ID: 902718123

View in Genome Browser
Species Human (GRCh38)
Location 1:18286686-18286708
Sequence CAGGCACAGCAGGCTGTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 368}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902718114_902718123 4 Left 902718114 1:18286659-18286681 CCAGGGAGTCCCAGACAGATCAG 0: 1
1: 0
2: 4
3: 16
4: 205
Right 902718123 1:18286686-18286708 CAGGCACAGCAGGCTGTCCTGGG 0: 1
1: 0
2: 4
3: 45
4: 368
902718119_902718123 -6 Left 902718119 1:18286669-18286691 CCAGACAGATCAGGGTCCAGGCA 0: 1
1: 0
2: 0
3: 11
4: 170
Right 902718123 1:18286686-18286708 CAGGCACAGCAGGCTGTCCTGGG 0: 1
1: 0
2: 4
3: 45
4: 368
902718118_902718123 -5 Left 902718118 1:18286668-18286690 CCCAGACAGATCAGGGTCCAGGC 0: 1
1: 0
2: 0
3: 18
4: 163
Right 902718123 1:18286686-18286708 CAGGCACAGCAGGCTGTCCTGGG 0: 1
1: 0
2: 4
3: 45
4: 368
902718109_902718123 27 Left 902718109 1:18286636-18286658 CCGCCTGGGCCAGGCTACTCTTA 0: 1
1: 0
2: 2
3: 74
4: 1480
Right 902718123 1:18286686-18286708 CAGGCACAGCAGGCTGTCCTGGG 0: 1
1: 0
2: 4
3: 45
4: 368
902718113_902718123 18 Left 902718113 1:18286645-18286667 CCAGGCTACTCTTACCAGGGAGT 0: 1
1: 0
2: 0
3: 9
4: 154
Right 902718123 1:18286686-18286708 CAGGCACAGCAGGCTGTCCTGGG 0: 1
1: 0
2: 4
3: 45
4: 368
902718110_902718123 24 Left 902718110 1:18286639-18286661 CCTGGGCCAGGCTACTCTTACCA 0: 1
1: 0
2: 1
3: 10
4: 131
Right 902718123 1:18286686-18286708 CAGGCACAGCAGGCTGTCCTGGG 0: 1
1: 0
2: 4
3: 45
4: 368
902718108_902718123 28 Left 902718108 1:18286635-18286657 CCCGCCTGGGCCAGGCTACTCTT 0: 1
1: 0
2: 4
3: 21
4: 256
Right 902718123 1:18286686-18286708 CAGGCACAGCAGGCTGTCCTGGG 0: 1
1: 0
2: 4
3: 45
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902718123 Original CRISPR CAGGCACAGCAGGCTGTCCT GGG Intronic
900137502 1:1124588-1124610 CAGGCACTGCAGGTTCTCTTTGG + Intergenic
900625395 1:3606208-3606230 CAGGACCAGCAGCCTCTCCTGGG + Intronic
901432182 1:9223117-9223139 GAGGCAGGGCAGGCTGGCCTAGG - Intergenic
901773014 1:11540337-11540359 CAGGCACAGCAGGTAGCCCAAGG + Intergenic
901924052 1:12554761-12554783 CAGGGCCAGCAGGGTCTCCTAGG + Intergenic
902644983 1:17791697-17791719 CAGGCAAATCAGGCTGGCTTCGG - Intronic
902718123 1:18286686-18286708 CAGGCACAGCAGGCTGTCCTGGG + Intronic
903417921 1:23197053-23197075 CAGGCACACCAGGCTTCCTTGGG - Intergenic
903819905 1:26094260-26094282 CAGCCCCAGCAGGCAGTACTTGG - Intergenic
903938006 1:26909980-26910002 CAGGCAGAGCAGTTTGGCCTGGG + Intronic
904509984 1:30996878-30996900 CAGGCACTGCAGTCAGTGCTAGG - Intronic
904616832 1:31754534-31754556 CAGGCCCTGGAGGCTGGCCTGGG - Intronic
905694535 1:39965135-39965157 GAGGCACAGCAGACTGGGCTGGG + Intronic
906125820 1:43426407-43426429 CAGGCACAGCACCATGTCGTTGG - Intronic
906514810 1:46432619-46432641 CAGGCTCACCATGCTGTCATAGG - Intergenic
907497929 1:54857338-54857360 CAGCCCCAGCAGGAAGTCCTGGG + Intronic
908169095 1:61487241-61487263 CAGGTCCAGCAGGATGGCCTGGG - Intergenic
908769764 1:67585272-67585294 CACGGACAGCAGGCTGCCCAGGG + Intergenic
911435126 1:97846077-97846099 TCGGCCCAGCAGGCTGTTCTCGG - Intronic
912775239 1:112502582-112502604 CGGGGAAAGCAGGCTGTCCTTGG - Intronic
914450162 1:147784540-147784562 GAGGCACAGCTGGCTGTTCTGGG - Intergenic
915080552 1:153348960-153348982 CAGGCCCTGCAGGCTTTCCCAGG - Intergenic
915238236 1:154501712-154501734 GCGGGACAGCCGGCTGTCCTTGG + Exonic
915384071 1:155473377-155473399 TAGGCACAGAAGGATGTCATTGG - Intronic
915489091 1:156241653-156241675 CACCCACAGCAGGCTGCCTTTGG + Intronic
917978975 1:180257790-180257812 CACGCACAGGAGGCTGACATGGG + Intronic
918799871 1:188958806-188958828 CAGGGACATCAAGGTGTCCTGGG - Intergenic
919753303 1:201051810-201051832 CAGGCAGTGCAGGGTGGCCTCGG + Intronic
920247450 1:204599282-204599304 CAAGAACAGCAGGCTCCCCTGGG + Intergenic
920400226 1:205671437-205671459 CAGACTCTGCAGGCTGACCTGGG + Intronic
