ID: 902715543

View in Genome Browser
Species Human (GRCh38)
Location 1:18270207-18270229
Sequence TTGGAGAGTGAGTGGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 764
Summary {0: 1, 1: 0, 2: 3, 3: 78, 4: 682}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902715543_902715550 21 Left 902715543 1:18270207-18270229 CCTGCCATCCACTCACTCTCCAA 0: 1
1: 0
2: 3
3: 78
4: 682
Right 902715550 1:18270251-18270273 TGAAGACCTCAATTTAAACAAGG 0: 1
1: 0
2: 0
3: 18
4: 242
902715543_902715551 22 Left 902715543 1:18270207-18270229 CCTGCCATCCACTCACTCTCCAA 0: 1
1: 0
2: 3
3: 78
4: 682
Right 902715551 1:18270252-18270274 GAAGACCTCAATTTAAACAAGGG 0: 1
1: 0
2: 0
3: 17
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902715543 Original CRISPR TTGGAGAGTGAGTGGATGGC AGG (reversed) Intronic
900002293 1:21384-21406 AGGGAGAGAGAGTGGATGCCAGG - Intergenic
900022012 1:191908-191930 AGGGAGAGAGAGTGGATGCCGGG - Intergenic
900535663 1:3175951-3175973 TGGGTGAGTGAGTGGATGGATGG - Intronic
900573478 1:3371492-3371514 TGGGTGAGTGGGTGGATGGATGG - Intronic
900649957 1:3725835-3725857 TGGGTGGGTGAGTGGATGGATGG + Intronic
900687249 1:3956681-3956703 TTGTTGAGTGAGTGAATGGGCGG + Intergenic
900735310 1:4296071-4296093 TTGATGAGTGGGTGGATGGATGG - Intergenic
900747756 1:4372870-4372892 TTGGTGGGTGGGTGGATGGGTGG - Intergenic
900747801 1:4373107-4373129 TGGGTGAGTGAGTGGATGGATGG - Intergenic
901006534 1:6174380-6174402 TTGTATAGTGAATGGATGGATGG + Intronic
901177951 1:7318320-7318342 TTGGTCAGTGACTGGTTGGCTGG + Intronic
901318036 1:8322112-8322134 TTGGTGACTGAGTGGGTGGATGG + Intronic
901831340 1:11894386-11894408 TGGGTGGGTGAGTGGATGGATGG + Intergenic
902054021 1:13585222-13585244 TTGGAGAGGGAGCGGTTTGCAGG + Intronic
902163537 1:14551653-14551675 TTGGTGAGTTAGTGGGTGGAGGG + Intergenic
902202612 1:14845148-14845170 ATGGATAGTGAGTGGATGGGTGG + Intronic
902202625 1:14845196-14845218 TGGGTGAGTGAGTGGATGGGTGG + Intronic
902202638 1:14845240-14845262 TGGGTGAGTGGGTGGATGGTTGG + Intronic
902274762 1:15331405-15331427 TTGGTGGGTGGGTGGATGGATGG + Intronic
902603863 1:17558006-17558028 TGGGCGAGTGGGTGGATGGTGGG - Intronic
902665251 1:17933100-17933122 TTTGGGAGTGGGTGGATGGGTGG - Intergenic
902715543 1:18270207-18270229 TTGGAGAGTGAGTGGATGGCAGG - Intronic
902816262 1:18918317-18918339 TGGGAGAGTGGGGGGTTGGCTGG + Intronic
903066674 1:20703541-20703563 TGGGTGAGTGGGTGGATGGATGG + Intronic
903287130 1:22284351-22284373 TGGGTGAGTGGGTGGATGGCTGG - Intergenic
903294263 1:22333655-22333677 TGGGTGATTGAGTGGATGGATGG + Intergenic
903294703 1:22336353-22336375 TAGGTGACTGAGTGGATGGGTGG - Intergenic
903294715 1:22336433-22336455 TGGGTGATTGAGTGGATGGATGG - Intergenic
903294721 1:22336481-22336503 TAGGTGATTGAGTGGATGGATGG - Intergenic
903294753 1:22336661-22336683 TGGGTGATTGAGTGGATGGATGG - Intergenic
903294773 1:22336765-22336787 TGGGTGATTGAGTGGATGGGTGG - Intergenic
903294803 1:22336941-22336963 TGGGTGATTGAGTGGATGGATGG - Intergenic
903294811 1:22336989-22337011 TGGGTGATTGAGTGGATGGATGG - Intergenic
903294819 1:22337037-22337059 TGGGTGATTGAGTGGATGGAGGG - Intergenic
903294827 1:22337085-22337107 TGGGTGATTGAGTGGATGGATGG - Intergenic
903294835 1:22337133-22337155 TGGGTGATTGAGTGGATGGATGG - Intergenic
903294853 1:22337233-22337255 TGGGTGATTGAGTGGATGGATGG - Intergenic
903294867 1:22337328-22337350 TAGGTGATTGAGTGGATGGATGG - Intergenic
903294872 1:22337360-22337382 TGGGTGATTGAGTGGATGGAGGG - Intergenic
903294881 1:22337408-22337430 TGGGTGATTGAGTGGATGGATGG - Intergenic
903374976 1:22860188-22860210 TTGGAGAGTGGGTGGGTGGGAGG + Intronic
904043831 1:27598950-27598972 TTGGAGAGGGAGTGGGGGACAGG - Intronic
905945865 1:41901024-41901046 CTGGAGAGGGAGTGGACGTCAGG + Intronic
906202394 1:43968367-43968389 TTGGGGGGTGGGTGGGTGGCAGG + Intergenic
907182071 1:52579402-52579424 TTGGAGAGGGATTGGATGTGTGG - Intergenic
907420100 1:54341492-54341514 TTGTGGAATGAATGGATGGCAGG - Intronic
908391382 1:63686759-63686781 TGGGTGAGTGGGTGGATGGTTGG - Intergenic
909059640 1:70865482-70865504 TTGGAGAGTCACTGGATGTTGGG + Intronic
910167178 1:84339730-84339752 TTGAGGAGTGAGTGGGAGGCAGG + Intronic
910425318 1:87115278-87115300 GTGGGAAGTGAGGGGATGGCTGG - Intronic
911606333 1:99909419-99909441 GTGGAGACTGAGTGGAAGCCTGG - Intronic
912580363 1:110715440-110715462 TGGGTGAGTGGGTGGATGGATGG - Intergenic
913004876 1:114619514-114619536 TTGGGGGGTGAGTGGTTGGCAGG - Intronic
913703287 1:121395897-121395919 ATGGAGATGGAGTGGAAGGCCGG - Intergenic
913979461 1:143497061-143497083 ATGGAGATGGAGTGGAAGGCCGG - Intergenic
914073865 1:144322711-144322733 ATGGAGATGGAGTGGAAGGCCGG - Intergenic
914105289 1:144643649-144643671 ATGGAGATGGAGTGGAAGGCCGG + Intergenic
914696427 1:150085588-150085610 TTTGATAGTAAGTGGATGTCAGG + Intronic
914799681 1:150951376-150951398 CTGGATAGTTAGTTGATGGCAGG - Exonic
915562713 1:156696738-156696760 TTGGTCACTGAGTGGCTGGCGGG - Intergenic
916152754 1:161811736-161811758 TTGGATGGTGGGTGGATGGGTGG - Intronic
916399289 1:164428741-164428763 TAGGAGGGTGAGTAGATGGGTGG - Intergenic
916768160 1:167882053-167882075 TTAGTGAGTGAGTGGATGTGGGG + Intronic
916808103 1:168279946-168279968 ATGGCGAGTGAGTGGATGGCGGG - Intergenic
917346502 1:174033682-174033704 TGGGAGTTTTAGTGGATGGCAGG + Intergenic
918194994 1:182212951-182212973 ATGGAGTGTAAGTAGATGGCTGG + Intergenic
918784379 1:188747291-188747313 TTGAGGAGTGAGTGGCAGGCAGG + Intergenic
919162722 1:193852543-193852565 TTGGAGAGTATCTAGATGGCTGG - Intergenic
919288057 1:195590945-195590967 TGGGAAAGTTAGTGGAGGGCTGG + Intergenic
920125372 1:203690054-203690076 TTGGGGAGTAAGTGGCAGGCGGG + Intronic
920848704 1:209614002-209614024 GTAGAGAGTGCATGGATGGCTGG + Intergenic
920994270 1:210972960-210972982 TAGAAGAGTGAGTAGATGGGAGG - Intronic
921825597 1:219668605-219668627 TTGTTGAGTGATTGGCTGGCTGG - Intergenic
922506924 1:226131862-226131884 GTGGAGAGTGAATGCATGGAAGG - Intergenic
923766886 1:236900825-236900847 TTGGGGAATGAGTGGATGGCTGG + Exonic
924511497 1:244731911-244731933 ATGGAGAGTGAGTGGAATGAAGG + Intergenic
1062943709 10:1444333-1444355 TGGATGGGTGAGTGGATGGCTGG - Intronic
1063933278 10:11050869-11050891 TGGGCGAGTGAGTGAATGGTAGG - Intronic
1064598799 10:16972720-16972742 TTGAAGAATGAATGAATGGCCGG - Intronic
1065719420 10:28611775-28611797 TCGGAGACTGATTAGATGGCTGG - Exonic
1066688826 10:38006795-38006817 TTAGAGAGTGAGGGGATAGTGGG + Intergenic
1067289054 10:44928266-44928288 TTGGTGGGTGAGTGGATGGATGG - Intronic
1067659209 10:48221891-48221913 TGGGTGGGTGAGTGGATGGATGG + Intronic
1067751647 10:48975699-48975721 ATGGAGTGTGAATGGATGGGTGG + Intronic
1067983676 10:51116748-51116770 TGGGAGAGAGGGTGGAAGGCTGG + Intronic
1070379584 10:75868769-75868791 ATGGAGAGAGAGAGGAGGGCGGG - Intronic
