ID: 902717127

View in Genome Browser
Species Human (GRCh38)
Location 1:18280583-18280605
Sequence TAGCAATAGCACCACCATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 235}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902717127_902717133 18 Left 902717127 1:18280583-18280605 CCTAGATGGTGGTGCTATTGCTA 0: 1
1: 0
2: 0
3: 18
4: 235
Right 902717133 1:18280624-18280646 GGAGACTGAGACAGGGAGATAGG 0: 1
1: 1
2: 17
3: 213
4: 1589
902717127_902717132 11 Left 902717127 1:18280583-18280605 CCTAGATGGTGGTGCTATTGCTA 0: 1
1: 0
2: 0
3: 18
4: 235
Right 902717132 1:18280617-18280639 CAGGTAAGGAGACTGAGACAGGG 0: 1
1: 0
2: 19
3: 148
4: 1172
902717127_902717128 -8 Left 902717127 1:18280583-18280605 CCTAGATGGTGGTGCTATTGCTA 0: 1
1: 0
2: 0
3: 18
4: 235
Right 902717128 1:18280598-18280620 TATTGCTATCCTCATTTTACAGG 0: 1
1: 6
2: 43
3: 236
4: 916
902717127_902717131 10 Left 902717127 1:18280583-18280605 CCTAGATGGTGGTGCTATTGCTA 0: 1
1: 0
2: 0
3: 18
4: 235
Right 902717131 1:18280616-18280638 ACAGGTAAGGAGACTGAGACAGG 0: 1
1: 1
2: 6
3: 108
4: 784
902717127_902717129 -3 Left 902717127 1:18280583-18280605 CCTAGATGGTGGTGCTATTGCTA 0: 1
1: 0
2: 0
3: 18
4: 235
Right 902717129 1:18280603-18280625 CTATCCTCATTTTACAGGTAAGG 0: 2
1: 9
2: 117
3: 809
4: 3399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902717127 Original CRISPR TAGCAATAGCACCACCATCT AGG (reversed) Intronic
901353951 1:8626422-8626444 GAGCAGGAGCATCACCATCTTGG + Intronic
901551910 1:10001735-10001757 TAGTAACACCACCACCTTCTTGG - Intronic
902717127 1:18280583-18280605 TAGCAATAGCACCACCATCTAGG - Intronic
903980900 1:27187408-27187430 TAGCAAGAGCAACTCCATTTTGG - Intergenic
908489472 1:64628746-64628768 TAACAATACCACCCACATCTTGG + Intronic
909783853 1:79584832-79584854 CAGCAGGAGCATCACCATCTTGG - Intergenic
909832688 1:80212757-80212779 TAGCAATAGCACAGCACTCTGGG - Intergenic
909941905 1:81621048-81621070 TAGCAAAAGCACCATGATATGGG - Intronic
910951803 1:92656385-92656407 TAGCAAAAGCAGCACCAAGTGGG + Intronic
911477466 1:98391185-98391207 TTGGAATAGCAACACCATTTGGG - Intergenic
911583295 1:99660105-99660127 TAGCTGCAGCACCAGCATCTAGG + Intronic
918963061 1:191305706-191305728 CAGCAATAATACCACCATCTTGG - Intergenic
920281219 1:204845210-204845232 GAGCAGGAGCACCATCATCTCGG - Intronic
920610209 1:207428537-207428559 GAGCAGGAGCACCATCATCTTGG - Intergenic
1062972680 10:1660825-1660847 GAGCAGGAGCATCACCATCTTGG + Intronic
1064018770 10:11792959-11792981 TAGCGGTAACACCAGCATCTGGG + Intergenic
1064802023 10:19087169-19087191 GAGCAGGAGCACCATCATCTTGG - Intronic
1066056505 10:31686002-31686024 TAGCATCAGCACCTCCATCTTGG + Intergenic
1067327954 10:45287538-45287560 GAGCAGGAGCATCACCATCTTGG - Intergenic
1070540752 10:77413513-77413535 TAGCATGGGCACCACCAGCTGGG + Intronic
1070938883 10:80325297-80325319 CAGCAGTAGCAGCAGCATCTGGG + Intergenic
1072012128 10:91311443-91311465 CAGCACTAACACCAGCATCTGGG + Intergenic
1072024754 10:91443724-91443746 TAGCAACATCAGCATCATCTGGG - Intronic
1072426589 10:95335530-95335552 AAGCTATAGAGCCACCATCTTGG - Intronic