920856993 1:209670922-209670944 CAAGCACAGTAGCCTGTCCTTGG - Intergenic
920948479 1:210551474-210551496 ACAGCCCAGCAGGCTGTCCTAGG - Intronic
922064958 1:222127756-222127778 TAGGAACAGCAGTCTTTCCTGGG - Intergenic
922208843 1:223471648-223471670 CAGCCACAGCAGATTGGCCTTGG - Intergenic
922702360 1:227769308-227769330 AAGGCACACCAGGCCTTCCTGGG - Intronic
923063875 1:230500629-230500651 CAGCCAGAGCAGGATGACCTCGG + Intergenic
1062800952 10:379920-379942 CAGGCAGAAAAGGCTGTCCCTGG + Intronic
1062801031 10:380464-380486 CAGGCAGAAGAGGCTGTCCCTGG + Intronic
1063443836 10:6095561-6095583 CAGGGAAAGCAGACTGTCCAGGG - Intronic
1063529700 10:6819370-6819392 CATGAACAGGAGGCTGACCTGGG + Intergenic
1063849798 10:10174373-10174395 CATTCACAGCAGACTGACCTGGG - Intergenic
1065571347 10:27073305-27073327 CACGCACATCATGCTGTCGTGGG - Intronic
1067571647 10:47376200-47376222 CAGGCACCCCAGGCAGTCCATGG - Intronic
1067763727 10:49069809-49069831 CATGCACAGCTGTCTGTCCAGGG + Intronic
1068287874 10:54962811-54962833 TTGGCCCAGCAGGCTGTTCTTGG - Intronic
1068894229 10:62181636-62181658 CCGCCACAGCAGTCTGGCCTGGG + Intergenic
1070305285 10:75235670-75235692 CTGCCACAGGCGGCTGTCCTCGG + Exonic
1070353500 10:75616146-75616168 CAGGCAAGGCAGGCTGTGCAGGG + Intronic
1070551748 10:77495697-77495719 CAGGCACAGCCTGCCGTGCTGGG + Intronic
1070668650 10:78362896-78362918 CAGGCCCAGCAGGCTGTCTATGG - Intergenic
1070748670 10:78951018-78951040 CTGGCACCCCAGGCTGACCTTGG - Intergenic
1070788013 10:79173438-79173460 CAGGGACACTAGGCTGCCCTTGG - Intronic
1070960295 10:80494600-80494622 CAGGAACAGCAGACTATCCTGGG - Intronic
1071508247 10:86245791-86245813 CAGCCACAGCTGGCCGGCCTTGG + Intronic
1072621085 10:97079841-97079863 CAGGCACAGCACCCTGCTCTGGG + Intronic
1073316519 10:102585016-102585038 CAGGCACAGCAGCCTGGCCTGGG - Intronic
1073890489 10:108096061-108096083 TTGGCCCAGCAGGCTGTGCTTGG + Intergenic
1074145125 10:110710747-110710769 CAGGAACAGCTGCCTGCCCTGGG + Intronic
1074383950 10:113002462-113002484 CTGTCACAGGGGGCTGTCCTGGG - Intronic
1075397865 10:122141000-122141022 CAGGCACAGCAGGATAGCCCAGG + Intronic
1075410056 10:122220921-122220943 CAGGCACACCTGGCTCTCCACGG - Intronic
1076074537 10:127522766-127522788 CACCCACACCTGGCTGTCCTTGG + Intergenic
1076380306 10:130020788-130020810 CAGGAACACGAGGCTGTCATCGG + Intergenic
1076658073 10:132037362-132037384 AATGCACAGGAGGCTCTCCTAGG + Intergenic
1077138402 11:1012876-1012898 CATCCCCAGCAGCCTGTCCTTGG - Exonic
1077217788 11:1402231-1402253 CAGGCACAGCAGGCTGTGGTGGG + Intronic
1077368749 11:2171901-2171923 CAGGCACAGCAGGCAGGGGTGGG - Intergenic
1078050406 11:7960784-7960806 AAGGTGCAGCAGGCTCTCCTTGG + Exonic
1080591350 11:33725583-33725605 AAGGAACGGCAGGCTTTCCTGGG + Intronic
1080802291 11:35619340-35619362 CAGGCTCACCACGCTGCCCTCGG - Exonic
1081574052 11:44308668-44308690 CAGCCACAGGAGGCAGGCCTGGG - Intronic
1083291000 11:61690071-61690093 CAGGCACCGCAAACTCTCCTGGG + Intronic
1083306869 11:61766003-61766025 CAGGCATCGCAGGCTGCCCGTGG - Exonic
1083618232 11:64036580-64036602 CAGGGACAGCCGGCCGGCCTGGG + Intronic
1083625438 11:64069686-64069708 CAGGCAGAGCAGGCGGTGGTGGG + Intronic
1083682938 11:64359558-64359580 CAGGCAAGGCAGGCTGTGCCGGG - Intronic
1083898445 11:65632085-65632107 CAGGCACAGCAGGGCAACCTGGG - Intronic
1084208623 11:67610718-67610740 GAGGGACAGCAGGCGGCCCTGGG - Intronic
1084566440 11:69931437-69931459 CAGGCAGAGCAGGGTCTCCAGGG + Intergenic
1084858610 11:72004143-72004165 GTGGCACAGCACGCTGGCCTGGG - Intronic
1085055459 11:73400733-73400755 GAGGCACAGAGGACTGTCCTGGG - Intronic
1085468502 11:76740433-76740455 CTGGCACAGCAAGCTGTTCCAGG - Intergenic
1085475413 11:76785733-76785755 CAGGCACAGCAGGGTGCGGTTGG + Intronic
1086850370 11:91800447-91800469 TTGGCCCAGCAGGCTGTGCTTGG - Intergenic
1091140356 11:133229114-133229136 CAGGCCCAGCTGGCTCTCCGGGG - Intronic