1070416172 10:76191576-76191598 TTGGAGAGTGGATAGAAGGCAGG + Intronic
1070959720 10:80490155-80490177 CTGCAGAGTGAGGGGATGGATGG + Intronic
1071451952 10:85803086-85803108 TTGGAGGGTAAGTGGAAGGTGGG + Intronic
1072465866 10:95661933-95661955 TGGGAGAGTGAGTGGGAGGGAGG - Intergenic
1072783917 10:98267963-98267985 TTGGTGAGCGACTGGAGGGCCGG + Intronic
1074767905 10:116714072-116714094 TGGGTGGGTGAGTGGATGGATGG + Intronic
1075967920 10:126628799-126628821 ATGGAGAGTGAGTGGTGGGCAGG - Intronic
1076278133 10:129223493-129223515 TGGGTGAGTGAGTGGGTGACTGG + Intergenic
1076602825 10:131670061-131670083 TGGGTGAGTGAATGGATGGATGG + Intergenic
1076638584 10:131899484-131899506 GTGCAGAGTGAGTGGAGGGGAGG - Intergenic
1076763180 10:132615823-132615845 TTGGAGACTGAGGGGCTGGGAGG + Intronic
1076845037 10:133065763-133065785 TGGATGAGTGAGTGGATGGGTGG + Intergenic
1076931709 10:133536370-133536392 TAGGGGAGTGGATGGATGGCTGG + Intronic
1077150247 11:1069959-1069981 TGGGTGGGTGAGTGGATGGATGG - Intergenic
1077312230 11:1894026-1894048 TAGGTGGGTGGGTGGATGGCTGG + Intergenic
1077315999 11:1919625-1919647 TTGGCCAGTGACTGGGTGGCCGG - Exonic
1077357405 11:2124900-2124922 TGGAGGAGTGAGTGGATGGATGG + Intergenic
1077357436 11:2125075-2125097 ATGGAGGGTGAGTGGATGGATGG + Intergenic
1077357457 11:2125166-2125188 ATGGAGGGTGAGTGGTTGGATGG + Intergenic
1077357475 11:2125264-2125286 ATGGAGGGTGAGTGGATGGATGG + Intergenic
1077357494 11:2125362-2125384 ATGGAGGGTGAGTGGATGGATGG + Intergenic
1077357512 11:2125451-2125473 ATGGAGGGCGAGTGGATGGATGG + Intergenic
1077357529 11:2125540-2125562 ATGGAGGGCGAGTGGATGGATGG + Intergenic
1077357549 11:2125635-2125657 ATGGAGGGTGAGTGGATGGATGG + Intergenic
1077357567 11:2125730-2125752 ATGGAGGGTGAGTGGATGGATGG + Intergenic
1077357588 11:2125821-2125843 ATGGAGGGTGAGTGGTTGGATGG + Intergenic
1077357606 11:2125919-2125941 ATGGAGGGTGAGTGGATGGATGG + Intergenic
1077357626 11:2126014-2126036 ATGGAGGGTGAGTGGATGGATGG + Intergenic
1077357644 11:2126112-2126134 ATGGAGGGTGAGTGGATGGATGG + Intergenic
1077357662 11:2126202-2126224 ATGGAGGGTGCGTGGATGGATGG + Intergenic
1077357683 11:2126290-2126312 TGGGAGGGTGAGTGGATGGATGG + Intergenic
1077357707 11:2126401-2126423 TGGGAGGGTGAGTGGATGGATGG + Intergenic
1077357778 11:2126708-2126730 TGGGTGGGTGAGTGGATGGTTGG + Intergenic
1078550709 11:12278773-12278795 TTCCAGAGTGACTGAATGGCTGG + Intronic
1078775437 11:14389460-14389482 ATGGACAGTGAGTGACTGGCTGG - Intergenic
1078932119 11:15920745-15920767 TGGGAGGGTGGGTGGATGGATGG + Intergenic
1079386181 11:19981807-19981829 TTGGAGGGTGGCTGGATGGATGG + Intronic
1079478522 11:20857335-20857357 GAGGGGAGTGAGTGGATGGGTGG - Intronic
1079926365 11:26496671-26496693 TTGGAGAGTGAGGGGAGTGAGGG - Intronic
1080071282 11:28091324-28091346 ATGGAAAGTAAGTGCATGGCTGG + Intronic
1080531073 11:33177118-33177140 TTTGAGAGTTAGTGTATAGCTGG - Intergenic
1083828385 11:65216075-65216097 TGGGTGAGTGAGTGGGTGGGTGG + Intergenic
1083828509 11:65216738-65216760 TGGGTGAGTGAGTGGGTGGGTGG + Intergenic
1083828523 11:65216786-65216808 TGGGTGAGTGAGTGGGTGGGTGG + Intergenic
1083828537 11:65216834-65216856 TGGGTGAGTGAGTGGGTGGGTGG + Intergenic
1084006028 11:66324063-66324085 TGGGAGAGTGAATAGATGGATGG + Intergenic
1084083845 11:66845730-66845752 GTGGTGTGTGGGTGGATGGCTGG + Intronic
1084413344 11:69016476-69016498 TTGGTGGGTGAATGGATGGATGG - Intergenic
1084454050 11:69257242-69257264 GTCGTGAGTGAGTGAATGGCAGG - Intergenic
1084464471 11:69314014-69314036 TGGGCGAATGAGTGGATGGATGG - Intronic
1084684938 11:70687903-70687925 GTGGCGAGTGGGTGGATGGTGGG - Intronic
1084685718 11:70693962-70693984 TGGCTGAGTGAGTGGATGGCGGG + Intronic
1084713121 11:70856490-70856512 ATGGATAATGAGTGGATGGATGG + Intronic
1084739923 11:71133126-71133148 TGGGTGAATGAGTGGATGGAGGG + Intronic
1084740051 11:71133584-71133606 TTGGAGGGTCAGGGGATGGGTGG + Intronic
1084776622 11:71380870-71380892 TTGTTGAATGAGTGGATGGGTGG + Intergenic
1085163669 11:74374734-74374756 TTGGGGACTCAGTGAATGGCAGG - Intronic
1085464314 11:76713634-76713656 TTGGTCAGTGGGTGGATGGGTGG + Intergenic
1085534579 11:77210393-77210415 TAGGTGAGTGGGTGGATGGGTGG + Intronic
1085795805 11:79538427-79538449 TTGGTGATTGAGTGGATGAAAGG - Intergenic
1087235888 11:95718249-95718271 TAGGAGAGAGACAGGATGGCGGG + Intergenic
1088416066 11:109590423-109590445 TTGGAGGGTGAGGGGATGAGGGG - Intergenic
1089995072 11:122898868-122898890 ATGGAGGGTGAGAGGAGGGCAGG - Intronic
1090060790 11:123462553-123462575 TTGGAGAAGGGGTGGGTGGCAGG - Intergenic
1091375711 12:23446-23468 AGGGAGAGAGAGTGGATGCCGGG - Intergenic
1091670171 12:2446857-2446879 TTGGTGGGTGGGTGGATGGATGG + Intronic
1092143541 12:6200129-6200151 TTGAAGAAGGAGTGGGTGGCGGG + Intronic
1092672451 12:10879388-10879410 TGGAAGAGTGAGTGGGTGGGAGG + Intronic
1092680264 12:10971137-10971159 ATGGGGAGTGTCTGGATGGCTGG - Intronic
1092688777 12:11083636-11083658 ATGGAGAGTGTCTGGATTGCTGG - Intronic
1094278497 12:28707678-28707700 TTGGAAAGTGAGGGCATAGCAGG - Intergenic
1095726909 12:45463874-45463896 TTGGAGACTGTGTGGATGAATGG + Intergenic
1095801262 12:46271558-46271580 TTGGAGGGTTAGTGGGTGGAAGG + Intergenic
1095986043 12:48000463-48000485 TTGGAGGGTGAGCGGAAGGGAGG + Intronic
1096536761 12:52279834-52279856 GTGTAGAGTGAATGGATGGATGG - Intronic
1097179141 12:57160948-57160970 CTGGAGAGGGCGTGGATGGATGG + Exonic
1097685847 12:62690204-62690226 TTGGTGGGTGTGTGGATGGGTGG - Intronic
1098237643 12:68433093-68433115 TTGGAGAGAGAGTGGGAGGGAGG - Intergenic
1098384048 12:69899752-69899774 TTGGAGAGAGAATGGTGGGCAGG + Intronic
1098664327 12:73141595-73141617 TTTGAGATTTAGTTGATGGCAGG - Intergenic
1101020276 12:100546745-100546767 CTGGAGGGTTAGTGGATGGAGGG - Intronic
1101175970 12:102151847-102151869 TTGGACAGTGAGTTGGTGCCAGG - Intronic
1101233944 12:102769289-102769311 TTGAAGACTGAGTAGAAGGCAGG + Intergenic
1101822295 12:108193421-108193443 TGGAAGAATGAGTGGATGACTGG + Intronic
1102007077 12:109595880-109595902 ATGGAGTGTGAGGGGATGTCTGG - Intronic
1102764606 12:115421922-115421944 TTGGAGAGGGGGTGGAGGGTTGG - Intergenic
1102766449 12:115437569-115437591 TTAGGGAGGGTGTGGATGGCAGG + Intergenic
1102889983 12:116551188-116551210 TTGTAGAATTAGTGGATGGATGG + Intergenic
1102920681 12:116789335-116789357 ATGGAAAGAGAGTGGATGGGTGG + Intronic
1103024015 12:117558799-117558821 TGGGTGGGTGGGTGGATGGCTGG + Intronic
1103027213 12:117583350-117583372 TGGGTGAGTGAGTGGGTGGGTGG + Intronic
1103027224 12:117583394-117583416 TGGGTGAGTGAGTGGATGGATGG + Intronic
1103407480 12:120686450-120686472 TTTGAGAGCGAGTGGGTGCCAGG - Intergenic
1104448499 12:128852095-128852117 TTTGAGAGTGAGAGGAGGACAGG + Intergenic
1104528087 12:129543204-129543226 TTGGTGAGTGGGTGGGTGGGTGG + Intronic
1104542256 12:129676865-129676887 TGGGTGAGTGAGTAGATGGATGG - Intronic