1073276543 10:102316538-102316560 TAGGAACAGAACCACCATTTAGG + Intronic
1073737861 10:106370489-106370511 GAGCAGGAGCACCATCATCTCGG + Intergenic
1073991197 10:109264020-109264042 GAGCAGGAGCACCGCCATCTTGG + Intergenic
1074638735 10:115352847-115352869 GTGCAATGGCACCACAATCTCGG - Intronic
1076918324 10:133437946-133437968 TAGCAGTAACACCAGCGTCTGGG + Intergenic
1077277981 11:1725617-1725639 GTGCAGTGGCACCACCATCTCGG - Intergenic
1079084578 11:17436164-17436186 CAGCAAGAGCACAGCCATCTTGG + Intronic
1080296240 11:30732159-30732181 TAGCAATGGTGCCAACATCTTGG - Intergenic
1080639019 11:34147843-34147865 TAGGAATAGCACCTCCGTCACGG + Intergenic
1081093254 11:38899614-38899636 TAGCAGTAGCAGCACAATTTAGG + Intergenic
1081711840 11:45221895-45221917 CAGCAATGGCACACCCATCTGGG - Intronic
1082758002 11:57096994-57097016 TAGCAAAAGTACCACAAACTGGG - Intergenic
1088142004 11:106628459-106628481 GAGCAGGAGCATCACCATCTTGG - Intergenic
1089087605 11:115836542-115836564 TAGCAATATCAGCACCCTCCAGG + Intergenic
1089853223 11:121518155-121518177 TGGCAATACCCCCACCAACTGGG - Intronic
1094223306 12:28018086-28018108 TAACAATAGAAACACCATTTGGG - Intergenic
1094468866 12:30784246-30784268 GAGCAGGAGCATCACCATCTTGG + Intergenic
1094601078 12:31909440-31909462 GAGCAAGAGCATCACCATCTTGG + Intergenic
1096090337 12:48895468-48895490 GTGCAATGGCACCACGATCTCGG + Intergenic
1097585378 12:61509421-61509443 TAGCAACAGCAGCAGCAACTGGG - Intergenic
1099531840 12:83791765-83791787 CAGCAATATCAGCACCATCTGGG + Intergenic
1099607756 12:84827219-84827241 CAGCAATATCAGCATCATCTGGG + Intergenic
1100898212 12:99209690-99209712 GAGCAGGAGCATCACCATCTTGG + Intronic
1101782506 12:107848471-107848493 GAGCAGAAGCATCACCATCTTGG + Intergenic
1102166299 12:110809512-110809534 TAGCAATTGTACCACCACCAAGG - Intergenic
1103132400 12:118480614-118480636 GAGCAGGAGCATCACCATCTTGG - Intergenic
1103133670 12:118489455-118489477 GAGCAGGAGCATCACCATCTTGG - Intergenic
1107246796 13:38306482-38306504 TGTAAATTGCACCACCATCTAGG + Intergenic
1107624571 13:42270324-42270346 GAGCAAGAGCATCACCATCTTGG + Intergenic
1112364580 13:98745768-98745790 TAACAAAAGCACCACAAACTGGG - Intronic
1112487972 13:99836727-99836749 TCTCTCTAGCACCACCATCTTGG - Intronic
1113355457 13:109575932-109575954 TAGGAAAAGCACTACCTTCTGGG - Intergenic
1115554327 14:34532406-34532428 GTGCGATGGCACCACCATCTTGG - Intronic
1116699989 14:48229045-48229067 TAGCCATAGCAAAACCCTCTGGG - Intergenic
1118164504 14:63323034-63323056 TAGCAACTGCACCATCATCTCGG - Intergenic
1118962162 14:70543863-70543885 GAGCAGGAGCATCACCATCTTGG + Intergenic
1120488472 14:85145848-85145870 TAACAAAACCACCACCAACTGGG - Intergenic
1125791436 15:42369357-42369379 GAGCAGGAGCATCACCATCTTGG - Intronic
1125915751 15:43485790-43485812 GCGCAGTGGCACCACCATCTTGG - Intronic
1127095408 15:55507923-55507945 CAGCAATATTACCATCATCTGGG + Intronic
1127500260 15:59548320-59548342 GAGCAGGAGCATCACCATCTTGG + Intergenic
1131068997 15:89452609-89452631 TAGCACTAGCCCCACCCTCTGGG + Intergenic