1091271454 11:134314416-134314438 CAGGCTCAGGAAGGTGTCCTTGG - Exonic
1091649421 12:2298839-2298861 CAGGCACAGAAGGGTGGGCTGGG - Intronic
1091729426 12:2869310-2869332 CAGCCACTGCACGCTATCCTGGG - Intronic
1091749642 12:3014369-3014391 CATCCACTGAAGGCTGTCCTTGG - Intronic
1092238586 12:6824295-6824317 CAGGCACTGCATGCCGTCATGGG + Exonic
1092779233 12:11969991-11970013 AAGACACTGCAGGTTGTCCTGGG + Intergenic
1092787957 12:12046559-12046581 CATCCTCAGCAGGCTGGCCTGGG + Intergenic
1094176349 12:27545766-27545788 TAGGGACAGAAGGCTTTCCTAGG + Intronic
1095724163 12:45433841-45433863 CAGCCACAGCAGGTTATTCTAGG - Intronic
1095894899 12:47270350-47270372 CAGACACAACAGGATGTCATAGG + Intergenic
1097240618 12:57572575-57572597 CAGGGACAGCATGGTGGCCTGGG - Exonic
1100409848 12:94304873-94304895 CAAGCACAGCAAGCATTCCTGGG - Intronic
1101083733 12:101214583-101214605 TAGACACAGCAGGGGGTCCTGGG - Intergenic
1101953900 12:109197188-109197210 CATGCACAGCTCTCTGTCCTAGG + Intronic
1102007171 12:109596327-109596349 AAGGCACAGCAGGAAGGCCTGGG + Intronic
1102200217 12:111052933-111052955 CAGGTACAGCAGGCAATCCTGGG - Intronic
1102299543 12:111761111-111761133 AGGGCACAGCACGCTCTCCTTGG - Intronic
1102556499 12:113730108-113730130 CAGCCACAGCTTGCTTTCCTTGG + Intergenic
1102785633 12:115602259-115602281 CAGGCACAGTAGCCTGCCCAAGG - Intergenic
1102827053 12:115956857-115956879 CAGGCAGAGCAGGATGCCCAGGG + Exonic
1103261457 12:119593009-119593031 CAGGTAGATCAGGCTGGCCTAGG - Intergenic
1103644693 12:122382021-122382043 CAGGTTCACCAGGCTGGCCTTGG - Intronic
1103781588 12:123402385-123402407 CAGGCGCTGCAGTCTGTGCTGGG - Intronic
1103795346 12:123499439-123499461 CAGGCCCAGCTCCCTGTCCTTGG + Exonic
1103949821 12:124544608-124544630 GAGGCAGAGGAGGATGTCCTGGG - Intronic
1104378806 12:128288873-128288895 CAAGAAGAGCTGGCTGTCCTGGG - Intronic
1104475761 12:129069146-129069168 CAGTCACAACTGGCTGCCCTCGG + Intergenic
1104746095 12:131211356-131211378 CACTCAGAGCAGGCTCTCCTTGG + Intergenic
1105628395 13:22136691-22136713 CAGTCACAGCAAGGTGCCCTTGG + Intergenic
1106086398 13:26546202-26546224 CAGGCACAACAGGCTGCTGTGGG - Intergenic
1108505752 13:51110943-51110965 CAGGTACTGCAGGCAGTCCTGGG + Intergenic
1108684195 13:52804675-52804697 CAGGCAGAGCAGTCTGCCCTGGG - Intergenic
1109156245 13:58913630-58913652 CAGAGAAAGCAGGCTTTCCTTGG - Intergenic
1112332859 13:98490070-98490092 CTGGCAGAGCTGGCTGTCTTGGG - Intronic
1114598506 14:23934705-23934727 CAAGCATTGCAGGCTGTTCTAGG - Intergenic
1114643595 14:24241193-24241215 CAGGCACAGCAGGTTTCGCTGGG - Exonic
1115075217 14:29380965-29380987 CAGGCGCAGTTGGCTGTCCAAGG + Intergenic
1116264411 14:42668279-42668301 CATGCACAGCTGTCTGCCCTGGG - Intergenic
1119139676 14:72255036-72255058 GAGACACAGCAGGCTGTGCTGGG + Intronic
1119279991 14:73398052-73398074 CATGCATTGCAGGCTGTCTTAGG - Intronic
1121562761 14:94887068-94887090 CATTCACAGGAGGCTGGCCTGGG + Intergenic
1121659700 14:95625556-95625578 GAGGCAAAGCTGGCTGGCCTTGG + Intergenic
1122078006 14:99247936-99247958 GAGACAGAGCAGGCGGTCCTGGG + Intronic
1122421410 14:101579782-101579804 CAGGGACATCAGGCTCTCCAGGG - Intergenic
1123449010 15:20348983-20349005 CAGGCACAGGAGGGAGGCCTGGG - Intergenic
1123482517 15:20645992-20646014 CATGCACGGAAGGGTGTCCTGGG + Intergenic
1123699317 15:22902837-22902859 CAGCCACAGCAGGCAGGACTGGG + Intronic
1124798987 15:32811078-32811100 GAGGCACAGCACGCTGACATCGG + Intronic
1125009918 15:34860367-34860389 CAGGCAGAGCGTGCTGACCTGGG - Intronic
1128986794 15:72228219-72228241 CGGGCACAGCCGCCTCTCCTGGG - Intronic
1130749881 15:86700316-86700338 CTGGCACAGCAGTATGTTCTAGG + Intronic
1131072007 15:89471836-89471858 CAGGCTCCACAGACTGTCCTGGG - Exonic
1131351520 15:91705093-91705115 TAGGACCAGCAGGCTATCCTGGG - Intergenic
1132231004 15:100184228-100184250 CAGGGAGAGCAGACTGTTCTTGG + Intronic
1132568223 16:632838-632860 CAGGCCCCGCAGGCAGGCCTCGG - Exonic
