ID: 902719305

View in Genome Browser
Species Human (GRCh38)
Location 1:18293422-18293444
Sequence TGCTCCCCAGGCGGCCCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 246}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902719300_902719305 7 Left 902719300 1:18293392-18293414 CCTGCTTTTGTAAAAATGGGAAG 0: 1
1: 0
2: 4
3: 16
4: 229
Right 902719305 1:18293422-18293444 TGCTCCCCAGGCGGCCCGGCTGG 0: 1
1: 0
2: 0
3: 16
4: 246
902719295_902719305 24 Left 902719295 1:18293375-18293397 CCAGGCATCCTCCTCTGCCTGCT 0: 1
1: 0
2: 6
3: 59
4: 748
Right 902719305 1:18293422-18293444 TGCTCCCCAGGCGGCCCGGCTGG 0: 1
1: 0
2: 0
3: 16
4: 246
902719294_902719305 25 Left 902719294 1:18293374-18293396 CCCAGGCATCCTCCTCTGCCTGC 0: 1
1: 0
2: 5
3: 49
4: 486
Right 902719305 1:18293422-18293444 TGCTCCCCAGGCGGCCCGGCTGG 0: 1
1: 0
2: 0
3: 16
4: 246
902719297_902719305 13 Left 902719297 1:18293386-18293408 CCTCTGCCTGCTTTTGTAAAAAT 0: 1
1: 3
2: 28
3: 178
4: 754
Right 902719305 1:18293422-18293444 TGCTCCCCAGGCGGCCCGGCTGG 0: 1
1: 0
2: 0
3: 16
4: 246
902719296_902719305 16 Left 902719296 1:18293383-18293405 CCTCCTCTGCCTGCTTTTGTAAA 0: 1
1: 0
2: 4
3: 36
4: 370
Right 902719305 1:18293422-18293444 TGCTCCCCAGGCGGCCCGGCTGG 0: 1
1: 0
2: 0
3: 16
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902719305 Original CRISPR TGCTCCCCAGGCGGCCCGGC TGG Intronic
900115142 1:1025095-1025117 TGGGCCCCGGGCGGCCTGGCCGG - Intronic
900188198 1:1342646-1342668 TGCTCCCCAGGCGAGCCTTCGGG + Intronic
900188544 1:1343867-1343889 TGCTCTCCTGGGGGCCCTGCCGG - Intronic
900191505 1:1354159-1354181 TGGTCCCCAGGAGGGCCGGGAGG + Intronic
900402170 1:2477044-2477066 TGCAGCCCAGGCGGCTGGGCTGG + Intronic
900506512 1:3032131-3032153 TCCTCCCCAGGGTGCCCGGGTGG - Intergenic
901129715 1:6954735-6954757 AGCTGCCCAGGCGGCGGGGCAGG - Intronic
901188374 1:7389300-7389322 TGCTCCCCCTGCAGCCCTGCTGG + Intronic
901421790 1:9156237-9156259 TGCTGCCCAGCCAGCCCTGCTGG + Intergenic
902312540 1:15592614-15592636 GCCTCCCCAGGCTGCCTGGCTGG + Intergenic
902719305 1:18293422-18293444 TGCTCCCCAGGCGGCCCGGCTGG + Intronic
902871596 1:19316954-19316976 TGTTGCCCAGGCTGCCAGGCTGG + Intronic
902910981 1:19597121-19597143 TTCGCCCCAGCAGGCCCGGCCGG + Intronic
903788249 1:25875418-25875440 TGCTCTCCACGGGGCGCGGCGGG - Intergenic
903839033 1:26225324-26225346 GGCTACCCAGCCTGCCCGGCAGG - Intergenic
904034662 1:27552126-27552148 TCCTCCGCAGGCCGCCGGGCGGG + Exonic
904253000 1:29237862-29237884 TGCGCCCCGGGCGGCCGGGCGGG + Intronic
905657193 1:39692377-39692399 TGCAGCCCAGGCGGCCGGCCCGG - Intronic
905769525 1:40628585-40628607 TGCTCCCCAGGTTGCACAGCTGG - Intronic
907440367 1:54474928-54474950 TGCTCCCCCTGCGCCCGGGCGGG - Intergenic
908131870 1:61082465-61082487 CGCTCCCGCGCCGGCCCGGCCGG - Intronic