1104754291 12:131259335-131259357 TGGGTGAGTGAGTGAATGGGTGG + Intergenic
1104775129 12:131386272-131386294 ATGGAGAGGGAGGGGAGGGCAGG + Intergenic
1104778663 12:131405600-131405622 TGGATGGGTGAGTGGATGGCTGG - Intergenic
1104779330 12:131409796-131409818 ATGGATAGTGAATGGATGGATGG - Intergenic
1104906713 12:132217466-132217488 TGGGTGGGTGAATGGATGGCTGG - Intronic
1104925689 12:132313061-132313083 TGGGTGAGTGGGTGGATGGATGG - Intronic
1104925695 12:132313081-132313103 TGGGTGAGTGGGTGGATGGGTGG - Intronic
1104925760 12:132313297-132313319 TTGGTGTGTGAATGGATGGGTGG - Intronic
1104925778 12:132313369-132313391 TGAGTGAGTGAGTGGATGGGTGG - Intronic
1104925797 12:132313445-132313467 TGGGTGGGTGAGTGGATGGATGG - Intronic
1104925847 12:132313602-132313624 TGGGTGGGTGAGTGGATGTCTGG - Intronic
1104954656 12:132458161-132458183 TGGGCGGGTGAGTGGATGGGCGG + Intergenic
1105279797 13:18956809-18956831 TGGGTGCGTGAGTGGATGGATGG - Intergenic
1105589056 13:21774451-21774473 TTGGAAAGTGAGTGGGTGGTGGG - Intergenic
1105637673 13:22231221-22231243 TGGGTGAGTGAGTGGATGGATGG - Intergenic
1106236450 13:27865185-27865207 TTGAAGAATGAGGGGATGGAAGG + Intergenic
1107553873 13:41500748-41500770 ATGCAGAGGGGGTGGATGGCAGG - Intergenic
1108475678 13:50814360-50814382 TGAGTGAGTGAGTGGACGGCTGG - Intronic
1109188514 13:59298299-59298321 TTGGAAAGTGAGTAGATGTGGGG - Intergenic
1110462409 13:75759750-75759772 TTGGAGAGTAAGGGGATTCCGGG - Intronic
1112030565 13:95452917-95452939 TTGGGGAGTGTGTGTATGGTTGG - Intronic
1112799991 13:103099991-103100013 TTGGAGACTGAGTGCATGTGTGG + Intergenic
1112850583 13:103701203-103701225 TTGGTGAATGAATGGATGGCTGG - Intergenic
1112891732 13:104242319-104242341 TTGGCTATTGAGTGGATGGATGG + Intergenic
1113380829 13:109804351-109804373 ATGAAAAGGGAGTGGATGGCGGG - Intergenic
1113418277 13:110148761-110148783 TTGTAGAGTGAATGAATGGAAGG + Intergenic
1114460063 14:22880706-22880728 TTAGAGAGTGAGTGCCTGGATGG + Exonic
1114624273 14:24118546-24118568 CTGGAGAGTCAGTGGAAGCCTGG - Intronic
1114750117 14:25194633-25194655 TTGAACAGTGAGTGGATGAATGG + Intergenic
1115895717 14:38084652-38084674 TTAGATGGTGAGTGGATGCCGGG + Intergenic
1119968561 14:78943963-78943985 TTGAAGGGTGAGAGGATGGCAGG + Intronic
1119971660 14:78977616-78977638 TGTAAGAGTGAGAGGATGGCTGG - Intronic
1119986871 14:79148188-79148210 TTTAAGAGTGACTGGATGGGAGG + Intronic
1121087399 14:91157052-91157074 TGGGTGAGTGGGTGGATGGATGG + Intronic
1121092168 14:91190452-91190474 CTGGAGAGTGAGGGGCTGGGCGG + Intronic
1121485136 14:94308886-94308908 ATGGTGAGTGAGTGAATGGATGG - Intronic
1121606638 14:95245621-95245643 TGGGTGAGTGGGTGGATGGATGG + Intronic
1122134906 14:99627228-99627250 TAGGTGGGTGAGTGGATGGATGG - Intergenic
1122142809 14:99672940-99672962 GTGGTGAATGAGTGGATGGGGGG - Intronic
1122154624 14:99742694-99742716 TTGTGGAGTGCGTGGAGGGCTGG + Intronic
1122329510 14:100903249-100903271 TTGGAGAATGAGTGCATGGATGG - Intergenic
1122625252 14:103082224-103082246 GTGGATTGTGAATGGATGGCTGG + Intergenic
1122741710 14:103875399-103875421 TGGGTGAGTGAATGGATGGATGG + Intergenic
1122789672 14:104178961-104178983 TTGGGCAGTGGGTGGGTGGCTGG + Intronic
1122923752 14:104890587-104890609 TGGGTGAGTGAGTGGGTGGATGG + Intronic
1122923884 14:104891079-104891101 ATGGAGAGTGAGTGGGTGGATGG + Intronic
1125527290 15:40384804-40384826 TGGGAGAGGAACTGGATGGCTGG - Intronic
1128327612 15:66735229-66735251 TGGGAGCCAGAGTGGATGGCCGG + Intronic
1128654133 15:69447017-69447039 CTGAAGAATAAGTGGATGGCTGG - Intronic
1131103021 15:89708825-89708847 CTGGTGAGTGAGTGGAGGACTGG - Intronic
1131738112 15:95356358-95356380 TGGGAGAGGCAGTGGAAGGCAGG - Intergenic
1132451218 15:101969555-101969577 AGGGAGAGAGAGTGGATGCCAGG + Intergenic
1132644738 16:993709-993731 TGGGTGAGTGGGTGGATGGATGG - Intergenic
1132644749 16:993741-993763 TGGGTGGGTGAGTGGATGGATGG - Intergenic
1132644774 16:993829-993851 TGGGTGAGTGAGTGGGTGGACGG - Intergenic
1132644798 16:993927-993949 TGGGTGGGTGAGTGGATGGATGG - Intergenic
1132644862 16:994130-994152 TGGGCGAGTGGGTGGATGGATGG - Intergenic
1132644893 16:994254-994276 TGGGTGGGTGAGTGGATGGATGG - Intergenic
1132653739 16:1032951-1032973 CTGGTGGGTGAGTGGATGGATGG - Intergenic
1133313481 16:4867055-4867077 TGGGCGAGTTGGTGGATGGCTGG + Intronic
1133416538 16:5611674-5611696 TGGGGGAGTGGGTGGATGGATGG - Intergenic
1133474563 16:6107690-6107712 TGGGTGGGTGAGTGGATGGATGG + Intronic
1133726179 16:8539526-8539548 TTGGAGCGTGGGAGGATGGAAGG - Intergenic
1133877809 16:9751371-9751393 TAGATGAGAGAGTGGATGGCTGG - Intergenic
1134202334 16:12209517-12209539 CTGGAGAGTGAGAGGACAGCAGG - Intronic
1134663759 16:16003629-16003651 TTGGTGGGTGGGTGGATGGATGG + Intronic
1134663793 16:16003758-16003780 TTGGTGGGTGGGTGGATGGATGG + Intronic
1134663827 16:16003883-16003905 TTGGTGGGTGGGTGGATGGGTGG + Intronic
1134746648 16:16593869-16593891 ATGGAGAGTAGGTGGATGGATGG - Intergenic
1134998828 16:18759811-18759833 GTGGAGAGTAGGTGGATGGATGG + Intergenic
1135221207 16:20615180-20615202 TTAGAGGCTGAGTGGCTGGCTGG + Intronic
1135251978 16:20908005-20908027 ATGTTGAGTGAGTGGATGGATGG + Intronic
1135527485 16:23225147-23225169 TGGAAGAGTGAGTGGATGAATGG - Intergenic
1135548081 16:23379001-23379023 ATGGAGGATGAATGGATGGCTGG - Intronic
1135627267 16:24006921-24006943 TTGCAGAGAGATTGGATGACAGG + Intronic
1135892953 16:26373931-26373953 TGGGAGAGTGAGTAGGTGGGTGG + Intergenic
1136279097 16:29197613-29197635 TGGGTGAGTGAATGGATGGGTGG + Intergenic
1136279207 16:29198106-29198128 TGGGTGGGTGAGTGGATGGGTGG + Intergenic
1136590138 16:31213768-31213790 TTGGGGAATGAGTGGGTGACAGG + Intergenic
1137271691 16:46906589-46906611 TGGGTGAGTGAGTGGATGAGTGG + Intronic
1137386138 16:48044162-48044184 ATGGATGGTGAATGGATGGCTGG - Intergenic
1137463264 16:48685404-48685426 TAGGAGAATGAGAGGATGGATGG - Intergenic
1137561673 16:49506392-49506414 TTGGTGAGTGGGTGGATGGGTGG + Intronic
1137736896 16:50731490-50731512 TTGGGGAGTCTGTGGCTGGCTGG + Intronic
1137765018 16:50971408-50971430 TGGGTGGGTGAGTGGATGGATGG - Intergenic
1138441107 16:57035466-57035488 TTGGAGATTGAGTGGAAGGATGG - Intronic
1138547716 16:57729531-57729553 TGGGTGAGTGAGTGGGTGGGTGG + Intronic
1138547737 16:57729603-57729625 TGGGTGAGTGAGTGGGTGGGTGG + Intronic
1139371179 16:66470335-66470357 TGGAAGAGTCAGTGGATGGGTGG + Intronic
1140067693 16:71625409-71625431 TAGGTGAGTGGGTGGATGGATGG + Intergenic
1140067716 16:71625480-71625502 TGGGTGAGTGGGTGGATGGGTGG + Intergenic
1140067780 16:71625698-71625720 TGGGTGAGTGGGTGGATGGGTGG + Intergenic
1140067793 16:71625737-71625759 TGGGTGAGTGGGTGGATGGGTGG + Intergenic
1140067800 16:71625757-71625779 TGGGTGAGTGGGTGGATGGGTGG + Intergenic
1140456855 16:75110809-75110831 TGGAAGAGTGGGTGGCTGGCTGG + Exonic
1141048868 16:80742735-80742757 TGGGTGAGTGAGTGGGTGGATGG + Intronic