1132581576 16:687101-687123 CTGGCACAGCGAGCTGTCCTTGG + Exonic
1132710880 16:1266702-1266724 CCGGCGCTGCTGGCTGTCCTTGG - Intergenic
1132865106 16:2089429-2089451 CAGGTACAGCGGGCTGTGCCCGG - Exonic
1133446493 16:5865531-5865553 CAGGCAGAGCTCGCTGTCCATGG - Intergenic
1134301582 16:12996417-12996439 CAGGCTCAGGAGGGTGTTCTGGG - Intronic
1135008428 16:18849806-18849828 CAAGCAGTGCAGGGTGTCCTAGG + Intronic
1135597610 16:23755664-23755686 CAGGCGGAGCAGGCTGGCTTGGG - Exonic
1137675278 16:50300998-50301020 GATGCACAGCAGGCAGGCCTGGG - Intronic
1138542104 16:57694826-57694848 CAGCTAGAGCAGGCTGTCCTCGG + Exonic
1138688491 16:58747073-58747095 CAGAGGCAGCAGCCTGTCCTGGG + Intergenic
1139481011 16:67230711-67230733 CAAGCTCCGCAGGCTCTCCTCGG + Exonic
1140030007 16:71328156-71328178 CCTGCACTGCAGGTTGTCCTTGG - Intergenic
1140111884 16:72011842-72011864 CAGGCCCTAAAGGCTGTCCTGGG - Intronic
1140730261 16:77849991-77850013 CAGGAACAGGAGCCTGACCTTGG - Intronic
1141934374 16:87227605-87227627 CAGGCAGAGCAGGAGGCCCTGGG - Intronic
1142149089 16:88504885-88504907 CAGGCCCAGTGGCCTGTCCTGGG - Intronic
1144629689 17:16864706-16864728 CTGGCAGAGCAGGCTGCCCAAGG + Intergenic
1144651739 17:17011411-17011433 CTGGCAGAGCAGGCTGCCCAAGG - Intergenic
1145939822 17:28737522-28737544 CAGGGACAGCGAGCGGTCCTGGG + Intronic
1146075382 17:29723987-29724009 CAGGCACAGTAGCCTCTCTTAGG + Intronic
1146445116 17:32927412-32927434 CAGGCAGGGCAGGCTGCCCTGGG - Intergenic
1147597809 17:41727915-41727937 CAGGCACATCAGTGAGTCCTTGG + Intronic
1148773122 17:50078307-50078329 TAGGCACAGCAGGCTGGGGTGGG - Intronic
1149005481 17:51800980-51801002 CAGGCAGACCAGGCACTCCTAGG - Intronic
1149453855 17:56771364-56771386 GAGGGACAGCTGACTGTCCTGGG - Intergenic
1149867561 17:60159139-60159161 CAGGCACCTCATCCTGTCCTGGG - Intronic
1150306366 17:64088741-64088763 CATGCACCACAGGCTTTCCTAGG + Intronic
1150759290 17:67945713-67945735 CACGAACAGGAGACTGTCCTTGG - Exonic
1151733101 17:75922542-75922564 CAGGGACATCACCCTGTCCTGGG - Intronic
1151773864 17:76184557-76184579 CAGGCACATCAGTCTGTCTCAGG - Intronic
1152240355 17:79157648-79157670 CCGGCAGAGCTGGCTCTCCTGGG - Intronic
1152500666 17:80706643-80706665 CAGACACTGCAGGCTCCCCTAGG - Intronic
1152566800 17:81103873-81103895 CAGGCAGAGCAGGCTGTTGCTGG - Intronic
1152743792 17:82030174-82030196 CAGGCCCAGCTGGCTGACCCGGG - Exonic
1152755205 17:82084350-82084372 CATACCTAGCAGGCTGTCCTGGG + Exonic
1152869216 17:82743054-82743076 CAGCCACAGCTGGCTCCCCTGGG + Intronic
1154086844 18:11313876-11313898 CAGGAAAAGCAGGCTTCCCTTGG + Intergenic
1155429217 18:25738100-25738122 CAGGGACAGCTGGCACTCCTGGG - Intergenic
1155939221 18:31786974-31786996 GATGCGCAGGAGGCTGTCCTGGG + Intergenic
1156457440 18:37302661-37302683 GAGGCACAGCAGAGTTTCCTGGG + Intronic
1156481705 18:37440430-37440452 CAGGCTCAGCCCGCTGTCCCAGG + Intronic
1157045794 18:44100339-44100361 CAGGCAAAGCAAACTGCCCTGGG - Intergenic
1157309036 18:46538128-46538150 TGGGCTCAGCAGGCTGTCCAGGG - Intronic
1157506004 18:48227134-48227156 CAGGCATGGCTGGCTCTCCTTGG - Intronic
1157725586 18:49961135-49961157 CATGAACAGCAGGATGGCCTAGG + Intronic
1157740794 18:50090947-50090969 CAGGCTGTGCAGGCTGTCCTGGG - Intronic
1158517090 18:58139704-58139726 CAGGCACAGCTGCCTCTGCTCGG - Intronic
1158986967 18:62827671-62827693 CAGTCAGATCAGCCTGTCCTTGG - Intronic
1161154777 19:2726948-2726970 CAGGCACAGAAGCCTGTTCTGGG + Intronic
1161162144 19:2767514-2767536 CAGCAACAGCAGGCAGCCCTGGG - Intronic
1162017311 19:7852511-7852533 CAGGCCAAGGAGGCTCTCCTGGG - Intronic
1162159622 19:8702129-8702151 AAGGCACAGCAGGCTGACCTAGG - Intergenic
1162562029 19:11422498-11422520 CAGGTGCTCCAGGCTGTCCTTGG + Exonic
1163089663 19:15010971-15010993 CGGGTCCAGCACGCTGTCCTTGG - Exonic
1163367947 19:16886631-16886653 CACGCACAGGAAGATGTCCTTGG - Intergenic
