ID: 902719006

View in Genome Browser
Species Human (GRCh38)
Location 1:18291857-18291879
Sequence CTGTGGCAGGTGACGGATGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 276}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902719001_902719006 12 Left 902719001 1:18291822-18291844 CCGGTTGAGCACTCACGTGTGGC 0: 1
1: 0
2: 0
3: 2
4: 41
Right 902719006 1:18291857-18291879 CTGTGGCAGGTGACGGATGGTGG 0: 1
1: 0
2: 1
3: 21
4: 276
902718999_902719006 18 Left 902718999 1:18291816-18291838 CCAGGGCCGGTTGAGCACTCACG 0: 1
1: 0
2: 0
3: 6
4: 42
Right 902719006 1:18291857-18291879 CTGTGGCAGGTGACGGATGGTGG 0: 1
1: 0
2: 1
3: 21
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902719006 Original CRISPR CTGTGGCAGGTGACGGATGG TGG Exonic
900334349 1:2154136-2154158 TGGTGGCAGGTGAGGGGTGGAGG + Intronic
900967540 1:5969341-5969363 CTGTGGCACGTGTAGGAAGGCGG - Intronic
901256065 1:7827633-7827655 CTTTGGCTGGTGACTGAAGGGGG - Exonic
902526739 1:17063770-17063792 TTGTGGAAGGTGAGGGATTGAGG + Intergenic
902719006 1:18291857-18291879 CTGTGGCAGGTGACGGATGGTGG + Exonic
903140695 1:21337403-21337425 CTGCTGCAGGGGACTGATGGAGG + Intronic
903254817 1:22088968-22088990 CTGTGGGATGTCATGGATGGGGG + Intronic
904503950 1:30935605-30935627 CAGTGGCAGTTGAAGGCTGGGGG - Intronic
906210795 1:44011306-44011328 ATGTGGTAGGCGACGGGTGGGGG - Intronic
906674807 1:47685510-47685532 CAGAGGCGGGTGATGGATGGGGG + Intergenic
908892682 1:68863865-68863887 CAGTGGCAGGTGTGCGATGGCGG - Intergenic
912410856 1:109479848-109479870 CTGCTGCAGGTGAGGGTTGGGGG + Exonic
912475031 1:109929570-109929592 CTCTGGCAGGTGCTGGAAGGAGG - Exonic
913410178 1:118542514-118542536 CTCTGGCAGGTGGTGGCTGGAGG - Intergenic
914345576 1:146795739-146795761 ATGTGGCAGGTCAGGGATGATGG + Intergenic
915590605 1:156868245-156868267 CTGTGGTAGGTGCCGGGTGAGGG + Exonic
915622977 1:157097530-157097552 CTGGGGCAGGTGAAGGAGGTGGG - Intronic
917711380 1:177688675-177688697 CTGTGGGAAGTGAGGGAGGGTGG + Intergenic
917968618 1:180193780-180193802 CCGAGGGAGGTGACGCATGGTGG + Intronic
918038704 1:180899136-180899158 GTGTGGTGGGTGAAGGATGGAGG - Intergenic
918082616 1:181219010-181219032 CTGTGGCCGGTGGGGGATGGTGG + Intergenic
918533765 1:185551657-185551679 CTTTGGGAGGTGAGGGAGGGTGG + Intergenic
919819086 1:201461688-201461710 CTGAGGCAGGAGACTGAGGGAGG + Intergenic
920362504 1:205429121-205429143 CTGTGGAGGGTAAGGGATGGTGG - Intronic
920431449 1:205921630-205921652 GTGTGGAAGGTGACGAAGGGTGG + Exonic
921262296 1:213395034-213395056 CTGCGGCAGGGGAAGGAGGGTGG - Intergenic
923012867 1:230102832-230102854 TTGTGGCAGGGCAAGGATGGAGG + Intronic
923124437 1:231022939-231022961 CTGTGCCAGGTGAAGGACGCTGG - Intronic
