ID: 902720861

View in Genome Browser
Species Human (GRCh38)
Location 1:18303074-18303096
Sequence CCTGGGGCCCCCAACCACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 308}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902720861 Original CRISPR CCTGGGGCCCCCAACCACCA AGG Intronic
900205578 1:1430783-1430805 CCTGAGGCCCCGCACCGCCAGGG + Intergenic
900224995 1:1528836-1528858 CCTGGGCTCCCCCACCCCCATGG + Intronic
900357321 1:2271140-2271162 CCTGGGGTCGCCAATCACAAAGG - Intronic
900599628 1:3497501-3497523 CCTGGAGCCCCCCGCCACCCCGG + Intronic
902720861 1:18303074-18303096 CCTGGGGCCCCCAACCACCAAGG + Intronic
903145793 1:21371130-21371152 CCTCCTGCCCCCAACCCCCAAGG - Intergenic
904614294 1:31741762-31741784 CATGGGGCCCCCAGCCCCCAGGG + Intronic
905517154 1:38570176-38570198 ACTGGGGCTCCCAACCCCCGAGG - Intergenic
905626846 1:39495075-39495097 TCTGGGGCCACCAACCTTCAGGG - Intronic
907116183 1:51970472-51970494 CCTGGAGCCCCTCACCACAAAGG - Intronic
907256783 1:53185357-53185379 CCAGGGGACCACTACCACCAAGG + Intergenic
907295036 1:53445327-53445349 CCAGGGGACCACTACCACCAAGG - Intergenic
908605633 1:65793693-65793715 CCTTGGTGCCCCAGCCACCAGGG - Intronic
914005957 1:143732397-143732419 TCAGGGGTCCCCAACCCCCAGGG - Intergenic
914098426 1:144563630-144563652 TCAGGGGTCCCCAACCCCCAGGG - Intergenic
914300556 1:146374012-146374034 TCAGGGGTCCCCAACCCCCAGGG + Intergenic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
920283078 1:204858768-204858790 TCTGGGGCTCCCAACAGCCATGG + Intronic
920418956 1:205817415-205817437 CCTGGACCCCCTAACCAGCATGG + Intergenic
921196142 1:212759908-212759930 CCTGGGGCCACCCAGCAGCAAGG + Intronic
921778645 1:219133515-219133537 TCTGTGGCCCCCACCCACAAGGG - Intergenic
922334180 1:224605707-224605729 CCTGCGGCCCCCACCCAGAAGGG + Intronic
922875524 1:228937140-228937162 GCAGGGGTCCCCAACCCCCAGGG + Intergenic
923623205 1:235594521-235594543 CCTGAGCCTCCCCACCACCATGG - Intronic
1064978411 10:21142660-21142682 TCAGGGGCCCCCAACCCCCAGGG + Intronic
1067478331 10:46580173-46580195 GATGGTGCCCCCAATCACCAGGG - Exonic
1067616407 10:47761614-47761636 GATGGTGCCCCCAATCACCAGGG + Intergenic
1067944087 10:50679568-50679590 CTGGGTGCCCCCAACCACCTGGG - Intergenic
1068957090 10:62827979-62828001 TCAGGGGTCCCCAACCCCCAGGG + Intronic
1070305210 10:75235423-75235445 CCTGGGGGTCCCAAGCCCCAGGG + Intronic
1070750338 10:78960342-78960364 CCAGGGGCCCACAGCCAGCACGG - Intergenic
1070833627 10:79434980-79435002 CCTGGACTTCCCAACCACCAGGG + Intronic
1070853206 10:79584325-79584347 CCTGGGGGCCCCAACTTCCCAGG + Intergenic
1070865581 10:79706438-79706460 CTGGGTGCCCCCAACCACCTGGG - Exonic
1070879374 10:79844569-79844591 CTGGGTGCCCCCAACCACCTGGG - Exonic
1071632482 10:87228659-87228681 CTGGGTGCCCCCAACCACCTGGG - Exonic
1071645931 10:87360877-87360899 CTGGGTGCCCCCAACCACCTGGG - Exonic
1072524934 10:96263335-96263357 TCTGGGGCCCCCAGCCAGCATGG + Intronic
1073199966 10:101727309-101727331 CCAGGGGTCCCCAACCCCCTAGG - Intergenic
1073928328 10:108544121-108544143 CCGGGGGACCACTACCACCAAGG + Intergenic
1074744058 10:116513745-116513767 GCAGGGGTCCCCAACCCCCAGGG - Intergenic
1075419335 10:122289068-122289090 TCTGGGGACCCCTGCCACCAAGG - Intronic
1075690070 10:124388674-124388696 CTTCGGTCCCCCAATCACCAGGG + Intergenic
1075941091 10:126390637-126390659 CCTGGTGCTCACAACCACCTGGG - Intergenic
1076358589 10:129870494-129870516 CCTGGGGCCCCGAGCTGCCAGGG + Intronic