1132478261 16:153277-153299 TAGGAGTTGCACAACCATCTGGG + Intronic
1132480346 16:163867-163889 TAGGAGTTGCACAACCATCTGGG + Intronic
1134399721 16:13898738-13898760 TAGCAGCAGCACCAGCACCTAGG + Intergenic
1135810644 16:25583778-25583800 GAGCAGGAGCATCACCATCTTGG + Intergenic
1138967566 16:62103479-62103501 GAGCAGGAGCACCATCATCTTGG - Intergenic
1140957491 16:79878800-79878822 TATCAATAGCTCCAGCATCAAGG + Intergenic
1143755156 17:9061595-9061617 TAGCAATATCAACACCACCTGGG - Intronic
1144126961 17:12212027-12212049 TAATAATAGCACCTCCATATAGG + Intergenic
1147838073 17:43349284-43349306 TAGCAGTAACACCAGCATCTGGG - Intergenic
1148632522 17:49122275-49122297 GAGCAGGAGCATCACCATCTTGG - Intergenic
1152595300 17:81234846-81234868 GAGCAGGAGCATCACCATCTTGG + Intronic
1154505163 18:15030963-15030985 TAACAATAATATCACCATCTAGG - Intergenic
1155235072 18:23810879-23810901 CAGCATTAGCACCACAAGCTGGG - Intronic
1156398960 18:36723762-36723784 TATCAATTGCAGCACCTTCTGGG + Intronic
1156984904 18:43338596-43338618 GAGCAGGAGCACCATCATCTCGG - Intergenic
1158012556 18:52745858-52745880 TAGCAACAGCAACACCTCCTGGG - Intronic
1158827196 18:61236154-61236176 TAGAAATGCCACCACCCTCTAGG + Intergenic
1160276712 18:77443962-77443984 GAGCAATAGAATTACCATCTGGG - Intergenic
1161948526 19:7454091-7454113 TGGGATTAGCAGCACCATCTTGG + Intronic
1163073433 19:14865949-14865971 GAGCAGGAGCACCATCATCTTGG + Intergenic
1163086951 19:14988397-14988419 GAGCAGAAGCACCATCATCTTGG - Intronic
1165342629 19:35223819-35223841 TAACAGTAGCACCAGCCTCTTGG + Intergenic
1165432162 19:35779027-35779049 CAGCAGTGGCACCAGCATCTGGG - Exonic
925650777 2:6086962-6086984 GAACAAGAGCATCACCATCTTGG + Intergenic
926114334 2:10202796-10202818 GAGCAGGAGCATCACCATCTTGG - Intronic
931746677 2:65297117-65297139 TAACAATAGCTCCTCCCTCTTGG - Intergenic
935318250 2:101859211-101859233 TAGCAATAGGACCACAAAATGGG - Intronic
935523047 2:104133076-104133098 TAGCAACATCAGCACCACCTGGG + Intergenic
937054610 2:118923356-118923378 GAGCAGGAGCATCACCATCTTGG + Intergenic
938586045 2:132691578-132691600 GAGCAAGAGAATCACCATCTTGG + Intronic
938816429 2:134909222-134909244 CAGCAACACTACCACCATCTTGG - Intergenic
941855319 2:170225210-170225232 TAGCAATAGCACCCCCTTTTTGG - Intronic
943205642 2:184891033-184891055 GAGCAATACAACCACAATCTTGG + Intronic
943233733 2:185291299-185291321 TAGCAGTAGCACCAGTGTCTGGG + Intergenic
943830848 2:192459714-192459736 TAGCCATTGCACTACCACCTGGG - Intergenic
944756956 2:202773064-202773086 CAGCCATAGCACTACCATCTAGG - Intergenic
945326835 2:208491949-208491971 GAGCAGAAGCACCATCATCTTGG - Intronic
947001094 2:225457054-225457076 GAGCAGGAGCACCATCATCTTGG - Intronic
947463438 2:230322373-230322395 GAGCAGGAGCACCATCATCTTGG + Intergenic
1169995899 20:11556278-11556300 TAGCAATATCAACATCAGCTGGG + Intergenic
1171128075 20:22622307-22622329 GAGCTGGAGCACCACCATCTTGG - Intergenic
1174990431 20:55503380-55503402 TAGCAGTATCAGCACCACCTAGG - Intergenic
1178126005 21:29516382-29516404 CAGCAGTAGTCCCACCATCTGGG + Intronic
1178784302 21:35638283-35638305 TAGCAAATGCAGCACCAGCTAGG - Intronic