909698221 1:78491197-78491219 TGCTCCTCAGAGAGCCCGGCTGG + Exonic
913058928 1:115187140-115187162 TGGTCCCCAGGCTGCCCTCCAGG - Intergenic
918480725 1:184974270-184974292 TGCTCCCCAGGCCCCCGGGCGGG + Intronic
918657041 1:187040532-187040554 TGTTGCCCAGGCTGCCAGGCTGG + Intergenic
920193918 1:204213640-204213662 TGGTGCCCAGGGGGCCTGGCAGG - Intronic
920836649 1:209517273-209517295 TGCTCCCAAGGATGCCCAGCGGG + Intergenic
1063204051 10:3813678-3813700 AGCACCCCAGGTGTCCCGGCAGG - Intergenic
1065322274 10:24520814-24520836 TGCCACCCAGGCTGCCAGGCTGG - Intronic
1065636726 10:27742521-27742543 GGCTCCCCGGGCGCCCCGCCGGG - Intronic
1067661783 10:48241470-48241492 AGCTCCCCAGGGGGCCAGGCTGG + Intronic
1068235484 10:54227493-54227515 TTCTCCCCAGGCCTCCAGGCTGG + Intronic
1068910679 10:62375012-62375034 TGGTCCCCAGGCAGCGAGGCAGG - Intronic
1069570806 10:69493223-69493245 TTCTGCCCAGGCTGCTCGGCTGG + Intronic
1069589974 10:69635551-69635573 CTCTCCCCAGGCAGCCAGGCTGG - Intergenic
1069942305 10:71964227-71964249 TCCTCCCCCAGAGGCCCGGCCGG + Intergenic
1070767960 10:79067333-79067355 GGCTCCCCCCGCAGCCCGGCCGG + Intergenic
1073325687 10:102643136-102643158 TGCTGCCCAGGCGACGCGTCCGG - Intergenic
1073381132 10:103078875-103078897 TGCTCACCAGGCAGCCAGCCCGG - Exonic
1075092157 10:119449896-119449918 TGCTCCCCAGGCGGTTCGCCAGG - Intronic
1075732198 10:124643324-124643346 TGAAGCCCAGGCGGCTCGGCAGG + Intronic
1076096437 10:127737499-127737521 GGCGCCCCGGGCGGCCTGGCGGG + Exonic
1076379321 10:130014432-130014454 TGCACCCCAGTCATCCCGGCGGG + Intergenic
1076554165 10:131311396-131311418 TGCTCCCCGGTCTCCCCGGCTGG - Exonic
1077266858 11:1655235-1655257 TGTGCTCCAGGTGGCCCGGCAGG - Intergenic
1077601857 11:3580213-3580235 TGAACCCCAGGAGGCCAGGCTGG + Intergenic
1080422834 11:32126898-32126920 GGCTCCCCACACGGCCCTGCTGG + Intergenic
1080848858 11:36050393-36050415 TGGTCCCCAGGCAGCAGGGCAGG + Intronic
1082009892 11:47442673-47442695 CACTGCCCAGGCGGCCCAGCAGG + Exonic
1083678683 11:64341589-64341611 TGCGCCCCAGGTGACCCAGCCGG + Exonic
1084358272 11:68653422-68653444 TGCTTCCCAGGGGGGCAGGCAGG + Intergenic
1084814996 11:71640478-71640500 TGAACCCCAGGAGGCCAGGCTGG - Intergenic
1084859811 11:72011009-72011031 TGCTGCCCAGGCTGCTTGGCAGG + Intronic
1085523235 11:77150211-77150233 TGGTCTGCAGGGGGCCCGGCGGG - Intronic
1086757923 11:90588064-90588086 TGTTGCCCAGGCTGCCAGGCTGG - Intergenic
1087141541 11:94769360-94769382 TGCCCCATAGGCGGCCGGGCTGG + Intronic
1090832403 11:130428443-130428465 CGCTCCCCCGGCGGCCCCTCTGG + Exonic
1092245090 12:6859600-6859622 TGCCCCCCAGGCGGTCAGGGAGG - Intronic
1092427999 12:8389556-8389578 TGAACCCCAGGAGGCCAGGCTGG + Intergenic
1094672809 12:32587418-32587440 TGTTGCCCAGGCTGCCAGGCTGG + Intronic
1094683460 12:32686974-32686996 TGTTGCCCAGGTGGCCAGGCTGG + Intronic