1163797266 19:19344853-19344875 CTGGCACAGCTGGCAGACCTGGG - Exonic
1165044495 19:33093996-33094018 CAGCCACAGCAGGCTGCACTGGG - Intronic
1165721472 19:38082365-38082387 CAGTGGCAGGAGGCTGTCCTTGG - Exonic
1167277187 19:48545560-48545582 CAGCCAGGGCTGGCTGTCCTCGG + Intergenic
1168282417 19:55312588-55312610 CAGGGACAGCTGGCTGGCCTTGG + Intergenic
925775683 2:7333144-7333166 TAGGCACAGAGAGCTGTCCTGGG - Intergenic
925890573 2:8430890-8430912 AAGCCCCAGAAGGCTGTCCTGGG - Intergenic
926014151 2:9434480-9434502 CAGGATCAGCAGGCTGTCTCTGG + Intronic
926218488 2:10920002-10920024 CAGGCTCAGCAGCCTGCACTTGG - Intergenic
927711594 2:25329521-25329543 CTGGCACAGCAGCCGTTCCTAGG - Intronic
928330520 2:30354682-30354704 CAGCCACAGCAGGCAGAACTGGG + Intergenic
928431160 2:31219369-31219391 CAGGCATACTAGTCTGTCCTGGG - Intronic
931937303 2:67213714-67213736 CACCCTCAGCAGGCTGTCCTGGG + Intergenic
932323235 2:70837353-70837375 CAGGAAAAGAAAGCTGTCCTGGG + Intergenic
932374414 2:71222965-71222987 CAGGCACACCAGGTTTACCTTGG + Intronic
932560830 2:72867345-72867367 CATGCACAGCTGTCTGTCATGGG - Intergenic
932659717 2:73641625-73641647 CAGACACAGAAGTCTGTCCATGG - Exonic
932666280 2:73701302-73701324 CAGACACAGAAGTCTGTCCATGG - Intergenic
933810727 2:86031330-86031352 CTGGCACCACAGGCTCTCCTCGG + Exonic
933966281 2:87431988-87432010 CAGGCACAGCACCTTGGCCTGGG + Intergenic
934136417 2:89000384-89000406 CAGGCACAGCAGGTAGTATTGGG + Intergenic
934636147 2:95991786-95991808 CAGGCAAAGCAGTCTGTCCACGG + Exonic
934835907 2:97589799-97589821 CAGGCAAAGCAGTCTGTGCACGG + Exonic
935333854 2:101997249-101997271 GAGGCACAGCGGGGTGACCTCGG - Intronic
936141648 2:109946980-109947002 CGGGCAAAGCAGGTGGTCCTGGG - Intergenic
936153336 2:110033380-110033402 CATGCACAGCAGGCTATCCATGG - Intergenic
936178336 2:110244928-110244950 CGGGCAAAGCAGGTGGTCCTGGG - Intergenic
936191345 2:110338035-110338057 CATGCACAGCAGGCTATCCATGG + Intergenic
936203042 2:110424504-110424526 CGGGCAAAGCAGGTGGTCCTGGG + Intronic
936327517 2:111518497-111518519 CAGGCACAGCACCTTGGCCTGGG - Intergenic
936475558 2:112836737-112836759 AAGGCACAACAGGCTGCTCTGGG - Exonic
937877889 2:126839209-126839231 CAGGCACAGGACTCAGTCCTGGG + Intergenic
938342552 2:130545129-130545151 CAGTCCCAGGAGGCTGTCTTTGG + Intronic
938347280 2:130575580-130575602 CAGTCCCAGGAGGCTGTCTTTGG - Intronic
938618944 2:133029733-133029755 CAGGCATATCAGGCTGTGCTAGG + Intronic
939632836 2:144546085-144546107 GAGGCACAGCAGCATGTCCAAGG - Intergenic
939694374 2:145306049-145306071 TAAGCACCCCAGGCTGTCCTGGG + Intergenic
943441809 2:187934870-187934892 TTGGCTCAGCAGGCTGTGCTTGG + Intergenic
944319813 2:198326466-198326488 CACTCAAGGCAGGCTGTCCTGGG + Intronic
947815638 2:233034552-233034574 CTGGCACTCCAGGGTGTCCTGGG - Exonic
947853981 2:233310870-233310892 CAGGCAAAGCCGGATCTCCTGGG - Intronic
947876504 2:233471177-233471199 CAGCGACAGGAGGCTGTGCTGGG - Exonic
948090685 2:235292224-235292246 CAGGCATAGCAGGATGTGCCAGG - Intergenic
948604729 2:239127719-239127741 CAGGAACAGCAGGCTGCCTCAGG - Intronic
948786589 2:240355955-240355977 CAGGGACAGCAGGAGGCCCTGGG + Intergenic
949051665 2:241900949-241900971 CTGACACCGCAGGCTTTCCTGGG - Intronic
1169284366 20:4295532-4295554 CAGGCACAGCATGAGGACCTGGG - Intergenic
1169350396 20:4863722-4863744 CAAGCACACCAGGCAGGCCTGGG + Intronic
1172229297 20:33326274-33326296 CAGGCACAGCTCGCTGGCCCTGG - Intergenic
1172839967 20:37897038-37897060 CAGGGACAGCAGGGGGGCCTGGG - Intergenic
1173506323 20:43590149-43590171 CAGGCACAGAGCGCTTTCCTGGG + Intergenic
1173576594 20:44116148-44116170 TGGGCTCAGCAGGCCGTCCTTGG + Exonic
1174363527 20:50042954-50042976 GAGGCACAGCAGTTTGTCCAAGG - Intergenic
1175397797 20:58678923-58678945 CAGGCAGAGGAGACTGGCCTGGG - Exonic
1175542472 20:59756353-59756375 GAAGCCCAGCAGGCTGTCCTGGG - Intronic
1175677789 20:60961728-60961750 GAGGCCCAGCAGTCTGTACTTGG + Intergenic