1063798828 10:9546732-9546754 CTGAGGCAGGTCATGAATGGAGG - Intergenic
1063953811 10:11247606-11247628 GTGTGGCAGGGGTGGGATGGCGG - Intronic
1064265382 10:13821277-13821299 CTGTGGCAGGGGACACAGGGAGG + Intronic
1064424070 10:15214440-15214462 CCGTGGCTGGTGACGGACAGCGG + Exonic
1065018703 10:21484707-21484729 CTGTAGCAGGTGACAGAGTGAGG - Intergenic
1065419402 10:25525650-25525672 CTGTGGCAGGGGAAGAATGGGGG + Intronic
1069592034 10:69648081-69648103 GTGTGGCAGGTGGGGCATGGAGG + Intergenic
1069830744 10:71280849-71280871 CTCTGTCAGGTGACTGAAGGGGG - Intronic
1069912189 10:71766361-71766383 TGGTGGCAGGTGGCGGGTGGCGG - Intronic
1070433079 10:76360769-76360791 CTGTAGCAGGTGAGGGAGGGAGG - Intronic
1070793558 10:79203863-79203885 CCGGGGCAGGTGAGGGAGGGTGG - Intronic
1070925789 10:80220716-80220738 CTCTGGCAGATGTGGGATGGAGG - Intergenic
1072446400 10:95502507-95502529 CTCTGGAAGGTGAGTGATGGGGG - Intronic
1075709217 10:124521700-124521722 CTGGGGCAGCTGGCGGGTGGGGG + Intronic
1075856926 10:125637773-125637795 CTGTGCCATGAGATGGATGGGGG - Intronic
1077304951 11:1864829-1864851 CTGTGCCAGGTGCCAGAGGGAGG + Intronic
1077888997 11:6405373-6405395 CCCTGGCAGGTGAGGGGTGGGGG - Intronic
1077919423 11:6631731-6631753 CTGGTGCAGGTGCAGGATGGAGG - Exonic
1078420734 11:11210063-11210085 CTGTGGCTGGTGTAGCATGGTGG - Intergenic
1079451321 11:20601773-20601795 CAGTGCCAGGTGATGGATGCGGG + Intronic
1080695826 11:34602329-34602351 TTGTGCCAGGTGAATGATGGAGG + Intergenic
1083784754 11:64937645-64937667 CTCTGGCATGTGACAGATGATGG + Intronic
1083845028 11:65326653-65326675 CTGTGGCTGGTGCCTGATGCAGG - Intergenic
1083864890 11:65448411-65448433 CTGTGGCTGGTGCCTGATGCAGG - Intergenic
1083891154 11:65596387-65596409 CTGTGGCAGGGGAGAGTTGGGGG + Intronic
1084273617 11:68041245-68041267 CTGTGGGTGGACACGGATGGGGG - Intronic
1084368608 11:68721269-68721291 CTGTGGCAAGAGAGGGAGGGTGG - Intronic
1084606423 11:70175009-70175031 ATGTGGCAGGTGGCGGGCGGGGG - Intronic
1086534633 11:87830155-87830177 TTGTGGAAGGTGCAGGATGGTGG + Intergenic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1090487472 11:127126942-127126964 CTCTGGCAGGTGATGGAAGGAGG + Intergenic
1090830811 11:130419766-130419788 CTGAGGCCGGGGACGGGTGGGGG - Intronic
1093863274 12:24194260-24194282 CTGTGGGGGGTGATGGAAGGTGG + Intergenic
1094261963 12:28510900-28510922 ATGTGGCAGGTGATGGGTGGTGG - Intronic
1096424655 12:51490909-51490931 CTGTTGCAGGTGACAGATGATGG + Intronic
1096973950 12:55687957-55687979 CTGTGGAAGGTGAGGCTTGGAGG - Exonic
1097058362 12:56264294-56264316 CTTTGGGAGGTGAAGGTTGGTGG - Intergenic
1097104094 12:56610504-56610526 CTCTGGCAGGTGGCGGAGAGAGG - Exonic
1098271321 12:68773012-68773034 CTGTGACTGGTGAGGGCTGGTGG - Exonic