1095409150 12:41903153-41903175 TGTTGCCCAGGCTGCCAGGCTGG - Intergenic
1095740692 12:45603549-45603571 TGTTGCCCAGGCTGCCAGGCTGG + Intergenic
1096157351 12:49347917-49347939 TGATCCCCAGGGGGCCGGGGAGG + Exonic
1096260122 12:50085264-50085286 TGTTCCCCCGGCCGGCCGGCCGG - Exonic
1099653509 12:85459357-85459379 TGTTGCCCAGGCTGCCAGGCTGG + Intergenic
1100438254 12:94591722-94591744 TGTTGCCCAGGCTGCCAGGCTGG - Intronic
1102029619 12:109732447-109732469 TGCTGGGCAGGCGGCCGGGCAGG - Intronic
1102788152 12:115620812-115620834 TGATCCCAAGGAGGCCAGGCTGG + Intergenic
1103009934 12:117450254-117450276 TGCTACCCAGGCAGCTGGGCAGG + Intronic
1105626933 13:22121738-22121760 TGCTGGCCAGGCAGGCCGGCTGG + Intergenic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1106036860 13:26051565-26051587 GGCTGCCCGGGCGGCCCGGCCGG - Intergenic
1107951397 13:45465255-45465277 TTCTCCTCGGGCGCCCCGGCAGG + Intronic
1111951221 13:94711195-94711217 TCCTCGCGAGGCGGCCCCGCGGG + Exonic
1112033180 13:95475349-95475371 AGGTCCCCAGGAGGCCGGGCTGG - Intronic
1112046173 13:95600426-95600448 TGCTCACCAGGAGGCTGGGCAGG + Intronic
1113530112 13:111018295-111018317 CGCTCCCCATGCGCCCCAGCAGG + Intergenic
1113955088 13:114096077-114096099 TGCTCTCCAGGTGGCCCTGGCGG + Intronic
1113955115 13:114096167-114096189 TGCTCTCCAGGTGGCCCTGGCGG + Intronic
1114193865 14:20460797-20460819 TCCTCCCCAGGCAACACGGCTGG + Exonic
1117315434 14:54567208-54567230 TGCTCCCCTCACGGCCCGCCTGG - Intronic
1118321524 14:64756231-64756253 TGCTTCCCAGGCGGACCTGCTGG + Intronic
1122374509 14:101249037-101249059 TGCTCCCCATGCAGCCCGTGGGG - Intergenic
1122893741 14:104745090-104745112 CGTTCCCCAGGAGGCCTGGCTGG + Intronic
1202858107 14_GL000225v1_random:63979-64001 TGGTCCCCAGGTCGCCCGGGCGG - Intergenic
1124340205 15:28885694-28885716 AGCTCCCCAGCCAGCACGGCCGG + Intronic
1126113324 15:45187847-45187869 CGCACCCCCGGCGCCCCGGCGGG + Intronic
1126552938 15:49953182-49953204 TGCTCCCCATGCCACCCAGCTGG - Intronic
1127912748 15:63431649-63431671 TTCTCCCCAGGCCTCCCTGCAGG + Intergenic
1128151061 15:65363666-65363688 TTCTCCCCAGGGGTCCTGGCAGG - Intronic
1128532534 15:68464504-68464526 TGCTCCCAAGGAGGCCCTGCCGG - Intergenic
1129156740 15:73722819-73722841 TGCTCCCCAGCAGCCCTGGCTGG + Intergenic
1130282966 15:82533331-82533353 TGCTGCCCTGGCTGCCCTGCCGG + Intergenic
1131175166 15:90204682-90204704 TTCTCCCCACGTGGCCAGGCTGG - Intronic
1132311620 15:100861861-100861883 TCCTCCCCAGTTGGCTCGGCTGG - Intergenic
1132572927 16:651828-651850 GGGTGCCAAGGCGGCCCGGCCGG - Exonic
1132621472 16:870106-870128 TGCACCCCACTCGGCCCAGCCGG - Intronic
1133300215 16:4777893-4777915 TGCTGCCCCGCGGGCCCGGCTGG - Exonic
1133370241 16:5240811-5240833 TGAACCCCAGGAGGCCAGGCTGG - Intergenic
1138556510 16:57774026-57774048 TGTCCCCCAGGAGGCCTGGCTGG - Intronic
