79237164-79237186 CTGTGTACACAGTGGGGAAGGGG - Intronic
1160534684 18:79585718-79585740 GTGGGGACACAGTGGGAGCATGG - Intergenic
1160854840 19:1212095-1212117 CTGTGCACACAGTGGGCTTCCGG + Intronic
1161718673 19:5891732-5891754 ATGTGTACCCAGCGGGAGGCTGG - Exonic
1162042542 19:7979416-7979438 CTGTTTACACACTGGGCACCCGG + Intronic
1162440634 19:10690061-10690083 CTCTGTAGATGGTGGGAGCCTGG - Exonic
1162997150 19:14343414-14343436 CTGTGTTCACAGAGCCAGCCAGG + Intergenic
1164713758 19:30376910-30376932 CTGTGTGCACAGTGGGTACGGGG + Intronic
1165167131 19:33864530-33864552 CTGTCTACAGGGTGGAAGCCAGG + Intergenic
1166053350 19:40274241-40274263 CTGGGGACACAGTGGGGGCTAGG - Intronic
1166678777 19:44755055-44755077 GCGTGTACACAGTGGGTGGCAGG - Intronic
925177004 2:1793150-1793172 CTGTGGGCACAGTGCCAGCCTGG - Intronic
925811255 2:7702926-7702948 CAGAGTACCCAGTGGGTGCCAGG + Intergenic
927149824 2:20189120-20189142 CAGGTTACACAGTGGGAGGCAGG + Intergenic
928268915 2:29837019-29837041 CTGTGTTCACAGTGGGATCAGGG - Intronic
928495586 2:31828657-31828679 CTGTGGACACACCTGGAGCCTGG - Intergenic
929918857 2:46158066-46158088 CTGAGTGTACAGTGGGAACCAGG + Intronic
931345800 2:61445000-61445022 CTGTATAAACAATGGAAGCCAGG + Intronic
931832416 2:66066418-66066440 GTATGGAGACAGTGGGAGCCCGG + Intergenic
932385052 2:71324252-71324274 CTGTGTACACAGTGCTATCAGGG + Intronic
932408007 2:71526773-71526795 CTGTGAAGACAGTGGGGCCCAGG - Intronic
932702454 2:74001138-74001160 CTGTGTTCCCAGGGGGAGGCAGG + Intronic
933698900 2:85240292-85240314 TTGTGAACACAGAGGAAGCCGGG + Intronic
935676383 2:105598097-105598119 CAGTGCACAGAGTGGGAGGCAGG - Intergenic
936182000 2:110275106-110275128 CTGGGACCACAGTGGGGGCCTGG + Intergenic
936230569 2:110696567-110696589 CTGGGACCACAGTGGGGGCCTGG - Intergenic
937361249 2:121231581-121231603 CTGGGTGCCCGGTGGGAGCCAGG - Intronic
937677616 2:124609162-124609184 CTCAGTATACAGTGGGAGCAAGG + Intronic
939620298 2:144410684-144410706 CTGTGTTCACAGTGGAAGACAGG + Intronic
940235975 2:151511195-151511217 TTGTGTTCACTGAGGGAGCCAGG - Intronic
941226721 2:162858658-162858680 CTTTGTTCACAGAGGGAGACAGG + Intergenic
944006874 2:194920341-194920363 CAGTCTTCACAGTGAGAGCCTGG - Intergenic
947179004 2:227395578-227395600 CTGTGTGCCCAGAGGGAGGCTGG - Intergenic
948252193 2:236538414-236538436 CTGTGGCCACAGCGGAAGCCAGG + Intergenic
948763879 2:240209653-240209675 CCGGGCACACAGTGGGAGTCTGG - Intergenic
948775269 2:240284720-240284742 CTGTGTGGGCAGTGGGACCCGGG + Intergenic
948894011 2:240919896-240919918 CTGTCTCCACGGTGGGACCCTGG - Intronic
1168758103 20:329764-329786 CTGTTTTCCCAGTAGGAGCCAGG + Exonic