1181235165 22:21444203-21444225 TAGGAAGGGCAGCACCATCTGGG - Intronic
1181598013 22:23930226-23930248 CAGCAGTAGCGCCAGCATCTGGG + Intergenic
1181730495 22:24842895-24842917 TAGAAATAGCACCAGCTTCAAGG - Intronic
1183283704 22:36949090-36949112 GAGCAGAAGCATCACCATCTTGG - Intergenic
1183831477 22:40420497-40420519 TACCAATAGCAGCTCCAGCTCGG - Exonic
951254765 3:20435598-20435620 GAGCAATAACAGCACCATCCAGG + Intergenic
951663377 3:25095348-25095370 CAGCAACATCAGCACCATCTGGG + Intergenic
951958411 3:28285204-28285226 CAGCAACAGAACCATCATCTTGG - Intronic
952539311 3:34350669-34350691 TTGCAATAACACCATCACCTGGG + Intergenic
957089436 3:75714329-75714351 TAGCAGTAACGCCAGCATCTGGG - Intronic
959092055 3:101913479-101913501 CAGCAATATCAGCACCATCTGGG - Intergenic
960396222 3:117140964-117140986 TTGAAATAACACCATCATCTTGG + Intergenic
960863920 3:122181403-122181425 GAGGAACAGCCCCACCATCTTGG + Intergenic
961943810 3:130664570-130664592 CAACAATAGCACTAACATCTTGG - Intronic
962337835 3:134552634-134552656 TAATAATAATACCACCATCTAGG - Intronic
962806851 3:138933706-138933728 TAGCAACACCACCTCCATCTAGG - Intergenic
963304041 3:143630355-143630377 TAGCAATGTAACCACCTTCTAGG + Intronic
968039798 3:195579444-195579466 CAGCAGCAGCATCACCATCTTGG + Exonic
971941161 4:33217384-33217406 TACAAATAGCTCCACCATATTGG + Intergenic
972321271 4:37975607-37975629 TAGCGGTAACACCAGCATCTGGG - Intronic
976836074 4:89375447-89375469 TAGCAACAACACCTCCAACTTGG - Intergenic
977091510 4:92682376-92682398 CAGCAACAGCACCATCACCTGGG + Intronic
977392727 4:96432292-96432314 TTGGAATACCACCACCATATTGG + Intergenic
979084339 4:116388102-116388124 GAGCAGTAGCATCGCCATCTTGG + Intergenic
979520131 4:121656359-121656381 TGTCAACAGCACCACCCTCTGGG + Intergenic
982793156 4:159615752-159615774 GAGCAGGAGCATCACCATCTTGG - Intergenic
983111697 4:163758219-163758241 AAGCAATGGCACCCCCAGCTGGG - Intronic
984810960 4:183796552-183796574 CAGCAGTAGCAGCAGCATCTGGG + Intergenic
985185633 4:187312246-187312268 TAGCAACAGGGACACCATCTTGG + Intergenic
985475233 5:75176-75198 CAACACTAGCACCACCATATTGG + Intergenic
987088781 5:14492584-14492606 TAGCAACATCTCCACCATGTTGG + Exonic
988084866 5:26462052-26462074 TAGCAGTATGACCACCATTTAGG - Intergenic
992758057 5:79927440-79927462 TACCAATAGTCCCACCCTCTAGG - Intergenic
993666211 5:90699659-90699681 CACCACTAGCACCACCATCCAGG - Intronic
994624494 5:102201197-102201219 GAGCAGGAGCATCACCATCTTGG - Intergenic
994930191 5:106172935-106172957 GAGCAAGGGCATCACCATCTTGG + Intergenic
995346999 5:111132921-111132943 TAGCAATATCAACATCACCTGGG + Intergenic
997146155 5:131435615-131435637 TAGCAATATCAGAATCATCTGGG - Intronic
998259573 5:140619247-140619269 GAGCAGGAGCACCATCATCTTGG + Intergenic
1000161426 5:158601263-158601285 TAGCAATATCAGCATCACCTGGG - Intergenic
1001868093 5:175123212-175123234 TAACAACAGTACCACCATCATGG - Intergenic
1002109258 5:176897291-176897313 CAGCAATACCACCTCCAGCTCGG - Intronic
1005185356 6:23158390-23158412 TCACAATTGCAACACCATCTAGG + Intergenic