1141430323 16:83967875-83967897 TGGGAGGGTGGGTGGATGGATGG + Intergenic
1141488247 16:84355158-84355180 TGGGTGAGTGGGTGGATGGATGG + Intergenic
1141488321 16:84355406-84355428 TGGGTGAGTGGGTGGATGGATGG + Intergenic
1141650007 16:85387909-85387931 TAGGTGGGTGAGTGGATGGATGG + Intergenic
1141650070 16:85388157-85388179 TGGGTGAGTGGGTGGATGGGTGG + Intergenic
1141690890 16:85595684-85595706 TGGGTGGGTGAGTGGATGGGAGG - Intergenic
1141943481 16:87294115-87294137 TGGGTGAGTGGGTGGATGGATGG + Intronic
1142083490 16:88163706-88163728 TGGGTGAGTGAATGGATGGGTGG + Intergenic
1142083597 16:88164207-88164229 TGGGTGGGTGAGTGGATGGGTGG + Intergenic
1142152663 16:88519577-88519599 TGGGAGGGTGGGTGGATGGATGG + Intronic
1142152895 16:88520587-88520609 TGGGAGGGTGAGTGGGTGGATGG + Intronic
1142152918 16:88520658-88520680 TGGGAGGGTGGGTGGATGGGTGG + Intronic
1142152946 16:88520746-88520768 TGGGAGGGTGGGTGGATGGATGG + Intronic
1142244730 16:88964842-88964864 ATGGTGGGTGAGTGGATGGATGG - Intronic
1142248299 16:88979699-88979721 TGGGTGGGTGAGTGGATGGGTGG + Intergenic
1142400589 16:89856234-89856256 GCGGTGAGTGAGGGGATGGCAGG + Exonic
1142478628 17:204611-204633 TTGGGGGATGGGTGGATGGCAGG - Intergenic
1142563046 17:822504-822526 TTGGATGGTGAGTGGCTGGGAGG - Intronic
1142706035 17:1695024-1695046 TTGCACAGTGCGTCGATGGCAGG + Intergenic
1143495917 17:7312577-7312599 TTGGAGGGTGGGGGGATGGCTGG - Intergenic
1143592796 17:7895585-7895607 TAAGAGAGGGAGAGGATGGCAGG - Intronic
1143754178 17:9054428-9054450 ATGGAGGGTGAATGGAAGGCGGG + Intronic
1144100718 17:11939926-11939948 ATGGATAGTGGGTGGATGGACGG + Intronic
1144773638 17:17772992-17773014 CAGGTGAGTGAGTGGATGGGTGG + Intronic
1145240023 17:21235747-21235769 TTGGTGGATGAGTGGATGGCTGG - Intergenic
1146173942 17:30652959-30652981 TTGTTGAGTGAATGGATGGCAGG + Intergenic
1146290965 17:31606956-31606978 TTGGTGTGTGTGTGGATGGATGG - Intergenic
1146347398 17:32068981-32069003 TTGTTGAGTGAATGGATGGCAGG + Intergenic
1147153738 17:38532907-38532929 TTGGGAAGTGAGGGGAAGGCGGG + Exonic
1147208021 17:38852820-38852842 TTGGGCAGTGAGTGGAGGGAGGG - Intronic
1147847806 17:43417436-43417458 TTGTTGAGTGAATGTATGGCTGG + Intergenic
1148345914 17:46903744-46903766 TGGGTGGGTGAGTGGATGGATGG + Intergenic
1148346087 17:46904411-46904433 TTGGTGGGTGCGTGGGTGGCTGG + Intergenic
1148546637 17:48524317-48524339 TAGAAGAGAGTGTGGATGGCAGG - Intergenic
1148768309 17:50052326-50052348 TGGGAGAGTGAGATGAGGGCTGG + Intergenic
1149289546 17:55203449-55203471 TTGTAGAATGGGTGGATGGTAGG + Intergenic
1150172669 17:63016056-63016078 TTGGAGAATGTGTGGAAGGCAGG + Intronic
1150439131 17:65177337-65177359 TGGGTGGGTGAGTGGATGGATGG - Intronic
1150635807 17:66912398-66912420 CTGGAGAGTGAGTGTCTGGGAGG - Intergenic
1151430603 17:74060001-74060023 TTGGAGCCTGAGTGGATGAATGG + Intergenic
1151973215 17:77469773-77469795 TGGGTGAGTGAGTGGATGGGTGG - Intronic
1151973271 17:77470055-77470077 TGGGTGAATGAGTGGATGGGTGG - Intronic
1152033593 17:77858439-77858461 TTGGTGAGTGGGTAGATGGGTGG - Intergenic
1152038093 17:77885492-77885514 TGGGTGAGTGGGTGGATGGATGG + Intergenic
1152141601 17:78540412-78540434 TGGGTGAGTGGGTGGATGGATGG + Intronic
1152141636 17:78540516-78540538 TGGGTGGGTGAGTGGATGGGTGG + Intronic
1152141906 17:78541304-78541326 TGGGTGAGTGAGTGGATGGGTGG + Intronic
1152353465 17:79795693-79795715 TGGGTGGGTGGGTGGATGGCTGG + Intronic
1153277115 18:3378352-3378374 TTGGGGAATGAATGGATGACTGG + Intergenic
1153324438 18:3803687-3803709 TTGGAGAGAAAGTAGAGGGCTGG + Intronic
1154947814 18:21179604-21179626 TGGGTGAATGAGTGGATGGATGG + Intergenic
1155155158 18:23151460-23151482 GTGAAGGGTGGGTGGATGGCAGG + Intronic
1156398918 18:36723376-36723398 TTGGTGGGTGTGTGGATGGGGGG + Intronic
1160229198 18:77033786-77033808 TGGGTGAGTGGGTGGATGGATGG - Intronic
1160634046 19:62992-63014 AGGGAGAGAGAGTGGATGCCAGG - Intergenic
1160692129 19:465025-465047 TGGATGAGTGAGTGGATGGGTGG + Intronic
1160692148 19:465096-465118 TGGGTGAGTGGGTGGATGGATGG + Intronic
1160692162 19:465144-465166 TGGGTGGGTGGGTGGATGGCTGG + Intronic
1160859806 19:1233014-1233036 TGGGAATGTGAGTGGAAGGCGGG - Intronic
1160926714 19:1550056-1550078 TGGGAGGGTGGGTGGATGGATGG - Intergenic
1160960225 19:1717654-1717676 TGGGTGAGTGAGTGGATGGATGG + Intergenic
1161287770 19:3477651-3477673 TGGGTGAGTGGGTGGATGGGTGG + Intronic
1161347781 19:3776747-3776769 GTGGATAGTGAGTGGGTGGATGG + Intergenic
1161449149 19:4334932-4334954 ATGGACGGTGAGTGGATGGATGG - Intronic
1161641069 19:5423728-5423750 GTGGTGAGTGGGTGGATGGATGG - Intergenic
1161657480 19:5525003-5525025 ATGGATGGTGAGTGGATGGATGG - Intergenic
1161766154 19:6210036-6210058 TGGGTGGGTGAGTGGATGGGTGG - Intergenic
1161974249 19:7599915-7599937 TTGGTGGGTGGGTGGATGGATGG - Intronic
1161974377 19:7600283-7600305 TGGGAGAGTGGGTGGGTGGGTGG - Intronic
1162042893 19:7980995-7981017 TTGGAGAGTGACTGTGAGGCTGG + Intronic
1162064785 19:8118829-8118851 TGTGAAAGTGAGTGGATGTCTGG - Intronic
1162569380 19:11462233-11462255 TTTGAGAGTGAATGGGGGGCAGG + Intronic
1162625223 19:11879789-11879811 TTGGAGAGAGGGTGGAGAGCTGG - Intronic
1162988471 19:14287077-14287099 TTGTTGAGTGAATGGATGGCAGG - Intergenic
1163350667 19:16774660-16774682 TAGGTGGGTGAGTGGATGGAAGG - Intronic
1163382603 19:16978820-16978842 ATGGTGGGTGAGTGGATGGATGG - Intronic
1163382676 19:16979151-16979173 ATGGATAGTGGGTGGATGGGTGG - Intronic
1163675587 19:18653900-18653922 GTGGATGGTGAGTGGATGGAAGG - Intronic
1163731854 19:18954191-18954213 TGGGCGAATGAGTGGATGGGTGG - Intergenic
1163979002 19:20880855-20880877 GTGGAGAATGAGTGGCTGACAGG - Intergenic
1164576325 19:29407374-29407396 CTGTAGAGTGAGTGGGTGGGTGG + Intergenic
1164597982 19:29542577-29542599 TGGGAGAATGAATGGATGGATGG + Intronic
1165759154 19:38310403-38310425 TTGGTGAGTGGATGGATGGATGG - Intronic
1166774430 19:45303584-45303606 TGGGAGTGTGAGTGGATGAATGG - Exonic
1168326874 19:55543061-55543083 TTGGTGGGTGAGTGGATGGATGG - Intronic
1168326881 19:55543093-55543115 TTGGTAGGTGAGTGGATGGATGG - Intronic
1168326935 19:55543276-55543298 TTGGTGGGTGAGTGGATGGATGG - Intronic
1168508243 19:56954467-56954489 ATGGATAGTGGGTGGATGGGTGG - Intergenic
1168508281 19:56954643-56954665 TTGGAGGATGAGTGGATGGATGG - Intergenic
1168711409 19:58502332-58502354 GTAGTGAGTGAGTGGATGGATGG + Intronic
1168711429 19:58502540-58502562 GTAGTGAGTGAGTGGATGGATGG + Intronic
1202681428 1_KI270712v1_random:7141-7163 ATGGAGATGGAGTGGAAGGCCGG + Intergenic
925030189 2:644415-644437 TTGTAGAGTGAATGAAGGGCTGG + Intergenic
925030199 2:644493-644515 TTGTAGAGTGAATGAAGGGCTGG + Intergenic
925216615 2:2101656-2101678 TTGGTGGATGAGTGGATGGGTGG - Intronic
925347861 2:3183245-3183267 TGGGTGAGTGGGTGGATGGCGGG - Intergenic
926223287 2:10950117-10950139 TGGGTGAGTGGGTGGATGGATGG + Intergenic