1098288472 12:68933087-68933109 CTGTGGCAGCTGCCGGACGGCGG - Intronic
1098881482 12:75921808-75921830 CTGTGGCAGGCCAATGATGGGGG + Intergenic
1102222267 12:111202499-111202521 TTGTGGCAGGGGACTGATGGGGG + Intronic
1102460433 12:113096625-113096647 ATGTGGCAGGGGAGGGAGGGAGG + Intronic
1103344475 12:120240259-120240281 AGGTGACAGGTGACAGATGGGGG + Intronic
1104437779 12:128769463-128769485 GTGTGGCAGATGAAAGATGGTGG - Intergenic
1105494880 13:20921805-20921827 CAGTGCCAAGTGACTGATGGAGG + Intergenic
1106615461 13:31323097-31323119 CTGTTGCAGGGGACGGAGGAGGG + Intronic
1107175653 13:37395285-37395307 CTCTGGCTGGTGATGGGTGGTGG - Intergenic
1108004836 13:45935838-45935860 CTGTGGCAGTTGTGGGTTGGTGG - Intergenic
1112718292 13:102212421-102212443 CTGTGGGAGGTGAAGGGTGGAGG - Intronic
1115349825 14:32381882-32381904 CTGAGGCAGGTGAGGGTTTGAGG - Intronic
1115437234 14:33388484-33388506 CTGTGGCAGGTGAATGGGGGCGG + Intronic
1116866213 14:50033747-50033769 CAGTGGGAGGAGCCGGATGGTGG + Intergenic
1118797521 14:69156554-69156576 CTTTGGGAGGTGAAGGCTGGAGG - Intergenic
1122145424 14:99685757-99685779 CTGTGGCTGGTGACATAGGGAGG + Intronic
1122308250 14:100779021-100779043 CTGTGGTAGGAGAGGGAGGGAGG - Intergenic
1122605860 14:102947381-102947403 CTGTGGCAGGTTAGGCATGAAGG - Intronic
1122917278 14:104865059-104865081 CTGGGGCAGGGGCGGGATGGCGG + Intergenic
1122950601 14:105042413-105042435 CTGTGGCTGGTGACAGGAGGGGG + Intergenic
1123689298 15:22823623-22823645 CGGTGGCGGGTGGCGGGTGGGGG + Intronic
1125891210 15:43268587-43268609 CTGCAGCAGGTGAGGGGTGGTGG - Intergenic
1128214710 15:65926298-65926320 CTGTGGCATGAGAAGGTTGGTGG + Intronic
1128549399 15:68588507-68588529 CTGTGGAAGGCGAGGGAAGGTGG + Intronic
1128865852 15:71115083-71115105 CTGGGGCAGGGGACGGACGCGGG - Intronic
1128990954 15:72260076-72260098 CTTTGGGAGGTGAAGGAAGGCGG + Intronic
1129946804 15:79545641-79545663 CTGGGACAGGTGAAGGAGGGGGG - Intergenic
1130332714 15:82934312-82934334 CTGTGGATGGTGACAGGTGGTGG - Intronic
1130890696 15:88131538-88131560 CTGGGGCAGGGGGAGGATGGAGG + Intronic
1131338024 15:91569045-91569067 CAGTGGCAGGTGTCGAAGGGAGG + Intergenic
1132983093 16:2749262-2749284 CTGTGGGAGGGGTTGGATGGGGG + Intergenic
1132986098 16:2768410-2768432 CTGGGGCAGGGGGCGGAGGGAGG + Intronic
1133128907 16:3664316-3664338 CTCTGCCAGGTGACGGTTGGGGG + Exonic
1133817478 16:9209221-9209243 CTGTGGAAGGAGACGCCTGGAGG + Intergenic
1134013789 16:10874442-10874464 CTGTGGCAGGTGAGGGTGTGGGG - Intergenic
1134466649 16:14484692-14484714 ATGTGTCAGGTGCCGGATGTGGG - Intronic
1134661042 16:15984857-15984879 CTTTGGCAGGTGAAGGTGGGAGG + Intronic
1136064754 16:27751151-27751173 CTTTGGCAAGTGACTTATGGAGG + Intronic