1005713015 6:28520695-28520717 GAGTAATAGGAACACCATCTAGG + Intronic
1005787665 6:29263000-29263022 GAGCAGGAGCATCACCATCTTGG + Intergenic
1005965575 6:30724166-30724188 TGGCAATAGCACAGCCATCCAGG + Exonic
1007667037 6:43520528-43520550 CAGCAAAAGCACAACCCTCTTGG - Intronic
1009260411 6:61479315-61479337 TAGCACTAACGCCAGCATCTGGG + Intergenic
1009663042 6:66638285-66638307 TAGCAATACCACCAGCAGCCTGG - Intergenic
1010479100 6:76328020-76328042 GAGCAAGAGCATCACCATCTTGG + Intergenic
1010917455 6:81637861-81637883 TTGCACTTACACCACCATCTTGG + Intronic
1012397777 6:98819633-98819655 TTCCAACAGCACCACCATCATGG + Intergenic
1012545593 6:100415701-100415723 GAGCAGGAGCACCATCATCTCGG + Intronic
1012790660 6:103690382-103690404 TAGCAACAGCAGCAGCACCTAGG - Intergenic
1012796771 6:103771936-103771958 AAGCTAAAGCACCTCCATCTTGG + Intergenic
1013795091 6:113878800-113878822 TAGCAATAGCCCCTACATTTTGG + Intergenic
1014039093 6:116803467-116803489 TAGCAGTATCAGCATCATCTGGG + Intronic
1016269068 6:142267715-142267737 TAACAATATCCCAACCATCTAGG + Intergenic
1020586941 7:10080269-10080291 GAGCAGAAGCACCATCATCTTGG + Intergenic
1021133446 7:16938397-16938419 TAGTAATAGGAGCACCATTTTGG + Intergenic
1021457801 7:20848270-20848292 CAACAAAAGCACCACTATCTTGG - Intergenic
1023709270 7:42974607-42974629 GAGCAGGAGCACCATCATCTCGG + Intergenic
1023827676 7:44020384-44020406 TAGCAGTAACGCCAGCATCTGGG + Intergenic
1025872409 7:65447269-65447291 TAGCAGTAACACCAGCGTCTGGG - Intergenic
1026146981 7:67754976-67754998 GAGCAGGAGCATCACCATCTTGG - Intergenic
1026381556 7:69804804-69804826 CAGCAATATCATCATCATCTGGG + Intronic
1028035539 7:85976963-85976985 TAGCACAAGCAACACCATTTTGG + Intergenic
1030606597 7:111644777-111644799 TAGCAGTAACGCCAGCATCTGGG + Intergenic
1031781964 7:125979391-125979413 TAGCACAATCACCACCTTCTGGG - Intergenic
1032258126 7:130313031-130313053 GAGCAGGAGCATCACCATCTTGG - Intronic
1034051703 7:147990712-147990734 GAGCAGGAGCATCACCATCTTGG - Intronic
1034922500 7:155095474-155095496 AAGCATGAGCACCGCCATCTTGG + Intergenic
1035770289 8:2141824-2141846 GAGCAGCAGCACCGCCATCTTGG - Intronic
1040279201 8:46029486-46029508 GAGCTCTAGCACCGCCATCTGGG - Intergenic
1040548990 8:48423833-48423855 TAGCAATATCACCTCCATAAGGG + Intergenic
1040920228 8:52607855-52607877 GAGCAAGAGCACCATCATCTTGG - Intergenic
1041750642 8:61257145-61257167 TAGCATTATCCCCACAATCTGGG - Intronic
1045173502 8:99696386-99696408 CAGCATGAGCACCACGATCTTGG - Intronic
1045658795 8:104414444-104414466 TAGCAACATCAACATCATCTGGG - Intronic
1045702432 8:104882111-104882133 TGACAGAAGCACCACCATCTGGG - Intronic
1047819694 8:128505082-128505104 TAGCAGTAACACCACCAACCTGG + Intergenic
1048185614 8:132237902-132237924 GAGCAGGAGCACCATCATCTCGG + Intronic
1048930337 8:139310188-139310210 TAGCAAGAGCACCAAAATCCTGG + Intergenic
1049228449 8:141469477-141469499 CAGCAACATCACCACCATCATGG - Intergenic
1050777484 9:9284249-9284271 TAGCCATAGCACCACAGTCAAGG + Intronic
1050801859 9:9625416-9625438 TATTAATAGCACCAGCGTCTGGG + Intronic