1138556940 16:57776263-57776285 TGCTCCCAGGGCCGCCCCGCTGG - Intronic
1139472648 16:67186496-67186518 TGCTCCCCAGGCAGCCCAAAGGG - Intronic
1139949088 16:70660570-70660592 AGCTCCCCAGTCTGCCAGGCTGG - Exonic
1141953682 16:87355743-87355765 TCCTCCCCACGCTGCCGGGCTGG - Intronic
1142049855 16:87951289-87951311 TGCTCACCAGGAGGCCGAGCGGG + Intronic
1142049934 16:87951610-87951632 TGCGGCGCGGGCGGCCCGGCGGG - Intronic
1142176213 16:88646664-88646686 TCCTGTCCAGGCAGCCCGGCCGG + Intronic
1142344504 16:89545402-89545424 TGCTCCCCAGGCTGCACTGATGG - Intronic
1142741484 17:1934313-1934335 TGATCCTCAGGGCGCCCGGCAGG - Intergenic
1142812172 17:2400526-2400548 GGCTCCGCAGGCCGCCCGGGAGG + Intronic
1145214521 17:21042259-21042281 GGCTCCCCAGGCAGCAGGGCAGG + Intronic
1145878217 17:28335696-28335718 GGCTCCCCAGCCGGCTGGGCTGG + Exonic
1147914207 17:43877060-43877082 TGCTCCCCACAGGGCCAGGCTGG - Intronic
1148080993 17:44967753-44967775 TTCTCCCCCGGCGGCCCCACAGG + Exonic
1148263036 17:46200940-46200962 TGCTGCCCAGGCTGCCAGGCTGG + Intronic
1149719214 17:58826265-58826287 TGTTGCCCAGGCTGCCAGGCTGG - Intronic
1151956433 17:77382543-77382565 TCCTCCCCAGGAGGCCTGGAGGG + Intronic
1152429109 17:80237551-80237573 TGCTCTCCAGGAGGCCCATCAGG - Exonic
1156275791 18:35581711-35581733 GGCTCCCCCGGCGGGCGGGCGGG - Intronic
1157655546 18:49384208-49384230 AGCTACCCAGGAGGCCAGGCAGG + Intronic
1158436760 18:57439733-57439755 CGCTCCGCAGGCGGCTCGGCCGG + Intronic
1159616677 18:70588062-70588084 TGTCCCCCAGGCTGCCAGGCTGG - Intergenic
1160003973 18:75054551-75054573 TGCCCTCCAGGAGGACCGGCTGG + Intronic
1161014965 19:1978924-1978946 TGGTCCCCGGGCGGCCCACCAGG - Exonic
1161249001 19:3270598-3270620 TGCGCCCGGGGCGGCCGGGCGGG + Intronic
1161681541 19:5682136-5682158 TGCACCCCATGAGGCCCTGCAGG - Intronic
1162305430 19:9870427-9870449 TAGTCCCCACGCGGCCCAGCTGG + Intronic
1163427253 19:17246183-17246205 GGCTCCCGCCGCGGCCCGGCAGG - Intronic
1163537291 19:17884031-17884053 TGCTCACCTGGGGGCCCTGCTGG - Exonic
1164937323 19:32224491-32224513 AGCTGCCAGGGCGGCCCGGCGGG - Intergenic
1165260008 19:34605615-34605637 TGTTGCCCAGGCTGCCAGGCTGG + Intronic
1166340668 19:42134911-42134933 AGGTCCCCCGGGGGCCCGGCGGG + Intronic
1166568357 19:43778805-43778827 TGCTCCCCAGGGGGAGGGGCTGG - Intronic
1166690868 19:44820697-44820719 GGCTCCCCTGGCGGCCTGGGGGG - Exonic
1167172951 19:47845611-47845633 TGTTGCCCAGGCTGCCAGGCTGG - Intergenic
1168209443 19:54879711-54879733 TGTTGCCCAGGCTGCCAGGCTGG + Intronic
925725193 2:6865323-6865345 TACTGCCCGGGCGGCCAGGCCGG - Exonic
925922229 2:8645588-8645610 TCCTCCCCAGGCGGGCGGGCGGG - Intergenic
926066298 2:9843215-9843237 TGCTCCTCCGGCGGCACGGGGGG - Intergenic
927154012 2:20211608-20211630 TTCCCACCAGCCGGCCCGGCTGG + Intronic
929160900 2:38831357-38831379 TGTCCCCCAGGCTGCCAGGCTGG + Intronic