1137763075 16:50956315-50956337 CTGAGGCAGGTGACGAATGATGG - Intergenic
1138857563 16:60712921-60712943 CTTTGGGAGGTGAGGGAGGGAGG + Intergenic
1139988411 16:70919524-70919546 ATGTGGCAGGTCAGGGATGACGG - Intronic
1140313729 16:73873054-73873076 CGGTGGGTGGTGGCGGATGGTGG + Intergenic
1141137302 16:81474638-81474660 CTGTGGAAGGGGAATGATGGGGG + Intronic
1141403570 16:83772046-83772068 CTGTGGGTGGAGAAGGATGGGGG + Intronic
1141543233 16:84743304-84743326 CTGTGGGGGGTGAAGGGTGGTGG - Intronic
1142243800 16:88959262-88959284 CTGTGGCCGCGGACGGGTGGTGG + Intronic
1142287047 16:89175738-89175760 CTCTGCCAGCTGACAGATGGCGG - Intronic
1143276059 17:5711723-5711745 CTGTCGAAGTTGATGGATGGAGG + Intergenic
1144702364 17:17347956-17347978 CTGGGGCAGGTGCGGGAAGGAGG - Intergenic
1146953374 17:36921649-36921671 CTGTGGAAGGTGAGGCTTGGCGG - Intergenic
1151231336 17:72687340-72687362 CTGAGGCAGGAGCCGGAAGGCGG - Intronic
1151554656 17:74840634-74840656 CTGTGGCAGGTGAGGCATCCTGG - Intergenic
1151893149 17:76963050-76963072 CTGAGGCAGGTGCAAGATGGAGG + Intergenic
1152036103 17:77874179-77874201 ATGTGGCTGGGGAGGGATGGGGG - Intergenic
1158717944 18:59897491-59897513 CTGTGGGAGGTGGAGGCTGGGGG - Intergenic
1160405971 18:78646708-78646730 CTGCGGCTGGTGGCTGATGGGGG - Intergenic
1160659793 19:292536-292558 CTGGGGCAGGGGGCTGATGGTGG - Intergenic
1160764568 19:801691-801713 CTGTGGGAGGCGAAGGTTGGAGG + Intronic
1161400012 19:4063077-4063099 GTCTGGCAGGTGACAGGTGGGGG + Intronic
1161743474 19:6040110-6040132 CTGTGGGAGGGGACCGCTGGCGG + Exonic
1161865764 19:6831119-6831141 CTGTGGTAGGTGAGGGTGGGAGG + Intronic
1161931844 19:7345811-7345833 CTGTGGCAGGTGTGGGATCACGG - Intergenic
1162128709 19:8512644-8512666 CTGTGCCAGGTCACGGACGCTGG + Exonic
1162807973 19:13148776-13148798 CTGTTGCAGGAGAGGGCTGGGGG - Intronic
1162821921 19:13228322-13228344 CTTTGGGAGGTGAGGGGTGGAGG + Intronic
1163314986 19:16535575-16535597 CTGTGGCAGGGGTGGCATGGTGG + Exonic
1163535545 19:17874325-17874347 GTGTGGGAGGGGACTGATGGGGG - Intronic
1166584620 19:43934954-43934976 CTGTGGGAGGTGGGGGAAGGCGG + Exonic
1167041478 19:47025248-47025270 CTGTGGCAGTTGAGGGAAGGAGG + Intronic
1167529060 19:50003498-50003520 ATGTGACTGATGACGGATGGTGG + Intronic
1168116466 19:54223616-54223638 CTGTGGCGGGTGATGGCTTGAGG + Intronic
1168119446 19:54243394-54243416 CTGTGGCGGGTGATGGCTTGAGG + Intronic
925065363 2:925641-925663 CCATGGCAGGTGACGCCTGGGGG + Intergenic
925289946 2:2740716-2740738 CTGAGGGAGGAGACTGATGGAGG + Intergenic
925715235 2:6779050-6779072 CTGGGGCAGGTGGTTGATGGTGG - Intergenic
926116550 2:10217365-10217387 CCGTGGTAGGTGAGGGCTGGAGG - Intergenic
926702074 2:15810433-15810455 TCGTGGCAGGTGACGGGTTGGGG + Intergenic