1051626687 9:19105518-19105540 AAGCTATAGCCCCATCATCTTGG - Intergenic
1052718691 9:32148741-32148763 TAGCGGTAACACCAGCATCTGGG + Intergenic
1053038059 9:34842810-34842832 TGGAAATAGTACAACCATCTTGG - Intergenic
1054825760 9:69572045-69572067 TAACACTAGCAGCACTATCTTGG - Intronic
1055068040 9:72138369-72138391 GAGCAGGAGCACCATCATCTTGG - Intronic
1056685941 9:88759450-88759472 TTTCTCTAGCACCACCATCTGGG - Intergenic
1059259498 9:112962244-112962266 CAGCAACAGCAGCATCATCTTGG + Intergenic
1060516451 9:124269141-124269163 TAATAAGAGCCCCACCATCTGGG - Intronic
1060882716 9:127129628-127129650 CAGCACCAGCACCTCCATCTGGG - Intronic
1061246889 9:129405168-129405190 TAACAATAGCACAACCCTCCCGG + Intergenic
1203488161 Un_GL000224v1:77667-77689 TAGCGGTAACACCAGCATCTGGG + Intergenic
1203500782 Un_KI270741v1:19563-19585 TAGCGGTAACACCAGCATCTGGG + Intergenic
1185525155 X:772597-772619 TAGGAATAGCAAAGCCATCTGGG - Intergenic
1185619198 X:1442979-1443001 GAGCAAAAGCATCGCCATCTTGG + Intronic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619886 X:1447381-1447403 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619899 X:1447473-1447495 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619906 X:1447511-1447533 TGGGAGAAGCACCACCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619930 X:1447673-1447695 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619968 X:1447950-1447972 TTGGAAAAGCACCACCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620041 X:1448441-1448463 TTGGAAAAGCACCACCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620076 X:1448698-1448720 TTGGAGAAGCACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1186649839 X:11547404-11547426 TAGCAACATCAGCACCATCTAGG - Intronic
1187136397 X:16551667-16551689 TAGCACAACCACCACCACCTTGG - Intergenic
1187525478 X:20050262-20050284 CAGCAATGGCAGCAGCATCTAGG - Intronic
1188288261 X:28356010-28356032 TAGCACTACCACCACCAGTTGGG - Intergenic
1188612049 X:32112344-32112366 CAGCAACATCAGCACCATCTGGG - Intronic
1189614639 X:42770548-42770570 GAGCAGGAGCATCACCATCTTGG + Intergenic
1189858310 X:45246786-45246808 TACTAATATCAGCACCATCTGGG - Intergenic
1190497783 X:51043180-51043202 TAGCAATATCACTAACATGTAGG + Intergenic
1190848951 X:54219491-54219513 TAGAAATGGTACCACCATGTTGG - Intronic
1194135748 X:90138611-90138633 GAGCAGGAGCATCACCATCTTGG - Intergenic
1194650571 X:96510511-96510533 TAGCAAAATCACAACCATCAGGG - Intergenic
1195532919 X:105977871-105977893 GAGCAGGAGCACCATCATCTTGG + Intergenic
1197230074 X:123994206-123994228 TAGCAACAGCCCCACTCTCTTGG + Intronic
1199438258 X:147838864-147838886 TAACAATAGAACTACCTTCTAGG + Intergenic
1200138955 X:153888035-153888057 TAATAACAGCACCATCATCTGGG - Intronic
1200481510 Y:3708678-3708700 GAGCAGGAGCATCACCATCTTGG - Intergenic
1200877523 Y:8173773-8173795 GAGCAAGGGCACCATCATCTTGG - Intergenic
1201649484 Y:16269869-16269891 TAGCGGTACCACCAGCATCTGGG + Intergenic
1201711740 Y:17000233-17000255 TAGGATTAGCACCATCTTCTTGG + Intergenic
1202104529 Y:21348901-21348923 GAGCAAGGGCACCATCATCTTGG - Intergenic