926690838 2:15732245-15732267 TTGGAGAGGGAATGAATGGATGG + Intronic
927126073 2:20012972-20012994 TGGGAGGGAGAGTGGAGGGCCGG - Intergenic
927848893 2:26486439-26486461 TGGGTGGGTGAGTGGATGGATGG + Intronic
928283431 2:29968535-29968557 TTGATGACTGAGTGAATGGCTGG + Intergenic
928333046 2:30372312-30372334 TGGGAGAGAGAGTGGCTGGAAGG - Intergenic
928365053 2:30694068-30694090 ATGTGGAGTGAGTGGAAGGCAGG + Intergenic
929606752 2:43239848-43239870 TGGGTGAGTGGGTGGATGGGTGG - Intronic
930003743 2:46879809-46879831 ATGGATGGTGAGTGGATGGGTGG + Intergenic
930701609 2:54463194-54463216 TTGTAGGGTAAATGGATGGCAGG + Intronic
931147467 2:59534858-59534880 TTGGAGATTGTGTTTATGGCTGG - Intergenic
931648923 2:64451650-64451672 TTGGAGAGAGGGTGGATGATAGG - Intergenic
932125783 2:69144494-69144516 GGGGAGAGAGAGTGGATGGCGGG + Intronic
933236144 2:79866644-79866666 TTGGAAAGTCTGTGGATGACAGG - Intronic
934724594 2:96607619-96607641 TAGAAGTGTGAGTGGATGGGAGG - Intronic
934938285 2:98480873-98480895 GTGGAGGGTGAGTGGGGGGCAGG + Intronic
936527718 2:113253057-113253079 ATGGACAGTGAGTGGTTGGAGGG + Intronic
936567434 2:113592036-113592058 AGGGAGAGAGAGTGGATGCCGGG + Intergenic
937234084 2:120419889-120419911 TGGGTGAGTGGGTGGATGGATGG - Intergenic
937268500 2:120632349-120632371 TGGGTGGGTGAGTGGATGGATGG + Intergenic
937961575 2:127464101-127464123 TTGGAGGGTGAAAGGAAGGCAGG - Intronic
937977080 2:127588816-127588838 TGGGTGGGTGAGTGGATGGGTGG + Intronic
937977127 2:127588997-127589019 TGGGTGAGTGAGTGGATGGGTGG + Intronic
937977141 2:127589036-127589058 TGGGTGGGTGAGTGGATGGGTGG + Intronic
937977199 2:127589252-127589274 TGGGTGGGTGAGTGGATGGATGG + Intronic
937977284 2:127589549-127589571 TGGGTGAGTGGGTGGATGGGTGG + Intronic
937977295 2:127589588-127589610 TGGGTGAGTGGGTGGATGGGTGG + Intronic
937977369 2:127589830-127589852 TGGGTGAGTGGGTGGATGGGTGG + Intronic
938069156 2:128299447-128299469 GGGGAAACTGAGTGGATGGCAGG + Intronic
939088620 2:137752298-137752320 TTGGAGATGGACTGAATGGCTGG - Intergenic
939512029 2:143119187-143119209 TGAGAGTGTGAGTGTATGGCTGG + Intronic
940120564 2:150260049-150260071 TTGTAGAGTGAGTAAATGCCAGG + Intergenic
942487875 2:176458259-176458281 TTGGATAATGAGTGAATGGGGGG - Intergenic
943670437 2:190654482-190654504 TTGGAGGGAGAGAGGATGCCTGG + Intronic
945102408 2:206274572-206274594 TGGGAGAGTGAGTGAGTGGGTGG + Intergenic
945216299 2:207437549-207437571 TTTGAGAGTGAACGGAGGGCGGG + Intergenic
946197293 2:218042102-218042124 TTGATGAGTGAGTGGCTGGTGGG + Intronic
947272781 2:228356341-228356363 TTGGAAAGTGTGTGGATGAAAGG - Intergenic
947408472 2:229807646-229807668 TTGGAGAGTGGGTGTAGGGATGG - Intronic
948187263 2:236031343-236031365 TTGCACAGTGAGAAGATGGCAGG + Intronic
948389402 2:237601257-237601279 GTGCAGGGTGAGAGGATGGCTGG - Intronic
948791194 2:240377787-240377809 TTGGGGAATGAATGGATGGAAGG - Intergenic
948815562 2:240508537-240508559 ATGGAGAGTGATGGGAAGGCAGG - Intronic
948815672 2:240509194-240509216 TGGGTGGGTGAGTGGATGGGTGG + Intronic
1168834104 20:865719-865741 TGGGAGAGTGAGTGGTTGAGTGG - Intergenic
1168881414 20:1209395-1209417 TTGGAGATGGAGGGGTTGGCAGG - Intergenic
1169934411 20:10867348-10867370 TGGGTGAGTGGGTGGATGGATGG - Intergenic
1172179963 20:32996861-32996883 ATGGAGAGAGAATGGATGGGAGG - Intronic
1172184841 20:33025055-33025077 TTGGTGGGTGGGTGGATGGATGG - Intergenic
1172184910 20:33025455-33025477 ATGGATAGTGAGTAGATGGATGG - Intergenic
1172193200 20:33074718-33074740 TGGGAGGGTGAGTGGATGGATGG - Intergenic
1172196186 20:33093299-33093321 TGGGAGGGTGGGTGGATGGGTGG - Intronic
1172196274 20:33093685-33093707 TGGGTGAGTGAGTGGATAGGTGG - Intronic
1172939449 20:38644543-38644565 TGGGTGAGTGGGTGGATGGATGG - Intronic
1173181159 20:40807315-40807337 CTGGAGAGTGAATGGCTGGCAGG + Intergenic
1173974846 20:47179370-47179392 TTGGATATTGGGTGGATGGATGG + Intronic
1173976616 20:47191576-47191598 TAGGTGAATGAGTGGATGGATGG + Intergenic
1174057911 20:47811145-47811167 TGGCAGAGTGGGTGCATGGCAGG - Intergenic
1174178139 20:48657753-48657775 TAGGAGAGTGAGGGTGTGGCTGG - Intronic
1174195012 20:48766811-48766833 TTGGTGAGTGAGTGGATGGACGG + Intronic
1174302403 20:49592204-49592226 TGGGTGGGTGAATGGATGGCTGG - Intergenic
1174357141 20:50005964-50005986 TTGGAGAGTGAGTGAATGCAAGG + Intergenic
1174512104 20:51061147-51061169 TGGGTGGGTGAGTGGATGGATGG - Intergenic
1174564643 20:51456121-51456143 TGGGTGGGTGAGTGGATGGATGG + Intronic
1175189765 20:57203406-57203428 TGGGTGAATGAGTGGATGGATGG + Intronic
1175343441 20:58250625-58250647 TTGGACAGTGAGAAGAAGGCAGG + Intergenic
1175442461 20:59001410-59001432 TGGAAGAGGGAGTGGAGGGCAGG + Intronic
1175526560 20:59638570-59638592 TGGGTGCGTGAGTGGATGGATGG + Intronic
1175526572 20:59638624-59638646 TTGGAGAATGGGTGGATGGGTGG + Intronic
1175526631 20:59638878-59638900 TGGGTGGGTGAGTGGATGGGTGG + Intronic
1175526644 20:59638936-59638958 TTGGAGAATGGGTGGATGGGTGG + Intronic
1175742425 20:61429532-61429554 TGGGTGTGTGAGTGGATGGATGG + Intronic
1175817286 20:61889879-61889901 TGGGTGAGTGAATGGATGGATGG + Intronic
1175817294 20:61889933-61889955 TGGATGAGTGAGTGGATGGTTGG + Intronic
1175817395 20:61890464-61890486 TGGAAGGGTGAGTGGATGGATGG + Intronic
1175818044 20:61893730-61893752 TGGGTGGGTGAGTGGATGGATGG + Intronic
1175818058 20:61893781-61893803 TGGGTGGGTGAGTGGATGGATGG + Intronic
1176131257 20:63497769-63497791 TGGGAGTGTGAGGGGCTGGCGGG + Exonic
1178604371 21:34022935-34022957 CTTGAGAATGAGGGGATGGCAGG + Intergenic
1179174449 21:38997430-38997452 CTGCAGTGTGAGTGAATGGCAGG - Intergenic
1179719833 21:43308692-43308714 TTGGAGGGCGAGTGGATGGGAGG + Intergenic
1179899455 21:44381435-44381457 TGGGTGGGTGTGTGGATGGCTGG + Intronic
1180024995 21:45155955-45155977 TGGGTGGGTGGGTGGATGGCTGG - Intronic
1181441525 22:22938332-22938354 TGGGTGGGTGAGTGGATGGCTGG + Intergenic
1181822584 22:25487431-25487453 TGGGTGAGTGGGTGGATGGATGG + Intergenic
1181822620 22:25487577-25487599 TGGGAGAGTGGGTGGATGGATGG + Intergenic
1181855647 22:25779890-25779912 TTGGGCAGGGAGTGGGTGGCAGG + Intronic
1181861757 22:25824219-25824241 TTGGGGAGTGAGTGGGAGACAGG + Intronic
1181905500 22:26192010-26192032 GGGGAGAATGAGTGGATGGATGG - Intronic
1182009366 22:26987440-26987462 TTGAAGAGTGAGTGGATGAAGGG + Intergenic
1182086619 22:27565421-27565443 TGGGTGAGTGGGTGGATGGGTGG + Intergenic
1183077894 22:35438283-35438305 TAGGTGAGTGGGTGGATGGACGG - Intergenic
1183077905 22:35438339-35438361 TGGGTGGGTGAGTGGATGGATGG - Intergenic
1183082160 22:35463474-35463496 ATGGATAGTGGGTGGATGGGTGG - Intergenic
1184036970 22:41922893-41922915 ATGGAAGGGGAGTGGATGGCTGG + Intergenic
1184058440 22:42067501-42067523 TTGGAGGCAGAGAGGATGGCAGG - Intronic
1184123673 22:42471578-42471600 TTGGTGGATGAGTGGATGGGTGG - Intergenic
1184276680 22:43412693-43412715 GTGTTGAGTGAGTGGATGGATGG - Intronic