927873783 2:26640835-26640857 CTGGTGCAGGAGACAGATGGAGG + Intronic
930034549 2:47077240-47077262 TTCTGGCAGGGGACGGGTGGTGG - Intronic
931914027 2:66933462-66933484 CTGTGGCAGCTGATGGAAGAGGG - Intergenic
932336166 2:70932649-70932671 TTGGGGCAGGTGGTGGATGGGGG - Intronic
934916668 2:98305787-98305809 CTGTGGCAGGAGGAGGCTGGAGG - Intronic
935267931 2:101410441-101410463 CTGTAGCAGGTGGAGAATGGGGG - Intronic
938312303 2:130301363-130301385 CTGTGGCAGGAGACTGGTTGGGG + Intergenic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
942692188 2:178597699-178597721 ATGTTCCAGGTGACGGTTGGAGG + Exonic
945129683 2:206557171-206557193 CTTTGGCAGGTGGAGGCTGGAGG - Intronic
946134923 2:217637613-217637635 TTGTTGCAGGTGAAGAATGGCGG + Intronic
948024947 2:234769365-234769387 GTGGGGCAGGTGATGGAGGGAGG - Intergenic
948060181 2:235037293-235037315 TGGTGGCAGTTGACTGATGGAGG + Intronic
948420157 2:237853964-237853986 CTGTCACAGATGAAGGATGGAGG - Intergenic
948449564 2:238060852-238060874 CTGGGTCAGGTGACGGGTGGGGG - Intronic
948718989 2:239884245-239884267 CTGTGGGAGGAGACAGCTGGAGG - Intergenic
1168852396 20:985693-985715 GTGGGGCAGGTCAGGGATGGGGG - Intronic
1169073158 20:2746002-2746024 CTTTGGCAGGTGCTAGATGGAGG - Intronic
1169438486 20:5614088-5614110 CTTTGGGAGGTGAAGGAGGGCGG + Intergenic
1170546063 20:17436756-17436778 CTGTGGCATATGACTGATGGAGG - Exonic
1170686478 20:18574343-18574365 CTGTTGAATGTGAAGGATGGTGG - Intronic
1170846920 20:19969996-19970018 CTGTGGCAGGTCCCTGATGCTGG + Intronic
1171811108 20:29744465-29744487 CTTTGGGAGGTGAGGGAAGGTGG + Intergenic
1172006018 20:31819641-31819663 CTGGGGCAGGAGATGGAGGGAGG + Intronic
1173235312 20:41239756-41239778 CAGTGCCAGGTGAAGGGTGGAGG - Intronic
1174500704 20:50982011-50982033 CTGTGGCAGGTGTCAGAGGTGGG + Intergenic
1175803895 20:61816738-61816760 GTGTGGCAGGTGATGAATTGAGG - Intronic
1175919671 20:62444791-62444813 CTGGGGCAGGAGAAGGAGGGTGG + Intergenic
1175979387 20:62729426-62729448 GTGGTGCAGGTGATGGATGGAGG + Intronic
1176721072 21:10393268-10393290 CTCTGGCATGGGATGGATGGTGG - Intergenic
1176977074 21:15334613-15334635 CTCTGGCAGGGGGCGGCTGGAGG + Intergenic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1179878883 21:44285377-44285399 CTGTGGGAGGAGCCCGATGGAGG - Intergenic
1179888668 21:44325311-44325333 CTGGGGCCGGGGACAGATGGTGG - Intronic
1179931277 21:44572537-44572559 CTGGGGCAGGTGGAGCATGGGGG - Intronic
1179933144 21:44585193-44585215 CTGTGGCAGGTGTCAGCAGGAGG - Intronic
1180302261 22:11046058-11046080 CTCTGGCATGGGATGGATGGTGG - Intergenic
1182161053 22:28122109-28122131 CTTTGGGAGGTCAAGGATGGCGG - Intronic
1183122514 22:35741042-35741064 CTGTGGCTGTTGAAGGATGATGG + Intronic