932791038 2:74654582-74654604 TGCTCCTCAGACCGCTCGGCCGG + Intronic
934783268 2:96986412-96986434 GGCTCCCCAGGCGGCGCAGTGGG + Exonic
935931006 2:108125389-108125411 TGCTGCCCAGTAGGCCCTGCTGG - Intergenic
936525159 2:113236467-113236489 GGCCCACCTGGCGGCCCGGCCGG + Intronic
936817329 2:116475041-116475063 TGTTGCCCAGGCTGCCAGGCTGG + Intergenic
937275746 2:120682890-120682912 TGCTCCCCAGGCCCCCCTGAGGG + Intergenic
937932826 2:127219546-127219568 TCCTCCCCAGGGGTCCCGGCTGG + Intronic
941544976 2:166837773-166837795 TGCTGCCCAGCCTGCCAGGCAGG - Intergenic
944288230 2:197975774-197975796 TGTTACCCAGGCTGCCAGGCTGG - Intronic
945225934 2:207530616-207530638 GGCTGCCCCGGAGGCCCGGCCGG - Intronic
947885577 2:233566803-233566825 TGCTTCCCAGGATGCCCCGCTGG + Intergenic
948056497 2:235012621-235012643 TGCAGCCCAGCCGGCCAGGCAGG - Intronic
948632143 2:239309180-239309202 TGCTCTCCCGGCGGCCTCGCTGG + Intronic
948901297 2:240958049-240958071 AGCTCCCCAGGAAGGCCGGCTGG - Intronic
1168757105 20:325525-325547 TTCTCCCCGCGCGGCCCCGCCGG - Exonic
1168896004 20:1324126-1324148 TGATACCCAGGCTGCCTGGCTGG + Intronic
1172762445 20:37332099-37332121 GGATCCCCAGGCAGCCCGGAAGG - Intergenic
1173865916 20:46312646-46312668 TGCTCCCTACGCCCCCCGGCGGG - Intergenic
1175604329 20:60299759-60299781 TGCTCCCCAGGCTGCCCACTGGG - Intergenic
1176026809 20:62990055-62990077 TGTTCCCGGGGTGGCCCGGCTGG + Intergenic
1176123753 20:63465943-63465965 CCGTCCCGAGGCGGCCCGGCGGG + Intronic
1176173585 20:63707531-63707553 CGCTCCCCAGGAGCCCCTGCAGG + Intronic
1179603345 21:42496003-42496025 AGCTCCCCAGGATCCCCGGCAGG - Intronic
1179718787 21:43303799-43303821 TGCTCCCCATGCTGCGGGGCTGG - Intergenic
1179726492 21:43344101-43344123 TGCTCCCCACGTGGCAGGGCTGG + Intergenic
1180049785 21:45325872-45325894 TGCCCCCCAAGGGGCCTGGCTGG + Intergenic
1181530184 22:23512951-23512973 TGCTCCATAGGGTGCCCGGCTGG - Intergenic
1183068577 22:35380716-35380738 TGCACCCCAGGCGTCCCAGAAGG - Intronic
1183259866 22:36787751-36787773 TGCATCCCAGGCGGCCCCGCAGG + Intergenic
1184291814 22:43501447-43501469 TGCTCTCCAGACGCCCCGCCCGG + Intronic
1184663468 22:45976093-45976115 CGAGCCCGAGGCGGCCCGGCCGG + Intronic
1184865682 22:47200753-47200775 TGCTGCCCACTCGGCCTGGCAGG + Intergenic
1185010216 22:48308771-48308793 TGCTCCCCGGGCTGGCCTGCTGG - Intergenic
1185131575 22:49042276-49042298 AGCTCCCCAGCCATCCCGGCAGG + Intergenic
1185134509 22:49062155-49062177 TGCTCCGCAGCCAGCCCAGCTGG + Intergenic
959606536 3:108247471-108247493 TGCTCTCCAGGGGGCCCACCTGG - Intergenic
961015189 3:123462495-123462517 TGTTGCCCAGGCTGCCAGGCTGG - Intergenic
961872992 3:130002075-130002097 TGAACCCCAGGAGGCCAGGCTGG + Intergenic
962623880 3:137205486-137205508 TGCTCCCCAGGCTGCTAGGGAGG + Intergenic
967859671 3:194141519-194141541 CGCTCCCCCCGCGGCCTGGCAGG - Intergenic