1184321265 22:43743877-43743899 TGGGTGGGTGAGTGGATGGATGG + Intronic
1184444538 22:44539641-44539663 TGGGTGGGTGAGTGGATGGATGG + Intergenic
1184444640 22:44540039-44540061 TGGGTGAGTGGGTGGATGGATGG + Intergenic
1184444683 22:44540195-44540217 TAGGTGAGTGAATGGATGGATGG + Intergenic
1184444692 22:44540246-44540268 TTGGTGAGTGAATTGATGGTTGG + Intergenic
1184609655 22:45594635-45594657 TTGGTGGGTGAATGGATGGATGG + Intronic
1184731123 22:46371723-46371745 GAGGTGAGTGAGTGGATGGATGG - Intronic
1184731250 22:46372285-46372307 GTGGGGAGCGAGTGGATGGATGG - Intronic
1184731258 22:46372312-46372334 GGGGTGAGTGAGTGGATGGATGG - Intronic
1184731271 22:46372364-46372386 GGGGTGAGTGAGTGGATGGATGG - Intronic
1184731292 22:46372443-46372465 ATGGGGGGTGAGTGGATGGATGG - Intronic
1184731308 22:46372493-46372515 GTGGGGGGTGAGTGGATGGATGG - Intronic
1184979266 22:48084596-48084618 TTGGAGAGCGACTGGTTGGCTGG + Intergenic
1185108620 22:48888196-48888218 TGGGTGGGTGAGTGGATGGATGG - Intergenic
949694928 3:6683261-6683283 TTGGAGAGAGAGAGGAAAGCAGG + Intergenic
950122032 3:10488337-10488359 TGGGTGAGTGAATGGATGGATGG - Intronic
950541759 3:13617374-13617396 TGGGTGAGTGGGTGGATGGGTGG - Intronic
950541874 3:13617796-13617818 TGGGTGAGTGAGTGGATGGGTGG - Intronic
950657713 3:14447424-14447446 TTATAGGGTGAATGGATGGCTGG - Intronic
950891109 3:16405177-16405199 CTGGAGACTGTGTGGCTGGCAGG - Intronic
951534618 3:23729526-23729548 TTGAAAAGTGAGAGGTTGGCTGG - Intergenic
951693420 3:25420706-25420728 TCAGAGAGTGAATGGATGGGTGG + Intronic
951962351 3:28342289-28342311 ATGAAGATTGACTGGATGGCAGG - Intronic
952721868 3:36542004-36542026 ATGGAGAGAGAATGGGTGGCAGG + Intronic
952846059 3:37688995-37689017 TGGGTGTGTGAGTGGATGGCTGG + Intronic
952846068 3:37689031-37689053 TGGATGGGTGAGTGGATGGCTGG + Intronic
953182435 3:40608513-40608535 TTGGGGACTGATTGGATGGAGGG + Intergenic
953571595 3:44075982-44076004 GTGGGGGGTGAGTTGATGGCAGG + Intergenic
953705501 3:45226870-45226892 GTGGAGAGTGACTGGCTGGGGGG + Intergenic
953800639 3:46020005-46020027 TTGGAGTGTGGGTGGGTGGGGGG + Exonic
953959791 3:47257918-47257940 TTGGAGAGAGAGTGGAACGCAGG - Intronic
953999312 3:47543283-47543305 TTGTTGAGTGAATGGATGGATGG - Intergenic
954131518 3:48563647-48563669 TTGGAGGTTGAGTGGATGTGGGG - Intronic
954675657 3:52314027-52314049 TTGGGGGATGAGTGGATGGGAGG + Intergenic
954750191 3:52809228-52809250 TGGGTGAGTGAATGGATGGATGG - Intergenic
954954852 3:54510167-54510189 TGGGTGAGTGAGTGGAGGGATGG + Intronic
954962087 3:54575656-54575678 TTGGAGAGGGAGTAGTTGGGGGG + Intronic
956377372 3:68629237-68629259 TTGGAGATTCAGAGGATGGGAGG - Intergenic
956748384 3:72327488-72327510 TTGGTGAGTGGATGGATGGATGG - Intergenic
957071088 3:75568373-75568395 TTATAGAGTGATTGGGTGGCAGG - Intergenic
957194613 3:77051393-77051415 TTGGATTGTGAGTAGAGGGCAGG - Intronic
957978045 3:87472818-87472840 ATGGAGTGTGAGTGCAAGGCTGG - Intergenic
958059417 3:88460437-88460459 TTGGAGAGTGAGGTGGGGGCAGG - Intergenic
960252537 3:115472369-115472391 TGGGTGACTGAGTGGATGGGAGG - Intergenic
960272794 3:115693039-115693061 GTGGAGGCTGAGTGGAAGGCAGG - Intronic
960527577 3:118727398-118727420 TTGCAGAGTAAGTGGGTGGTGGG - Intergenic
961311987 3:126008062-126008084 TTGGGGAGGCAGTGGATAGCTGG + Intronic
961661258 3:128469932-128469954 TGGGTGGGTGAGTGGCTGGCTGG - Intergenic
961736401 3:129004487-129004509 TGGGTGGGTGAGTGGATGGGTGG - Intronic
962183389 3:133232361-133232383 ATGGTGAGTGAGTGGATGCAAGG - Intronic
962286056 3:134086316-134086338 GAGGAGAGAGAGTGGATGGCAGG + Intronic
962480709 3:135795908-135795930 CTGGAGAGTGAGAGTTTGGCAGG - Intergenic
963056627 3:141191414-141191436 TGGGCGGGTGAGTGGATGGTTGG + Intergenic
963810328 3:149770466-149770488 CTGTAGAGTGAGTGAATTGCAGG + Intronic
964683069 3:159363631-159363653 TTGGAGAGTGATTGGGTTGGTGG - Intronic
964920741 3:161892544-161892566 TTGGATAGAGAGTGGAGGGAGGG + Intergenic
965453543 3:168869222-168869244 TTGGAGCGGGAGTGAATGTCTGG + Intergenic
965821714 3:172691017-172691039 TTGGGCAGTGTGTGGATGTCAGG - Intronic
967362722 3:188650095-188650117 TTGTAGAATGAATGGATGGATGG - Intronic
967889513 3:194355089-194355111 TTGGAAAGTGAGTGGGAGGCCGG - Intergenic
968598479 4:1497596-1497618 TGGGTGAGTGGGTGGATGGAAGG + Intergenic
968598487 4:1497624-1497646 TGGGTGAGTGGGTGGATGGAAGG + Intergenic
968930948 4:3578457-3578479 TGGGTGAGTGAATGGATGGGTGG - Intronic
969192608 4:5534348-5534370 TCAGCGAGTGAGTGGATGGATGG + Intergenic
969424844 4:7118162-7118184 TTGGTGGGTGGGTGGATGGAAGG + Intergenic
969424891 4:7118395-7118417 TTGGTGAGTGGGTGGATGGATGG + Intergenic
969424899 4:7118441-7118463 TTGGTGAGTGGATGGATGGAAGG + Intergenic
969424927 4:7118582-7118604 TTGGTGAGTGGGTGGATGGATGG + Intergenic
969424938 4:7118625-7118647 TTGGTGAGTGGGTGGATGGAAGG + Intergenic
969424970 4:7118773-7118795 TTGGTGAGTGGGTGGATGGAAGG + Intergenic
969524108 4:7695493-7695515 TGGGTGGGTGAGTGGATGGGTGG + Intronic
969524115 4:7695513-7695535 TGGGTGGGTGAGTGGATGGGTGG + Intronic
969524169 4:7695693-7695715 TTGGTGGGTGGGTGGATGGATGG + Intronic
969524209 4:7695829-7695851 TTGGTGGGTGGGTGGATGGATGG + Intronic
969564572 4:7970474-7970496 GTGGAGAGGGAGCGGATGGTGGG + Intronic
969571729 4:8012754-8012776 TGGGTGAGTGGGTGGATGGATGG - Intronic
969687446 4:8683583-8683605 TGGGTGAGTGGGTGGATGGGTGG + Intergenic
970485187 4:16517868-16517890 TTGATGAATGAGTGGATGGATGG + Intronic
971352659 4:25866952-25866974 TGGGAGGGTAAGTGGATGGAAGG - Intronic
972191375 4:36595678-36595700 TTGGTGAGTGAGTGGGTAGGGGG + Intergenic
976651882 4:87444424-87444446 TGGGTGAGTAAGTGGATGGATGG - Intronic
976828028 4:89282000-89282022 GTAGAGAGTGAGTGGGTGCCTGG + Intronic
977604542 4:98969477-98969499 TTGAAGAGTGAGTGGTTAACGGG + Intergenic
980230190 4:130038531-130038553 GAGGAGTGTGAGTGCATGGCGGG - Intergenic
980738703 4:136922934-136922956 TTCCAGTGTGACTGGATGGCAGG - Intergenic
981306129 4:143248619-143248641 TTGGAGAGTGAGGAGCTGACAGG + Intergenic
982936213 4:161479933-161479955 TGGGTGAGTGAATGGATGGATGG + Intronic
984667164 4:182441462-182441484 TTTGGGAATGAGTGGATGGATGG - Intronic
985025032 4:185732196-185732218 TTGGAGAGTGACGGAATGCCTGG - Intronic
985380546 4:189390301-189390323 TGGGTGAGTGGGTGGATGGATGG + Intergenic
985547548 5:517586-517608 TGGGTGAGTGAGTGGATGGATGG - Intronic
985560585 5:584107-584129 TGGGTGGGTGAGTGGATGGGTGG + Intergenic
985560621 5:584235-584257 TGGGTGGGTGAGTGGATGGATGG + Intergenic
985560637 5:584294-584316 TGGGTGGGTGAGTGGATGGCTGG + Intergenic
985560773 5:584778-584800 TGGGTGGGTGAGTGGATGGATGG + Intergenic
985560896 5:585202-585224 TGGGTGGGTGAGTGGATGGATGG + Intergenic
985560924 5:585310-585332 TAGAAGGGTGAGTGGATGGATGG + Intergenic
985662854 5:1166007-1166029 TGGGTGAGTGGGTGGATGGATGG - Intergenic
985662866 5:1166051-1166073 TGGGTGAGTGGGTGGATGGATGG - Intergenic