1183306599 22:37086242-37086264 CTGGGGCAGGGGAGGGGTGGTGG - Intronic
1183409554 22:37646921-37646943 CTGTGGCAGGTGCCTGATCCGGG + Exonic
1183472345 22:38016408-38016430 CTCTGGGAGGTGGCGGATGGGGG - Intronic
1183620540 22:38969554-38969576 CTATGGGAGGTCAAGGATGGAGG - Intronic
1184412915 22:44336297-44336319 CAGTGGCAGGTGAAGGGCGGAGG - Intergenic
1184519791 22:44986671-44986693 CTGTTGCAGTGGACAGATGGGGG - Intronic
1185054788 22:48573979-48574001 CTGTGCCAGGTGAGGGATGAAGG + Intronic
1185086155 22:48742159-48742181 CTGTGCCTGGTGAAGGATGAGGG - Intronic
1185086170 22:48742202-48742224 CTGTGCCTGGTGAAGGATGAGGG - Intronic
1185086185 22:48742245-48742267 CTGTGCCTGGTGAAGGATGAGGG - Intronic
1185337539 22:50277450-50277472 ATGTAGGAGGTGACGGGTGGCGG - Intronic
949490414 3:4583786-4583808 CTGGGGCAGTTGCAGGATGGGGG + Intronic
950941667 3:16898908-16898930 CTGTGGCAGGGGTTGGAGGGTGG + Intronic
952841976 3:37654259-37654281 CTGTGGCAGGAGAGGGCTGAAGG + Intronic
953614485 3:44477782-44477804 CTGAGGGAGGTGAGGGATGTTGG - Intergenic
954210500 3:49094333-49094355 CTCTGGCGGGCGACGGAAGGTGG - Exonic
954623287 3:52007788-52007810 CTGTGGCAGGTGTCCGTGGGTGG - Intergenic
956779953 3:72595967-72595989 CTGTGGGAGTCGAGGGATGGAGG - Intergenic
961478648 3:127164903-127164925 CTGTGTCACGTGACTGATGAGGG - Intergenic
962417980 3:135201179-135201201 CTGTTGTAGGTGATGGATGATGG + Intronic
968772202 4:2514587-2514609 CTGTGCCAGGTGAAGGACGCTGG - Exonic
968950491 4:3688867-3688889 CTGTGGGATGTGAGGGCTGGTGG - Intergenic
969111069 4:4844605-4844627 TTGTGGCAGGGGAGGGTTGGGGG - Intergenic
971188270 4:24402169-24402191 CTGTGGCAGGTTACGGAGTGGGG - Intergenic
977961733 4:103093156-103093178 CTCTGGCAGGGGAAGGATAGGGG - Intronic
978777792 4:112520435-112520457 CTGTTGCAGGTGACTGTCGGGGG + Intergenic
982738197 4:159028849-159028871 CTTTGGGAGGTGAAGGCTGGTGG + Intronic
985924437 5:3004833-3004855 CTGTGGAGGGTAAGGGATGGAGG - Intergenic
991642647 5:68770178-68770200 ATGTGGCAGGGGAAGGAGGGAGG - Intergenic
996416326 5:123214566-123214588 CTGTGGGAGGTGAAGGAGAGGGG - Intergenic
997109941 5:131064122-131064144 CTGTGGCAGATGACAGAGGAAGG - Intergenic
998093673 5:139384930-139384952 CTGGAACAGGTGAAGGATGGAGG + Intergenic
998579995 5:143362769-143362791 CTGGGGCACATGACGGGTGGAGG + Intronic
999052153 5:148534461-148534483 CTCTGGCAGGGGATGGCTGGAGG - Intronic
999918415 5:156289454-156289476 CTGTGGGGGGTGAGGGGTGGAGG - Intronic
1001159425 5:169300603-169300625 GTGGGGCAGGCGACGGCTGGAGG + Exonic
1001380644 5:171304371-171304393 CTGTGGCAGGTGAATGAATGAGG - Intergenic
1002523006 5:179801615-179801637 GTGTGGCAGGTGATGGAAGACGG + Exonic
1003353151 6:5339676-5339698 CTGTGGCAGGTCAAGGTGGGTGG - Intronic