968078431 3:195829920-195829942 TGCTCCCCATGAGGGCTGGCTGG + Intergenic
968446664 4:655559-655581 TCCTCCCCAGGCTGCCGTGCTGG - Intronic
968541049 4:1168608-1168630 TGCTCCCCAGGTGGGCTGCCCGG - Intronic
968971751 4:3799370-3799392 GGCTCCCCAGGCTGCCTGACAGG + Intergenic
969301954 4:6302279-6302301 TGCTGCCCAGGCGGCCCTCCAGG - Exonic
969688143 4:8688366-8688388 TGTACCCCAGGCGGGACGGCCGG + Intergenic
969714680 4:8862805-8862827 TGCTCCCCAGGCGGTGAGGCTGG + Intronic
969723870 4:8907849-8907871 TGCCCTCCTGGCAGCCCGGCGGG - Intergenic
969737650 4:9001767-9001789 TGAACCCCAGGAGGCCAGGCTGG - Intergenic
969796850 4:9533328-9533350 TGAACCCCAGGAGGCCAGGCTGG - Intergenic
972168770 4:36319479-36319501 TGCTCTCCAGGCAGCTCAGCTGG + Intronic
975787535 4:77907925-77907947 TGTTGCCCAGGCTGCCAGGCTGG + Intronic
978335030 4:107657705-107657727 TACTGCCCAGGCTGCCAGGCTGG - Intronic
979947125 4:126845895-126845917 TGTTGCCCAGGCTGCCAGGCTGG - Intergenic
985028883 4:185768494-185768516 TGTTGCCCAGGCTGCCAGGCTGG - Intronic
985771463 5:1814560-1814582 TGCTCCCGAGGCGGCCCTTACGG + Intronic
986416287 5:7531255-7531277 TGCTACCCAGGCGACCTGGAGGG + Intronic
990937652 5:61167179-61167201 TGTTGCCCAGGCTGCCAGGCTGG - Intergenic
994320796 5:98392433-98392455 TGCCCCGCAGCCGGCCCAGCAGG - Intergenic
997350058 5:133224678-133224700 TGCTCCCCAGGTAGGCCTGCAGG - Intronic
999279849 5:150357925-150357947 CCGTCCCCAGGCGACCCGGCAGG + Intronic
1001798866 5:174526218-174526240 TGCTTCCCAGGGAGCCCAGCTGG + Intergenic
1002495711 5:179610134-179610156 GGCTCACCAGGCTGCCCTGCAGG - Intergenic
1005466211 6:26116668-26116690 TGTTGCCCAGGCTGCCAGGCTGG - Intronic
1005968363 6:30742815-30742837 GGCTAACCAGGCAGCCCGGCTGG - Intergenic
1006296578 6:33172567-33172589 TGCTCTCCAGGGGGCCCCGGGGG + Exonic
1007274540 6:40663636-40663658 TGCCCCCCAGGCAGCTCGACTGG - Intergenic
1013273461 6:108561860-108561882 CGCTGCGCAGGAGGCCCGGCGGG - Intronic
1013372472 6:109482998-109483020 TGCTCCCCAGTCGGGCCCGCGGG - Intronic
1015376138 6:132512808-132512830 GGCTCCCCACGCCCCCCGGCCGG - Intronic
1015776795 6:136822746-136822768 CGCAGGCCAGGCGGCCCGGCAGG - Exonic
1016614437 6:146029570-146029592 TTCTCCCCAGAAGCCCCGGCAGG + Exonic
1017646150 6:156541438-156541460 TGCTGCCCAGGAGGCCTGGCCGG + Intergenic
1019575425 7:1735433-1735455 TGCCCTCCAGGAGGCCGGGCTGG - Intronic
1020046776 7:5046257-5046279 TGCTCCCGAGGGGCCCGGGCCGG - Exonic
1020660626 7:10976862-10976884 AGCTCCCCAGGGGGCCAGGAAGG - Intronic
1021716948 7:23469630-23469652 CGCTCCCCCGGCGCCCCGCCCGG - Intronic
1021844607 7:24752349-24752371 TGCTTCCCTGGCTGCCCTGCAGG - Intronic
1022094452 7:27130228-27130250 GCCACCCCAGGCGTCCCGGCAGG - Exonic
1022440363 7:30427979-30428001 TGCTTCCCAGGCTGCTGGGCAGG + Intronic
1023354566 7:39354024-39354046 CCCGCTCCAGGCGGCCCGGCAGG + Intronic