1170574995 20:17655640-17655662 CAGTGTAAACTGTGGCAGCCAGG - Intronic
1173648116 20:44646211-44646233 CTGTGTTCACACAGGGAGGCAGG - Intronic
1173661433 20:44736974-44736996 CTGTCTGCACAGTGGAAGCTGGG - Intergenic
1175075834 20:56372189-56372211 TTGTGTGCTCAGTGGGTGCCAGG - Intronic
1175123583 20:56735526-56735548 CTGTGTGCACAGTAGGTGCTCGG + Intergenic
1175869523 20:62201742-62201764 CTCTGTGCTCAGTGGGAGCCAGG + Exonic
1177404209 21:20645313-20645335 CTGTGGAGCCTGTGGGAGCCAGG + Intergenic
1179955407 21:44735487-44735509 CTGGGTAAACACTGGGAGCTGGG - Intergenic
1181068369 22:20317174-20317196 CTGTAGGCACAGCGGGAGCCAGG - Intronic
1183392431 22:37553045-37553067 GTGTGCAAACAGTGAGAGCCAGG - Intergenic
1184111424 22:42397846-42397868 CTGTCTACACAGTGAGTCCCGGG - Exonic
1184142759 22:42587974-42587996 CTTTGTATACAGTGGGAGTGTGG - Intronic
1184155640 22:42665009-42665031 CTGTGTACAGGGAGGCAGCCTGG - Intergenic
1184221967 22:43106617-43106639 TTGTGTCCTCTGTGGGAGCCTGG + Intergenic
1184233930 22:43173118-43173140 CTGTGTACATAGTCAGAGGCTGG - Intronic
1184512024 22:44939529-44939551 CTGTGAGCACAGTGGGGACCAGG + Intronic
1184615514 22:45635506-45635528 TTGTGAGCACAATGGGAGCCTGG - Intergenic
1185122044 22:48977162-48977184 GTGTTGACACAGTGGCAGCCCGG + Intergenic
1185287363 22:50008548-50008570 CTTTGTCCACCGTGGGAGGCAGG - Intronic
950127961 3:10522132-10522154 CTGTGTACCTACTGTGAGCCAGG + Intronic
951566991 3:24020465-24020487 CTGTGGAGCCAGTGGGGGCCAGG - Intergenic
953915070 3:46913892-46913914 CTGTGGACAGGGTTGGAGCCAGG + Intergenic
953985891 3:47442754-47442776 CTTTTTACACAATGGGAGCTTGG - Intronic
954135959 3:48582348-48582370 CTCTCTCCACAGGGGGAGCCTGG - Exonic
956937311 3:74117866-74117888 CTGGGTACACTTTGGGAGGCAGG - Intergenic
957548735 3:81676235-81676257 CTGTGAACACTGTGGGGGCTAGG - Intronic
962245861 3:133791751-133791773 CTCTTTTCACAGTGGCAGCCTGG + Intronic
963334727 3:143961546-143961568 CTAGGTACAGAGTGGAAGCCAGG - Intergenic
964195049 3:154054149-154054171 CAGTGAAAACAGTGGTAGCCTGG + Intergenic
967019523 3:185510302-185510324 CTGTGGACAGAGAGGGAGACAGG - Intronic
968939262 4:3629637-3629659 CTCTGGACTCAGAGGGAGCCAGG - Intergenic
969136148 4:5030511-5030533 ATGTGGATACAGTGTGAGCCGGG + Intergenic
969571059 4:8008635-8008657 CTGTGAACGCAGCCGGAGCCAGG - Intronic
970353811 4:15232780-15232802 CTTAGTACACAGTGGGTGCTAGG - Intergenic
973811257 4:54572398-54572420 CAGTGGATACAGTGGGATCCAGG - Intergenic
978397934 4:108302305-108302327 CTGTGTAAGGAGTGTGAGCCAGG + Intergenic
978827973 4:113047616-113047638 CTGTGACCACAGTGGGAGTTGGG + Intronic