1003911016 6:10743778-10743800 TTGGGGCAGGTGGGGGATGGTGG + Intergenic
1003972267 6:11310975-11310997 CAGTGGCAGGTGACAGGTGGAGG - Intronic
1004259282 6:14094395-14094417 CTCTGGCAGGAGGCAGATGGAGG + Intergenic
1004639552 6:17501916-17501938 CTGTGGCTTGTGACAGAAGGTGG - Intronic
1005493763 6:26370641-26370663 CTGTGGCAGTTGAATGAAGGGGG + Intronic
1005498317 6:26407990-26408012 CTGTGGCAGTTGAATGAAGGGGG + Intronic
1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG + Exonic
1005777110 6:29146238-29146260 CTGGGGCAGGGGAAGGAAGGGGG - Intergenic
1006121680 6:31810744-31810766 CTGGGGCTGGAGACGGCTGGGGG - Exonic
1006181294 6:32154821-32154843 CTGTGGCAGGGGAGGGAGAGCGG + Intronic
1006648861 6:35534778-35534800 CAGTGGCAGGGGAGGGAGGGAGG - Intergenic
1007730616 6:43943293-43943315 GTGTGGAAGGTGAGGGCTGGTGG - Intergenic
1008609078 6:53169274-53169296 CTGTGGGAGGGTACGGCTGGTGG + Intergenic
1013087264 6:106867058-106867080 CTGTGGCAGGTGCGGGATCCAGG + Intergenic
1013352902 6:109321715-109321737 CTGTGGCAGGACATTGATGGTGG + Intergenic
1014035575 6:116764629-116764651 CTGGGGCAGGAGACGCCTGGCGG - Intronic
1015797983 6:137032237-137032259 CAGTGGCAGGAGACAGCTGGTGG + Intronic
1015924455 6:138295224-138295246 CTGTGGCTGGTGAGTGTTGGAGG - Intronic
1017841170 6:158224188-158224210 CTGAGGCAGGGGAGGGCTGGAGG - Intergenic
1018908398 6:168088254-168088276 CAGGGGCAGGTGACGGCGGGAGG - Intergenic
1018950242 6:168374297-168374319 CAGTGGCAGAAGAGGGATGGCGG - Intergenic
1019677220 7:2321209-2321231 CTGTGGCAGGAAACGGTGGGGGG + Intronic
1020878627 7:13730071-13730093 CTTTGGGAGGCGAAGGATGGGGG + Intergenic
1023329952 7:39104356-39104378 CTGTGGCAGGTTTTGGGTGGAGG + Intronic
1024726537 7:52203273-52203295 CAGGGGCAGGTGCCTGATGGTGG - Intergenic
1025620787 7:63168717-63168739 CTTTGGGAGGTGAAGGTTGGGGG - Intergenic
1026352686 7:69531316-69531338 CTGTGGCAAAGGAGGGATGGGGG + Intergenic
1029210905 7:98907791-98907813 CTGAAGCAGGTCAGGGATGGGGG - Intronic
1029610092 7:101622201-101622223 CTGTGGGAGGTGAGAGGTGGGGG + Intronic
1029890979 7:103930420-103930442 TTGTGGCGGGGGACGGGTGGGGG + Intronic
1030093774 7:105879363-105879385 GTGTGGCAGGTAACTGAGGGAGG + Intronic
1030680612 7:112430198-112430220 CTGAGGCAGGTGAAGGATTTGGG + Intronic
1030896357 7:115065649-115065671 CTTTGGGAGGTGAAGGCTGGGGG - Intergenic
1031623017 7:123958538-123958560 GTCTGGCAGGTGAGGCATGGTGG + Intronic
1031888132 7:127262019-127262041 CTGAGGCAGGTGCAGGCTGGTGG + Intergenic
1032427525 7:131833581-131833603 CTGTGGCAGGTGAGTGATCTGGG + Intergenic
1032519740 7:132534864-132534886 CTGTGGCAGGTTAAGGAATGGGG - Intronic
1032606283 7:133357862-133357884 CTGTGGCAGGAGAAGGATAAAGG - Intronic
1032697085 7:134346497-134346519 CTGTGGCAGGTGATGAATTAGGG - Intergenic