1175921236 20:62451427-62451449 GAGGCAGTGCAGGCTGTCCTAGG + Intergenic
1176103215 20:63373901-63373923 CAGCCACAGCAGGCTCAGCTCGG + Intronic
1176137807 20:63532533-63532555 CAGCTCCAGCAGGCTGCCCTTGG + Exonic
1176145825 20:63565023-63565045 CCGGCACAGCCGGCTCTTCTGGG - Exonic
1176265736 20:64208404-64208426 CAGGCCCAGCTGGCTCTGCTCGG - Exonic
1177117258 21:17101463-17101485 CTGGAAAAGCAGCCTGTCCTGGG - Intergenic
1179032441 21:37732246-37732268 CAGGCACAGCAGGGTGTGTGGGG + Intronic
1179477032 21:41653611-41653633 AAGGCCCAGCAGGCTGCCCAGGG + Intergenic
1179837918 21:44049706-44049728 CAAGCACAGCAGGCCGCCCCAGG - Intronic
1179922388 21:44514140-44514162 CAGCCCCTTCAGGCTGTCCTGGG + Intronic
1180904701 22:19401200-19401222 CAAGCCCAGCAGTCTATCCTTGG + Intronic
1181068080 22:20316003-20316025 CAGGCATGGGTGGCTGTCCTGGG - Intronic
1181168050 22:20993774-20993796 CAGGCACAGCAGGCAGAGCAGGG - Intronic
1181235519 22:21445827-21445849 CAGGCTCAGGTGGTTGTCCTCGG - Exonic
1181483909 22:23218731-23218753 CAGGCGAACCAGGCTGTCCTGGG - Intronic
1181673557 22:24437395-24437417 CAGGCCCAGCAGCATATCCTGGG - Intronic
1182037155 22:27207954-27207976 CCTGCACAACAGGCTGTCTTGGG + Intergenic
1183032412 22:35116051-35116073 CAGGTACAGCAGGGTGTCCAGGG + Intergenic
1183279993 22:36926919-36926941 GAGGTACTGCAGGCTGTCATTGG + Intronic
1183640913 22:39091881-39091903 CAGTCCCTGCAGGCTCTCCTGGG - Intergenic
1184072764 22:42156164-42156186 CAGGGACAGCAGGATGGTCTGGG + Intergenic
1184080334 22:42214866-42214888 CAAGCACAGCACTCTGGCCTTGG - Exonic
1184098970 22:42331562-42331584 GAGGCCCAGCAGGCTGAGCTTGG + Intronic
1184149261 22:42628979-42629001 CAGGCAGAGCACACTGTCCTGGG + Intronic
1184715598 22:46280118-46280140 CAGGAAAAGCAGGCTGTGATGGG + Intronic
1184840992 22:47052362-47052384 CAGGCACAGCGGGCGAGCCTGGG + Intronic
1184997744 22:48222837-48222859 CAGGAAATGCAGGCTGACCTTGG + Intergenic
1185173585 22:49306919-49306941 CAGGCAGTGCAGGCTGTGCCCGG - Intergenic
1185239760 22:49736169-49736191 CAGGCCCTGCTGGCTGACCTTGG + Intergenic
950569075 3:13788886-13788908 TAGTCACGGAAGGCTGTCCTAGG + Intergenic
952178345 3:30891486-30891508 CAGGCAAAGGAGGCTGTTCCAGG + Intronic
954673651 3:52303897-52303919 CTGGCCCAGCAGGATGACCTGGG + Intergenic
954752087 3:52819432-52819454 CAGGAACATCAGGAGGTCCTGGG + Exonic
954929280 3:54266871-54266893 CAGGCAAAGCAGGCCCTCTTAGG + Intronic
954966288 3:54614064-54614086 CAAGCACAGCATGTTGTACTTGG + Intronic
955084783 3:55692272-55692294 CAGTCACAGCAGCCCCTCCTGGG - Intronic
955914546 3:63893624-63893646 CAGCCACTGCAGTCAGTCCTAGG - Intronic
956775936 3:72565625-72565647 AGGGCACGGCAGGGTGTCCTGGG + Intergenic
957118396 3:76057217-76057239 CAGGCACTGCAGGCTGTGGGTGG - Intronic
960589042 3:119347649-119347671 CAAGGACAACAGCCTGTCCTGGG - Intronic
961322085 3:126083548-126083570 CAGGCTCAGCCCACTGTCCTGGG - Intronic
961414424 3:126746940-126746962 CAGGCTAACCATGCTGTCCTTGG - Intronic
962626017 3:137226888-137226910 CAGGATCAGCAGCCTGTGCTAGG - Intergenic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
966337061 3:178880117-178880139 CAGACCCAGAAGGCTGGCCTGGG + Intergenic
966873412 3:184307231-184307253 AAGGCACAGCAGGCTGGGCATGG - Intronic
967565974 3:190972562-190972584 CAGGTACAGACGGCGGTCCTTGG - Intergenic
968440926 4:624059-624081 CAGGCTCTGGAGGCTGTTCTGGG + Intergenic
968515968 4:1015781-1015803 CGGGGCCACCAGGCTGTCCTGGG - Intronic
968547099 4:1205016-1205038 GAGTCGCAGCAGGCTGTGCTCGG + Intronic
968736215 4:2297905-2297927 GTGACACAGCAGGCTGTGCTGGG + Intronic
968808019 4:2787733-2787755 CAGGCAGGGCAGGCCCTCCTGGG + Intergenic
968866995 4:3219445-3219467 CAGGCACTGCAGTCTCTCCCTGG + Intronic
968882067 4:3306224-3306246 CATGCACAGCAGGCTTGCCTTGG + Intronic
969129933 4:4983723-4983745 CAGGCAAGGCAGGCTCTCATGGG + Intergenic
969249445 4:5957329-5957351 AGGGCTCAGCTGGCTGTCCTCGG + Exonic