985662992 5:1166574-1166596 CTGAAGAGTGGGTGGATGGATGG - Intergenic
985797876 5:1977054-1977076 TGAGTGAGTGAGTGAATGGCTGG + Intergenic
985829658 5:2219156-2219178 TGGGTGAGTGAATGGATGGGTGG - Intergenic
985837208 5:2280299-2280321 TGGGTGAGTGAGTGGTTGGGTGG + Intergenic
985874412 5:2584509-2584531 TGGGTGAGTGGGTGGATGGATGG + Intergenic
985897667 5:2758737-2758759 TTGGAGAGGAAGTGGAGGGAGGG - Intergenic
986482809 5:8205626-8205648 TTGGAGATTTAGTGGTTGGAAGG + Intergenic
987023186 5:13895996-13896018 TGGGAGAGTGAGTGGAAGCAGGG + Intronic
987068027 5:14308673-14308695 TAGGAGAATGAATGGATGGATGG - Intronic
987964647 5:24855748-24855770 TAGGCCAGTGAGTGGGTGGCGGG - Intergenic
987998376 5:25315511-25315533 TTCGAGTGTCAGTAGATGGCTGG - Intergenic
988171016 5:27655705-27655727 TTGGAGAGTAAGTGGATGTGGGG - Intergenic
988739144 5:34052699-34052721 TTTGACAGTGAGTGGGTGCCAGG - Intronic
991509577 5:67361769-67361791 TTGGAGAGGGACTGGATGGTTGG + Intergenic
991551682 5:67843643-67843665 TGGAAGTGTGAGAGGATGGCTGG - Intergenic
992021399 5:72628184-72628206 GTGGAGAGTGAGGGGAGGGAGGG + Intergenic
992817466 5:80458325-80458347 AGGGAGAGTAAGAGGATGGCTGG - Intronic
993655410 5:90572425-90572447 TTGGTGAATGAATGGATGACTGG - Intronic
996081882 5:119266479-119266501 CTGGAGATTGAGGGGATGGAGGG - Intergenic
998164518 5:139835345-139835367 TGGGTGAGTGAATGGATGGATGG - Intronic
998354040 5:141519768-141519790 ATGGTGAGTGAGTGGAAAGCTGG - Intronic
999245010 5:150149517-150149539 TTGGTGGGTGGGTGGATGGATGG - Intronic
999324803 5:150637260-150637282 TTGGCCAGTGAGTGGATTGTGGG - Intronic
999419121 5:151425575-151425597 TTGGTGGATGAGTGGATGGATGG + Intergenic
999476092 5:151900092-151900114 CAGGAGAGTTAGTGGATGGAAGG - Intronic
999490553 5:152046218-152046240 TTGCAGACAGAGTGGATGTCTGG - Intergenic
1000026475 5:157363297-157363319 TTGCTGAATGAGTGGATGGATGG - Intronic
1000062307 5:157668488-157668510 TTGGTGAGTGAATGGATGAATGG - Intronic
1001088968 5:168723083-168723105 TAGATGAGTGGGTGGATGGCAGG - Intronic
1001646329 5:173284717-173284739 TGGGTGGGTGAGTGGATGGATGG - Intergenic
1001646356 5:173284840-173284862 TGGGTGGGTGAGTGGATGGATGG - Intergenic
1001646415 5:173285114-173285136 TGGGTGGGTGAGTGGATGGATGG - Intergenic
1001686462 5:173597883-173597905 TGGGTGGGTGAGTGGATGGAGGG - Intergenic
1001686494 5:173597967-173597989 TGGGTGGGTGAGTGGATGGAGGG - Intergenic
1001689928 5:173625453-173625475 CTGGATAGTGAGTGGGTGGGAGG - Intergenic
1001751430 5:174134515-174134537 ATGGATAATGAGTGGATGGATGG - Intronic
1001778488 5:174347308-174347330 TGGGTGGGTGAGTGGATGGATGG + Intergenic
1001855754 5:175009341-175009363 TTTGTGAGTGATTGGATGGATGG + Intergenic
1001952086 5:175823421-175823443 TTGGATAATGAGTGGATGAAGGG + Intronic
1002160369 5:177311227-177311249 TTGGAGAGTGGGGAGATGGCAGG + Intronic
1002642040 5:180635075-180635097 TGGGAGGGTGGGTGGATGGATGG + Intronic
1002642124 5:180635347-180635369 TGGGAGGGTGGGTGGATGGATGG + Intronic
1002642138 5:180635391-180635413 TGGGAGGGTGGGTGGATGGATGG + Intronic
1002642152 5:180635435-180635457 TGGGAGGGTGGGTGGATGGATGG + Intronic
1002650890 5:180692771-180692793 TTGGAGAGTGGATTAATGGCAGG - Intergenic
1002949782 6:1798609-1798631 TTGGAGATTCAGCGGGTGGCTGG - Intronic
1003347596 6:5285156-5285178 TTGGAGAGGGAGAGGCTGACAGG + Intronic
1003564445 6:7211309-7211331 TGGGAGGGTGGGTGGATGGATGG + Intronic
1004795979 6:19085232-19085254 TGGCAGAGTAAGTGGATGGTGGG - Intergenic
1005065405 6:21813001-21813023 TTGGATAGTCAGTGAATGTCTGG + Intergenic
1005203756 6:23377439-23377461 TTTGAGATTCAGTGGATGGATGG + Intergenic
1005258825 6:24034814-24034836 CAGGGGAGTGAGTGGATGGGCGG + Intergenic
1005856646 6:29867950-29867972 AGGGACAGTGAGTAGATGGCAGG - Intergenic
1006067138 6:31470235-31470257 AGGGACAGTGAGTAGATGGCAGG + Intergenic
1006287202 6:33105672-33105694 CTGGTGAATGAGTGGATGGATGG + Intergenic
1006299771 6:33187480-33187502 TTGGAGGGTGAATGGAGGGATGG + Intronic
1006478695 6:34274396-34274418 TTGGAGGCTGAGTGGAGGGGAGG + Intergenic
1007218828 6:40262499-40262521 GTGTACAATGAGTGGATGGCAGG - Intergenic
1007847977 6:44776493-44776515 TGGCTGAGTGAGTGGATGGATGG + Intergenic
1008152531 6:47971830-47971852 TTAGAGAGTGACTAGATGACTGG + Intronic
1012151959 6:95764917-95764939 TAGAAGAGTGAATAGATGGCAGG + Intergenic
1013318083 6:108960398-108960420 CTGGAGACTGAGTGGGAGGCAGG + Intronic
1015213134 6:130720605-130720627 TTGGAGAGTAAGTAGATGTTGGG - Intergenic
1018610466 6:165643220-165643242 TAGGTGAGTGAGTGGGTGGGTGG + Intronic
1019103419 6:169650109-169650131 TGGATGAGTGAGTGGATGGATGG - Intronic
1019510762 7:1416187-1416209 TGGGTGGGTGAGTGGATGGATGG + Intergenic
1019549317 7:1594288-1594310 TGGGAGAGTGGGTGGATAGGAGG - Intergenic
1019549401 7:1594612-1594634 TGGGAGGGCGAATGGATGGCAGG - Intergenic
1019704737 7:2492107-2492129 TGGGTGAGTGGGTGGATGGATGG - Intergenic
1019704797 7:2492386-2492408 TGGGTGAGTGGGTGGATGGATGG - Intergenic
1019781770 7:2944613-2944635 TTGGTGAGTGAGTGAATGAATGG - Intronic
1020381216 7:7548731-7548753 TTGGAGAGTGAGTATTTTGCAGG - Intergenic
1020437873 7:8185386-8185408 TTGGTGGGTGGGTGGATGGATGG - Intronic
1021854027 7:24835912-24835934 GTGGAGAGTGGGTGGAGGGTGGG + Intronic
1023780500 7:43650937-43650959 TTGGGGTGTGAGTGGTGGGCAGG + Intronic
1023986425 7:45099817-45099839 TTGGAGATTCAGTGCATGGCTGG - Intergenic
1024094832 7:45975238-45975260 TGGTAGAGCTAGTGGATGGCAGG + Intergenic
1024338185 7:48230763-48230785 TGGATGAGTGAGTGGATGGATGG - Intronic
1024996116 7:55274230-55274252 TTGGAGAGTGAGGAGAAGGGAGG - Intergenic
1025205996 7:56993716-56993738 TAGGAGGGAGAGTGGATGGGAGG + Intergenic
1025665944 7:63583223-63583245 TAGGAGGGAGAGTGGATGGGAGG - Intergenic
1026319644 7:69257645-69257667 TGGGTGAATGAGTGGATGGATGG + Intergenic
1026319697 7:69257983-69258005 ATGGTGAATGAGTGGATGGATGG + Intergenic
1026873337 7:73866466-73866488 TTGGTGGGTGGGTGGATGGATGG - Intergenic
1026975340 7:74494448-74494470 TCTGAGAGTGAGTGAGTGGCTGG + Intronic
1027050572 7:75018980-75019002 CTGGACAGTGGGTGGATGACTGG - Exonic
1028358478 7:89938328-89938350 TGGAAGAGTGAGAGGATGGGAGG - Intergenic
1029382478 7:100222690-100222712 CTGGACAGTGGGTGGATGACCGG + Intronic
1031680751 7:124671288-124671310 TTTGAGAGTGAAGGGTTGGCTGG + Intergenic
1031986801 7:128168676-128168698 TTGGAGAGTGAGTAGAAGAGGGG + Intergenic
1032465941 7:132145099-132145121 TTGGTGAGTGAAGGGAGGGCAGG - Exonic
1033264457 7:139872858-139872880 TGGGTGAGTGAATGGATGACAGG - Intronic
1033542626 7:142371501-142371523 TAGGAGAGTGTGTGGATCTCGGG + Intergenic
1034270494 7:149801302-149801324 TAGGTGAGTGAATGGATGGATGG - Intergenic
1034395843 7:150824570-150824592 TTAGAGAGTGAGCGGCAGGCAGG + Intergenic
1034457908 7:151181413-151181435 TTGGAGCGAGAGTGGATGGTCGG - Exonic
1035236198 7:157499092-157499114 TAGGAGAGTGGGGGTATGGCAGG + Intergenic