1034978465 7:155461181-155461203 CTGTGGCTGGAGAAGGCTGGGGG - Intronic
1035254711 7:157618955-157618977 CTGAGCCAGGTGACGGGTGAGGG - Intronic
1036590293 8:10162525-10162547 GTGGGGCAGGTGACGGGAGGAGG + Intronic
1037884769 8:22590134-22590156 CTGTGGAAGGTGGAGGCTGGCGG + Intronic
1038163101 8:25059246-25059268 CTGTGGCAGGTGATGGGTGGTGG - Intergenic
1039297300 8:36170056-36170078 CTATGGCAGGTGGCAGGTGGGGG + Intergenic
1041618050 8:59931430-59931452 CTGAGGCAGGTGACAAATGCAGG + Intergenic
1042935093 8:74050451-74050473 CTGTACCTGGTGACGGATGGTGG - Intergenic
1045002564 8:97891084-97891106 CTGTGCCAGATGCCGGTTGGGGG + Intronic
1047749423 8:127868646-127868668 CTGTGGGAGGTGTAGGAGGGTGG - Intergenic
1048136531 8:131751880-131751902 ATGTGCCAGGTGAGGGGTGGAGG - Intergenic
1052311624 9:27074804-27074826 CTGTGGCAGGGGATGGCTGGAGG + Intergenic
1053129749 9:35608284-35608306 CCATGGCAGCTTACGGATGGGGG - Intronic
1056567131 9:87783527-87783549 CAGAGCCAGGTGACAGATGGTGG - Intergenic
1057050495 9:91919967-91919989 GTGGGGCAGGTGTGGGATGGCGG - Intronic
1059305323 9:113349529-113349551 CTGTCGCAGGTGGCGGCGGGCGG - Exonic
1059466054 9:114469541-114469563 CTGTGGCTAGTGGCTGATGGCGG + Intronic
1060978205 9:127777554-127777576 CTGGGGCAGCAGAGGGATGGGGG - Intronic
1061349058 9:130049468-130049490 CTTTGGGAGGTGAAGGTTGGAGG + Intergenic
1061413035 9:130431327-130431349 GTGGGGCAGGTGGGGGATGGGGG - Intronic
1061801544 9:133115727-133115749 CTGGGGCCGGCGACGGATGCTGG + Intronic
1203361741 Un_KI270442v1:222382-222404 CTTTGGGAGGTGAGGGAAGGTGG + Intergenic
1185539899 X:894801-894823 CTCTGGCATGGGATGGATGGTGG + Intergenic
1187428122 X:19197005-19197027 CTGTGGCAGAGTAGGGATGGGGG - Intergenic
1189639470 X:43052067-43052089 CTGTGGGAGATGAAGGATTGAGG - Intergenic
1189748680 X:44196158-44196180 CTGTGGCAGGCCAAGGCTGGTGG - Intronic
1190922543 X:54869439-54869461 CTTTGGGAGGTGAAGGAGGGAGG - Intergenic
1190984771 X:55490180-55490202 CTCTGGGAGTTGACGGAGGGAGG + Intergenic
1191862103 X:65674122-65674144 CTTTGGCTTGTGACGGGTGGTGG + Intronic
1192183973 X:68933955-68933977 CTTTGGGAGGTGAAGGAAGGAGG + Intergenic
1192926404 X:75759231-75759253 CTCTGGCAGATGATGGCTGGAGG - Intergenic
1195829777 X:109043968-109043990 CTGTGGCAAGTGAGAGTTGGAGG - Intergenic
1196629819 X:117925918-117925940 CTGAGACAGGTGGCGGTTGGGGG - Intronic
1197106243 X:122720129-122720151 TTGTGGCAGGAGAGGGATGAGGG - Intergenic
1197221992 X:123923044-123923066 CTGTGCAAGGTGAATGATGGAGG + Intergenic
1199975141 X:152890347-152890369 GTTTGGAAGGTGAAGGATGGTGG + Intergenic
1200150670 X:153949928-153949950 GTGCAGCAGGTGAGGGATGGAGG - Intronic
1201580893 Y:15511251-15511273 GTGTGGCAGGGGATGCATGGGGG + Intergenic