980544661 4:134244109-134244131 CTGTGAAGCAAGTGGGAGCCAGG + Intergenic
980738106 4:136917427-136917449 CTGTGGAGCCAGAGGGAGCCAGG + Intergenic
981349718 4:143715486-143715508 CTGTGTACACAGTGCACACCAGG - Intergenic
982257510 4:153465664-153465686 CAGTGTCCACAGAGGGTGCCGGG + Intergenic
983323683 4:166227054-166227076 CTGTGGAACCAGTGGGAGCTGGG + Intergenic
984052160 4:174877756-174877778 CTATGTACATTGTGGGAGGCAGG + Intronic
985863868 5:2496105-2496127 CTGTATCCACAGTGGTTGCCAGG - Intergenic
993497757 5:88627083-88627105 CTGTTTTAACAGTGGGAGACTGG + Intergenic
994236163 5:97365551-97365573 CTGTGTTCAGAGTGGGAACAGGG + Intergenic
998203804 5:140145466-140145488 TTGAGTGCACATTGGGAGCCTGG - Intergenic
999887309 5:155937222-155937244 CTATGGAGCCAGTGGGAGCCGGG - Intronic
1001316133 5:170642360-170642382 CTGTGCACACAGTGCCAGCAAGG + Intronic
1002078500 5:176723844-176723866 CTGTGTACACAGAGAGGGGCTGG - Intergenic
1002300791 5:178256387-178256409 ATGTCTCCACAGGGGGAGCCTGG - Exonic
1002440253 5:179260638-179260660 CTGTAGAAACAGTGGGAGCCAGG - Intronic
1003127895 6:3370394-3370416 CTTCGTACAAAGTGAGAGCCAGG - Intronic
1007083673 6:39127515-39127537 CTGTGGAGACTGTGGGAGCCTGG - Intergenic
1008421924 6:51311044-51311066 CTTTCTACAGAGTGGGACCCTGG - Intergenic
1013462266 6:110386562-110386584 AGGTTTACACAGTGGAAGCCAGG - Intergenic
1015874463 6:137808918-137808940 CTGTGAGCACAGTGTAAGCCAGG + Intergenic
1015930502 6:138354714-138354736 CTGGGAACACGGTGGGAGCCTGG - Intergenic
1016728821 6:147406491-147406513 CTTTCTTCATAGTGGGAGCCAGG + Intergenic
1019115201 6:169754914-169754936 TTGTATATACAGTGTGAGCCTGG + Intronic
1019594231 7:1851021-1851043 CTGCGTCCACCGTGGCAGCCCGG + Intronic
1019597755 7:1866159-1866181 CCGGGTGCACACTGGGAGCCAGG + Intronic
1019709136 7:2510435-2510457 CTGAGTACTCTGTGGGTGCCGGG + Intergenic
1020259979 7:6525896-6525918 CTGTGTCCACAGGGAGGGCCGGG - Intronic
1022123396 7:27332310-27332332 CTGGGTACAGAGTGGGAACTGGG - Intergenic
1022322395 7:29299185-29299207 CGGTCTACGCAGTGGGAGCACGG - Intronic
1024324954 7:48102211-48102233 CTGTCTACACAGTGTGAGGGTGG + Intronic
1026523620 7:71136368-71136390 CTTGGTACAGAGTGGGAGCCAGG + Intronic
1027423357 7:78038692-78038714 CTTTGTAAACTGTGGGAGGCAGG + Intronic
1029400575 7:100342869-100342891 CTGGGTTCACACTGGGAACCCGG + Intronic
1031034901 7:116778206-116778228 CTGTCAACACAGGCGGAGCCAGG - Intronic
1035196197 7:157222792-157222814 CTGTATACACAGTAGGCCCCAGG - Intronic
1035457929 7:159021338-159021360 CCTTGTACACAGTGACAGCCAGG + Intergenic
1035617128 8:1010902-1010924 CAGTCTACACAGTGGGCCCCAGG + Intergenic