1035278878 7:157765112-157765134 ATGGGGAGTGAGTGGATGGATGG - Intronic
1036761587 8:11513246-11513268 TTGAAGTGGGAGTGGATGGTAGG + Intronic
1038228737 8:25681236-25681258 CTGGAGAGTCAGTGGAAGGTAGG + Intergenic
1039921731 8:41897699-41897721 ATGGAGAGGGAGTGGGTGGGCGG - Intergenic
1040932111 8:52746442-52746464 TTGGAAAGGGAGAGGTTGGCAGG + Intergenic
1041588816 8:59551696-59551718 GTGGAGAGTGGGTAGAGGGCAGG - Intergenic
1042570777 8:70162339-70162361 TTGGAGAGTGAGTGAACCCCTGG - Intronic
1042963515 8:74327153-74327175 TTGAAGACAGAGTGGATTGCAGG + Intronic
1044513852 8:93115814-93115836 TTGGAGGTTGAGTGGAGGGTTGG - Intergenic
1045683898 8:104691404-104691426 TTGGAGGGTGGTTGGAGGGCTGG + Intronic
1045776970 8:105815991-105816013 TGGGAAAGTTAGTGGGTGGCTGG - Intergenic
1045786946 8:105932804-105932826 TGGAAGAGTGAGTGGATGAGTGG + Intergenic
1047457106 8:125025056-125025078 TTGGAGAGGTAGGGGAGGGCAGG + Intronic
1049236563 8:141515162-141515184 TGGGTGAGTGAATGGATGGCTGG - Intronic
1049258466 8:141626225-141626247 TTGGAGGGTGATTGGATGGATGG + Intergenic
1049320624 8:141994444-141994466 GTGGATAGTGGGTGGATGGGTGG - Intergenic
1049359851 8:142207271-142207293 TGGGTGGGTGAGTGGATGGATGG + Intergenic
1049411590 8:142476018-142476040 TTGGAGGGTGTGCGGAAGGCTGG + Intronic
1049474796 8:142791879-142791901 TGGGTGAGTGGGTGGATGGATGG - Intergenic
1049474901 8:142792579-142792601 TGGGTGAGTGGGTGGATGGATGG - Intergenic
1049554043 8:143273503-143273525 CGGGTGAGTGAGTGGCTGGCTGG + Intronic
1049582339 8:143418354-143418376 TTAGAGAGTCAGTGGATGAGTGG - Intergenic
1049582346 8:143418385-143418407 TGGATGAGTGAGTGGATGGGTGG - Intergenic
1049885100 9:21497-21519 AGGGAGAGAGAGTGGATGCCAGG - Intergenic
1052599714 9:30609989-30610011 TTGAATAGTGAGTGGAGGACTGG + Intergenic
1052993832 9:34539027-34539049 TTGATGAGTGAGTGGTTGGGAGG - Intergenic
1053024957 9:34721705-34721727 TTCCAGAGAGAGTGGACGGCTGG - Intergenic
1053052053 9:34970224-34970246 TTGGACAGTGAGGGCATGACAGG - Intronic
1053390135 9:37728991-37729013 TTGCATAGTGAGTGGGTGGTGGG + Intronic
1054459177 9:65453489-65453511 TGGGTGAGTGAATGGATGGGTGG + Intergenic
1056430878 9:86526705-86526727 TTGGACAGTGACTTGAGGGCTGG + Intergenic
1056788583 9:89610748-89610770 TGGGACACTGAGTGGATGGAAGG - Intergenic
1057082580 9:92184135-92184157 CTGGAAAGTGAGTGGATGAATGG - Intergenic
1057383539 9:94589209-94589231 TTGGAACGTGAGAGGGTGGCGGG - Intronic
1057829036 9:98393134-98393156 TTGGTGGATGAGTGGATGGATGG - Intronic
1057909451 9:99006372-99006394 CTGCTGAGTGAGTGAATGGCTGG + Intronic
1058035559 9:100248794-100248816 TTGGAGGGAGACTGGAAGGCTGG + Intronic
1059099730 9:111458630-111458652 TTGGAGAGGGAGAGGAGGGTGGG + Intronic
1059332054 9:113541826-113541848 GTGGAAAATGAGTGGATGGGCGG - Intronic
1059956113 9:119517529-119517551 TTCAAGAGTGAGAGCATGGCTGG + Intronic
1060040163 9:120293473-120293495 TTGGTGGGTGGGTGGATGGGTGG + Intergenic
1060385763 9:123226755-123226777 TTGGGGAGTGAGGGGGTGGCGGG + Intronic
1061278996 9:129586334-129586356 AAGGAGAGTGAGTGGAGGGAGGG - Intergenic
1061303398 9:129719055-129719077 TTGAAGAGTGAATGGATGGGTGG + Intronic
1061715997 9:132519213-132519235 TAGGTGAGTGGGTGGATGGTTGG + Intronic
1061846724 9:133392468-133392490 TGGGTGGGTGAGTGGATGGATGG + Intronic
1061846739 9:133392524-133392546 TGGGTGGGTGAGTGGATGGATGG + Intronic
1061846769 9:133392644-133392666 TGGGTGGGTGAGTGGATGGGTGG + Intronic
1061846807 9:133392784-133392806 TGGGTGGGTGAGTGGATGGATGG + Intronic
1061847026 9:133393630-133393652 TAGGTGGGTGAGTGGATGGGTGG + Intronic
1061950570 9:133933704-133933726 ATGGTGAGTGGGTGGATGGATGG + Intronic
1062112593 9:134790330-134790352 TTGGTGGGTGGGTGGATGGATGG - Intronic
1062112630 9:134790434-134790456 TGGGTGAGTGGGTGGATGGATGG - Intronic
1062201299 9:135304228-135304250 ATGGAGGGTGAGTGGATGGATGG + Intergenic
1062201338 9:135304405-135304427 ATGGAGGGTGGGTGGATGGATGG + Intergenic
1062201349 9:135304454-135304476 ATGGAGGGTGGGTGGATGGATGG + Intergenic
1062201364 9:135304511-135304533 ATGGAGGGTGGGTGGATGGATGG + Intergenic
1062201377 9:135304564-135304586 ATGGAGGGTGAGTGGAGGGATGG + Intergenic
1062201399 9:135304663-135304685 ATGGAGGGTGTGTGGATGGGTGG + Intergenic
1062247732 9:135578084-135578106 TGGGTGATTGAGTGGATGGATGG - Intergenic
1062247775 9:135578327-135578349 TGGGTGGGTGAGTGGGTGGCAGG - Intergenic
1062247844 9:135578673-135578695 TGGGTGGGTGAGTGGGTGGCAGG - Intergenic
1062520746 9:136956913-136956935 TTGGATATTGGGTGGATGGATGG + Intronic
1062520767 9:136956990-136957012 TGGGTGGGTGGGTGGATGGCTGG + Intronic
1062520804 9:136957128-136957150 TTGGATATTGGGTGGATGGATGG + Intronic
1062520818 9:136957178-136957200 TTGGATATTGGGTGGATGGATGG + Intronic
1062649741 9:137569438-137569460 TGGGTGAGTGACTGGCTGGCTGG - Intronic
1062649786 9:137569603-137569625 ATGGTGGGTGAGTGGCTGGCTGG - Intronic
1185495147 X:549152-549174 TGGGTGAGTGGGTGGATGGATGG - Intergenic
1185497498 X:566396-566418 TGGGTGAATGAGTGGATGGATGG + Intergenic
1185497562 X:566713-566735 TAGGTGAATGAGTGGATGGCTGG + Intergenic
1185583160 X:1226470-1226492 TTGGTGGGTGGGTGGATGGATGG + Intergenic
1185583217 X:1226706-1226728 TGGGTGAGTGGGTGGATGGATGG + Intergenic
1185616155 X:1423540-1423562 TGGGTGAGTGGGTGGATGGATGG - Intronic
1185624438 X:1472572-1472594 TGGGTGAGTGGGTGGATGGCTGG + Intronic
1185660512 X:1724968-1724990 AGAGAGAGTGAGTGGATGGATGG - Intergenic
1185759609 X:2680570-2680592 TGGAAGGGTGAGTGGATGGATGG - Intergenic
1185759730 X:2681196-2681218 TGGGTGGGTGAGTGGATGGATGG - Intergenic
1185762784 X:2701167-2701189 TTAGTGAGTGGGTGGATGGTTGG - Intronic
1186388591 X:9135019-9135041 TCGGAAAGAGAGTGTATGGCTGG - Intronic
1186481851 X:9902116-9902138 TGGAAGAGTAAGTGGATGGATGG + Intronic
1187686032 X:21816431-21816453 TTTGAAAGTGATTGGCTGGCGGG - Intergenic
1187945251 X:24420076-24420098 GTGGAGAGTGAGAGGAGGGTGGG - Intergenic
1189738384 X:44094408-44094430 TTGGAGGGTGGGGGGATGGAGGG + Intergenic
1190245389 X:48687354-48687376 TAGGTGGGTGAGTGGATGGGTGG + Intronic
1191771785 X:64768119-64768141 ATGGAGAGAGAGTGGAGGGAAGG - Intergenic
1193062421 X:77220542-77220564 GTGGAGGGTGTGTGGTTGGCTGG - Intergenic
1195211155 X:102652936-102652958 TTGGAGAAAGAGAGCATGGCAGG + Intronic
1195265243 X:103173281-103173303 TGGGAGAATGAATGGATGGAGGG + Intergenic
1197751664 X:129968262-129968284 TTGTTGAGTGAGTGTCTGGCAGG + Intergenic
1197770042 X:130083801-130083823 TGGGTGGGTGGGTGGATGGCTGG + Intronic
1200282041 X:154785211-154785233 TTAGAGACTGAGTGGCTGGGGGG - Intronic
1200781580 Y:7221109-7221131 TGGATGAGTGAGTGGATGGATGG + Intergenic
1201144716 Y:11057968-11057990 TGGGTGAATGAGTGGATGGAGGG + Intergenic
1201305863 Y:12550148-12550170 TGGGAGGGTAAGTGGATGGATGG + Intergenic
1201616860 Y:15910051-15910073 TGGCAGGGTGAGTGGATGGAAGG - Intergenic