1023373335 7:39533147-39533169 TGCTCTCCAGGCTGCCCCCCTGG + Intergenic
1024246610 7:47475575-47475597 GGCTGCCCAGGAGGCCGGGCGGG + Intronic
1026727326 7:72879745-72879767 TGCTCCCGAGGGGCCCGGGCCGG - Exonic
1027116530 7:75485982-75486004 TGCTCCCGAGGGGCCCGGGCCGG + Exonic
1027121823 7:75527684-75527706 TGCTCCCGAGGGGCCCGGGCCGG + Intergenic
1027275297 7:76549721-76549743 TGCTCCCGAGGGGCCCGGGCCGG - Intergenic
1029168853 7:98617119-98617141 TGCGCGCCTGGCGGCCGGGCGGG - Intergenic
1029597186 7:101544081-101544103 TTCTTACCAGGCGGCCCCGCTGG - Exonic
1029721010 7:102364271-102364293 TGCTCCCGAGGGGCCCGGGCCGG - Exonic
1032217039 7:129965446-129965468 TGTTGCCCAGGCTGCCAGGCTGG + Intergenic
1033502205 7:141963183-141963205 TTGTTCCCAGGCGGACCGGCAGG - Intronic
1034902202 7:154914627-154914649 TGGTCCCCAGGCCCCCCGGGGGG - Intergenic
1036242748 8:7093027-7093049 TGAACCCCAGGAGGCCAGGCTGG - Intergenic
1036810687 8:11866377-11866399 TGCTCCCCAGGTGGCAACGCAGG - Intronic
1036899071 8:12658411-12658433 TGAACCCCAGGAGGCCAGGCTGG + Intergenic
1037817627 8:22120375-22120397 TGCTGCCCAGGCTGCTGGGCTGG + Exonic
1037882620 8:22580321-22580343 GGCTGCCCAGGCTGCCAGGCAGG - Intronic
1046792794 8:118339918-118339940 TGCTACCCAGGCGGCATGACCGG + Intronic
1048244223 8:132775686-132775708 GGCGTCCCGGGCGGCCCGGCGGG - Intronic
1049109423 8:140634415-140634437 TGCGCCGCCTGCGGCCCGGCTGG + Intronic
1049166398 8:141128612-141128634 CGGCCCCCAGGCGGCGCGGCTGG + Exonic
1049194563 8:141308220-141308242 TGCTCCCTCGGCCGGCCGGCCGG + Intronic
1049638861 8:143705401-143705423 TGCGCCCGAGGCGGGCGGGCAGG - Intronic
1049664067 8:143835361-143835383 TCCTACCCAGGCTGCCTGGCCGG - Exonic
1049792505 8:144478404-144478426 AACGCCCAAGGCGGCCCGGCGGG - Intronic
1052580481 9:30348996-30349018 TTCTGCCCACTCGGCCCGGCAGG + Intergenic
1053165449 9:35841041-35841063 TTCTCCCCAGCCCGCCCAGCAGG + Intronic
1056356435 9:85805512-85805534 GGCTCCCCAGGCGGCCGCACTGG - Intergenic
1058705889 9:107637687-107637709 AGTTCCCGAGGCCGCCCGGCAGG - Intergenic
1059433688 9:114264367-114264389 TGCTCCCCAGCTGGTCCGTCCGG - Exonic
1060406951 9:123377567-123377589 TGTTCTCCAGGAGGCCAGGCCGG + Exonic
1061700226 9:132410167-132410189 TGCGGCCCGGGCCGCCCGGCAGG + Intronic
1062111231 9:134783129-134783151 TGCTGCCCAGGCCACACGGCCGG + Intronic
1062334174 9:136057718-136057740 GGCTGCCCAGGCGGAGCGGCCGG + Intronic
1185466942 X:360855-360877 TGCTCTCCAGGCTGACCGCCTGG - Intronic
1186018355 X:5225405-5225427 TGTTGCCCAGGCTGCCAGGCTGG - Intergenic
1187464413 X:19515032-19515054 AGCTCCCAGGGCGGCGCGGCCGG - Exonic
1200100532 X:153687632-153687654 TGCAGCCCAGGCTTCCCGGCCGG - Intronic
1200122729 X:153798734-153798756 TCCTCCCCAGGTGGCCCCACAGG + Intergenic
1200144951 X:153921627-153921649 TGCTCCCCAGGCGGCCTCCACGG + Exonic