1036124671 8:6052009-6052031 CTGCCTCCACCGTGGGAGCCCGG + Intergenic
1036642391 8:10592565-10592587 CTGTGGTCACAGTGAGACCCCGG - Intergenic
1038954102 8:32448680-32448702 CTGTGTAAACAATGGGAGGGAGG + Intronic
1041414961 8:57597812-57597834 CTGGGGGCACTGTGGGAGCCAGG - Intergenic
1042398473 8:68318008-68318030 CCGTGTGCAGAGTGGGAGCTGGG - Intronic
1042437374 8:68783203-68783225 CTTTGAACAGAGTGGGAGGCAGG - Intronic
1044371478 8:91416898-91416920 CTGTGCACACAGTGGTACCCCGG + Intergenic
1045375082 8:101564431-101564453 ATGTGTGCACAGTGGTAGCAGGG + Intronic
1046938842 8:119911611-119911633 ATGTGTACACAGCAGGGGCCAGG - Intronic
1048281987 8:133112467-133112489 CTGTCTGCACTGTGGGAGTCTGG - Intronic
1048876813 8:138843134-138843156 CTATGTGCACAGTGGGAGAAAGG - Intronic
1048996030 8:139794197-139794219 CTGGGACCACAGTGGGAGCCAGG - Intronic
1049015997 8:139920510-139920532 CTGCCTACACAGTGGCAGCCAGG + Intronic
1049338868 8:142101236-142101258 CTGGGTGCACACTTGGAGCCAGG + Intergenic
1049475713 8:142796122-142796144 CTGAGAACACTGTGGGCGCCAGG + Intergenic
1050545604 9:6706293-6706315 CTTTGAATACAGTGGGAGGCAGG + Intergenic
1051149515 9:14065264-14065286 CTATATACACACTGGTAGCCAGG + Intergenic
1051368989 9:16342183-16342205 CTATGTACACAGTGGTGGGCGGG - Intergenic
1052652512 9:31321930-31321952 CAGTGGAGCCAGTGGGAGCCGGG - Intergenic
1052700110 9:31927764-31927786 CTATGTAAACAGTGGGACTCAGG - Intergenic
1053140424 9:35679358-35679380 GTGTGGACACAGTGGGTGCGGGG + Intronic
1054451492 9:65405684-65405706 CTCTGGACTCAGAGGGAGCCAGG + Intergenic
1059438076 9:114288443-114288465 CTGTGTCCACAGGGGGAGCAGGG + Exonic
1059493930 9:114693942-114693964 CTATCTATACAGTGGGAGCAAGG - Intergenic
1061663272 9:132145011-132145033 CTGAGTACAAAGTGAGATCCTGG - Intergenic
1062035891 9:134382372-134382394 CTGGGGAGACAGTGGGGGCCAGG + Intronic
1062302907 9:135885469-135885491 CTCTGTGCAGAGTGGGAGACGGG + Intronic
1185702956 X:2245133-2245155 CTTTGAACAGAGTGGGAGGCAGG - Intronic
1187909759 X:24100812-24100834 CTGTATACACAGTCTCAGCCAGG + Intergenic
1189194806 X:39143854-39143876 CTGTGTTTGCAGTGGGAGCATGG + Intergenic
1190247611 X:48700797-48700819 CTGTGTTCACAGTGTGCACCCGG + Intronic
1193239324 X:79148170-79148192 TTGTGCCCACCGTGGGAGCCAGG + Intergenic
1194806884 X:98340346-98340368 TTTTGTATACAGTGGGAGACAGG + Intergenic
1197654436 X:129101215-129101237 TGGTGTACACATTGTGAGCCTGG + Intergenic
1198882558 X:141296715-141296737 TTTTGTATACAGTGGGAGACAGG - Intergenic
1199887163 X:152031606-152031628 CTTTGAATACAGTGGGAGGCAGG + Intergenic
1201920260 Y:19226345-19226367 ATGAAAACACAGTGGGAGCCTGG - Intergenic