971909158 4:32772362-32772384 TAGAAACAGCAGGATGTCCTAGG - Intergenic
972108195 4:35520256-35520278 CCTGCACAGCAGGCTTGCCTGGG - Intergenic
972788334 4:42347351-42347373 CAGGCCTGGCAGGCTGTACTTGG - Intergenic
972933616 4:44104694-44104716 CAGGCACAGTTGGCTGGCATGGG + Intergenic
974607818 4:64174801-64174823 TAGGCCCAGCAGGCCGTGCTTGG - Intergenic
976389963 4:84497515-84497537 CAGGCACGGCAGGCAGGCATCGG + Intronic
977657683 4:99541299-99541321 CAGATACAATAGGCTGTCCTTGG - Intronic
978800281 4:112749605-112749627 CAGTCACAGCAGTGTTTCCTAGG + Intergenic
978822138 4:112979117-112979139 TTGGCCCAGCAGGCTGTGCTTGG + Intronic
980828781 4:138104591-138104613 CAGGAACAGGAGCCAGTCCTGGG + Intergenic
982955936 4:161766342-161766364 GAGGCACAGCAGGCTTCACTTGG - Intronic
983272600 4:165580584-165580606 CATGCACAGCAGACTGTTCTAGG - Intergenic
985272630 4:188208640-188208662 CACGCCCCGCAGGCTCTCCTTGG + Intergenic
985791564 5:1931049-1931071 CAGGCACCGCCGGCTGCCCTAGG - Intergenic
986706098 5:10455902-10455924 GAGGCACAGCTGCCTGTGCTGGG - Intronic
990478759 5:56187173-56187195 CAGGACCAGCTGGATGTCCTAGG + Intronic
990610153 5:57448849-57448871 CAGGCACAGCAGGTTTTCTTTGG + Intergenic
992013724 5:72556043-72556065 TAGGCACAGCAGGCTAATCTGGG + Intergenic
992986733 5:82238135-82238157 CAGGCACCTCAGATTGTCCTTGG + Intronic
996545283 5:124671612-124671634 CAGGCACATCATACTGTCCTGGG + Intronic
997195639 5:131977381-131977403 CAGGCACAGCAGGCTGGGAAGGG + Intronic
998518578 5:142779339-142779361 AAGGCACAGAATGCTGCCCTGGG + Intronic
999684485 5:154090015-154090037 CAGGCACTGGAGGATGTGCTGGG - Intronic
1000854029 5:166377936-166377958 CAGGCCTGGCAGGCTGCCCTTGG + Intergenic
1001229845 5:169976988-169977010 ATTGCACAGCAGGATGTCCTGGG + Intronic
1001942222 5:175748865-175748887 CAAGCACAGAAGATTGTCCTTGG - Intergenic
1002416410 5:179123091-179123113 AGGGCACAGCAGGTTCTCCTGGG - Intronic
1002503727 5:179664650-179664672 GAGACCCAGCAGGCTGTCATGGG + Intergenic
1005389500 6:25318771-25318793 CAGGAACAGATGGCTGTCCTGGG + Intronic
1006773931 6:36577320-36577342 CTGGCTCAGAAGGCTGTCCATGG + Intergenic
1010399459 6:75431689-75431711 CAGGCACAGCCAGCTGTCCTAGG + Intronic
1013048718 6:106511970-106511992 CACGAACAGGAGGCTTTCCTGGG + Exonic
1013367013 6:109444211-109444233 CAGGCTCAGCGAGCTGGCCTTGG - Exonic
1016569721 6:145498202-145498224 CAGGAACACCAACCTGTCCTGGG + Intergenic
1017080913 6:150667543-150667565 AAACCACAGGAGGCTGTCCTTGG - Intronic
1017862691 6:158413723-158413745 GCAGCTCAGCAGGCTGTCCTGGG - Intronic
1017926794 6:158917663-158917685 CAGGCAGAGCAGGCTCCACTGGG - Intergenic
1018747389 6:166773040-166773062 CCCGCACAGCAGGCTGACCATGG - Intronic
1019153064 6:170021901-170021923 CAGGAACAGGAAGCTGTCCCAGG + Intergenic
1019592942 7:1844689-1844711 AAGCCACAGCAGGATGTCCTGGG - Intronic
1019594662 7:1852886-1852908 CAGGGACAGCGGCCCGTCCTCGG - Intronic
1020164565 7:5797804-5797826 CAGGCAAAGGAGGCTGGCTTGGG + Intergenic
1021234478 7:18125238-18125260 CTTGCACTGCAGCCTGTCCTAGG - Intronic
1021804440 7:24341170-24341192 CAGGCTCAGCAGTCTGACTTTGG - Intergenic
1023822131 7:43986288-43986310 CAGGCACTTCGGGCTGTCCCTGG - Intergenic
1024224230 7:47313567-47313589 CAGGTACTGCATGCTGTGCTGGG - Intronic
1024251300 7:47507770-47507792 CTGGCACAGGAGGCTGTGTTGGG - Intronic
1024318098 7:48040155-48040177 CAGGCCCTGCAGGCTGGCTTGGG - Intronic
1027734771 7:81919618-81919640 TTGGCCCAGCAGGCTGTGCTTGG + Intergenic
1028221433 7:88201520-88201542 CAAGCACAGAAGTCTGTCTTAGG - Intronic
1028707585 7:93868404-93868426 AAGGCTCAGCAAGGTGTCCTTGG + Intronic
1029750398 7:102539702-102539724 CAGGCACTTCGGGCTGTCCCCGG - Intronic
1029768350 7:102638810-102638832 CAGGCACTTCGGGCTGTCCCCGG - Exonic
1029912977 7:104174574-104174596 CAGGAACAGCAGGCGACCCTAGG + Intronic
1032240353 7:130154625-130154647 CAGGCACTGCGGGCCCTCCTGGG - Intergenic
1032403364 7:131638788-131638810 CAGGCAGAGCTGGCTTTCCTCGG - Intergenic
1032471076 7:132179853-132179875 CAGGCTGAGCGGGCTGTCCGGGG + Exonic
1032991139 7:137396117-137396139 CAGGCACAGCACGCAGCCCTTGG + Intronic
1034493400 7:151406331-151406353 CAGGGACCGCAGGCTTTCCTGGG - Intronic
1034840224 7:154388628-154388650 CAGCCAGAGCACGCTGGCCTGGG - Intronic
1035280964 7:157777670-157777692 TAGGCACAGCAGTCATTCCTGGG + Intronic
1035418454 7:158707994-158708016 CAGGAACTTCAGGCTGTCCCTGG + Intergenic
1037261903 8:17018932-17018954 CAGACACAGCTGGCTGGCCTAGG + Intergenic
1037359462 8:18057979-18058001 GACGCACAGCTGGCAGTCCTGGG + Intronic
1037813165 8:22098445-22098467 CAGGAGCAGCAGGTTCTCCTGGG - Exonic
1037943173 8:22969996-22970018 CAGGTACAGTAGGCTGACGTGGG - Intronic
1037949543 8:23009887-23009909 CAGGCTCTCCAGGCTGTGCTGGG - Intronic
1040933921 8:52764038-52764060 CAGGCACTGCAGGAGGTGCTTGG + Intergenic
1041244939 8:55880434-55880456 CAGGGACAGCAGCCGGCCCTCGG - Intronic
1042128879 8:65566639-65566661 CAGGCACTGTAGGCTTTACTAGG - Intergenic
1042737558 8:72005561-72005583 CAGGCAGAGCAGTCTGACCAGGG - Intronic
1044426801 8:92061697-92061719 CAGGCAGAAGAGGCTGTGCTTGG - Intronic
1045593717 8:103628777-103628799 TAGAGACAGCAGGCTTTCCTTGG - Intronic
1049198746 8:141329650-141329672 CAGCCACAGCAGGCGGGGCTGGG + Intergenic
1049277391 8:141726577-141726599 CAGGGACACCCGTCTGTCCTTGG + Intergenic
1049719389 8:144108602-144108624 CAGCCACAGCAGGCTGAGGTTGG - Exonic
1051357849 9:16255749-16255771 GAGGCCCAGCAGGCTGTGCATGG + Intronic
1051398492 9:16653722-16653744 CAGACCTAGCAGGCTGACCTTGG - Intronic
1053117802 9:35520760-35520782 CAAGCAAAGCAGTCTGTGCTGGG + Intronic
1055371065 9:75600266-75600288 CAGTCAGAGCATGCTGTCCGTGG - Intergenic
1056395751 9:86179858-86179880 CAGGTGCTGCAGGCTCTCCTAGG - Intergenic
1056551879 9:87659340-87659362 CAGGCACAGCAGGGTGATGTGGG - Intronic
1056673076 9:88648112-88648134 CAGGCACACCAGTCTTTCCAAGG + Intergenic
1056741672 9:89261555-89261577 AAGACCCAGCAGGCTGTGCTTGG + Intergenic
1056771505 9:89481091-89481113 CAGGCACTGCATGCTCTCCGAGG + Intronic
1057494848 9:95553040-95553062 CAGGCACAGCAGGCTGGGGCCGG + Intergenic
1061330208 9:129887658-129887680 AAGGCACAGAAGGTTGTCATGGG - Exonic
1061767071 9:132888192-132888214 CAGGCACAGCAGAGTCACCTGGG - Intronic
1061805256 9:133134138-133134160 CAGGCCCAGCCGGCTCTGCTAGG + Intronic
1062023364 9:134329488-134329510 CAGGCCCAGCAGCCAGCCCTAGG - Intronic
1062198350 9:135287081-135287103 CAGGCCCAGGAGGCAGTGCTGGG - Intergenic
1062495831 9:136831286-136831308 GAGGCACCCCAGGGTGTCCTCGG + Intronic
1062628351 9:137452977-137452999 CAGGCAGAGCTGGCTGGACTCGG + Intronic
1062674349 9:137731704-137731726 TCGGCCCAGCAGGCTGTACTTGG + Intronic
1187676689 X:21723345-21723367 CACCCACAGGATGCTGTCCTTGG + Intronic
1189160664 X:38805314-38805336 CAGGTCCACCAGGATGTCCTTGG - Exonic
1189186528 X:39060016-39060038 CAGGCAGAGCAGGCTGCTCCTGG - Intergenic
1189240129 X:39518513-39518535 CAGGCACAGTGGGCTGGCTTAGG - Intergenic
1190926282 X:54908348-54908370 CATACACTGCAGCCTGTCCTTGG + Intergenic
1194727579 X:97416374-97416396 CAGCCAAAGTAGGCTGTCTTTGG - Intronic
1196868115 X:120087555-120087577 CAGCCACAGCAGGCTGTGACAGG - Intergenic
1196874830 X:120147702-120147724 CAGCCACAGCAGGCTGTGACAGG + Intergenic
1197449676 X:126595928-126595950 CTGGCACAGCAAGATGTCCCAGG - Intergenic
1200684491 Y:6246542-6246564 CGGGCACAGCAGGCTGTGCCTGG + Exonic
1200990020 Y:9337801-9337823 CGGGCACAGCAGGCTGTGCCTGG + Exonic
1200992682 Y:9358116-9358138 CGGGCACAGCAGGCTGTGCCTGG + Exonic
1200995336 Y:9378395-9378417 CGGGCACAGCAGGCTGTGCCTGG + Intronic
1200998000 Y:9398740-9398762 CGGGCACAGCAGGCTGTGCCTGG + Exonic
1201000509 Y:9467274-9467296 CGGGCACAGCAGGCTGTGCCTGG + Exonic
1201003177 Y:9487604-9487626 CGGGCACAGCAGGCTGTGCCTGG + Exonic
1201008490 Y:9528199-9528221 CGGGCACAGCAGGCTGTGCCTGG + Exonic