1076539715 10:131206382-131206404 CCTGGGGCCCCAGACAGCCAAGG + Intronic
1076739778 10:132477489-132477511 CCTGGAGCCCCCAACCAATGGGG - Intergenic
1076744279 10:132504945-132504967 CCTGGTGCCCCCACAGACCAAGG + Intergenic
1076790760 10:132775539-132775561 CCTGTGGCCCCCAACACCCAGGG - Intronic
1076978981 11:195373-195395 CCTGCGGCTCCCAACCCCCTTGG - Intronic
1077053705 11:579636-579658 GCTGGGTCCACCAAGCACCAGGG + Intronic
1077365696 11:2160711-2160733 CCTGGCGCTCCCACCCAGCATGG - Intronic
1077442552 11:2575362-2575384 CCTGGGCCCCCCACCGCCCAGGG + Intronic
1077826009 11:5808844-5808866 CCCACGGCCCCCAACCACCAAGG + Intronic
1081857404 11:46312509-46312531 CCAGGGGAGCCCACCCACCAAGG - Intronic
1083292719 11:61698840-61698862 CCAGGGCCCGCCAACCCCCAAGG - Intronic
1084217667 11:67659021-67659043 CCAGGGGACCACTACCACCAAGG + Intergenic
1084436454 11:69144331-69144353 CCTGTGCCCCCCATCCACCCCGG - Intergenic
1084601302 11:70147405-70147427 CAGGAGGCCCCCAACCCCCAGGG - Intronic
1084664850 11:70570788-70570810 CCCGGGGCCCACACCCACCAGGG + Intronic
1084785183 11:71437982-71438004 CCTGGGGCCCCCATGGACCTCGG + Intronic
1085297527 11:75439478-75439500 CCTGGGGCCCCCACCCAGCCAGG - Intronic
1085593660 11:77789399-77789421 CCTGGGGCCCAGTGCCACCAGGG + Intronic
1089528595 11:119112579-119112601 CCTGGGACCAGCAGCCACCATGG + Exonic
1090194833 11:124805891-124805913 GCAGGGGTCCCCAACCTCCAGGG + Intergenic
1091891378 12:4057337-4057359 CCTCGGTCCCTCATCCACCAGGG - Intergenic
1092143782 12:6201007-6201029 CCTGGCGCCCCCTACTACCTGGG - Intronic
1092341672 12:7681801-7681823 CCTTGGCCCCCCAAGCAGCAAGG + Intergenic
1092525547 12:9307402-9307424 CCTGGGGCCCCAAGCCAGAAAGG + Intergenic
1093059707 12:14589631-14589653 CCTGGGCCCCCCAAGAACCCAGG + Intergenic
1094511305 12:31098085-31098107 CCTGGGGCCCCAAGCCAGAAAGG + Intronic
1094747609 12:33363850-33363872 CCAGGAGTCCCCAACCCCCAGGG + Intergenic
1096111780 12:49033241-49033263 CCTGGGGGCCCAAAGCTCCAGGG + Exonic
1096522303 12:52191324-52191346 CCTGGGGTCACCCACCACCCAGG - Intronic
1096622680 12:52874318-52874340 CCTGGGGCCCCCGGCCGCCGTGG - Intergenic
1096766267 12:53892802-53892824 CCAGGGCCCCCCAACCAAAAGGG + Intergenic
1099025075 12:77455124-77455146 CCAGGGGTCCCCAATCCCCAGGG - Intergenic
1104440688 12:128791122-128791144 CCTCGTGCCCCCCACCCCCAGGG - Intergenic
1104940616 12:132392887-132392909 CCTGTGGCCCCCACGCTCCAGGG - Intergenic
1105854354 13:24361527-24361549 CCCGGGGCTCCCAGCCCCCATGG - Intergenic
1105912868 13:24887284-24887306 CCAGGGGGCCCCAAACCCCACGG + Intronic
1108884629 13:55164998-55165020 CCAGGGTCGCCCAACCCCCAAGG + Intergenic
1113493912 13:110713555-110713577 CCTGGAGCCCGCAGCCCCCAGGG + Intronic
1113539410 13:111094907-111094929 CCAGGGGACCCCAGCCAGCATGG - Intergenic
1114619163 14:24084694-24084716 CCTGAGGCCTCCAACCAATAAGG + Intronic
1118770738 14:68941004-68941026 CCTGGTGACCGGAACCACCATGG - Intronic
1119194211 14:72705054-72705076 CCAGGGGTCCCCAACCCCCCGGG + Intronic
1119545726 14:75469978-75470000 CCTGATGCCCCCACCCACCTCGG + Exonic
1121251645 14:92504239-92504261 CCTGTGGCCCCCACCAAACATGG + Intergenic
1122125265 14:99575323-99575345 CCTGGGTCCCCCTGCCGCCAGGG + Intronic
1122375989 14:101257701-101257723 CCTGGGGTCCTGAACCACCTAGG + Intergenic
1125841293 15:42803455-42803477 CCTGGGGCAGCCAACCACATGGG - Intronic
1126183554 15:45809565-45809587 CCTGGTGCCCTGACCCACCAAGG + Intergenic
1127351650 15:58158842-58158864 CCTGGGGCCAGGGACCACCAGGG - Intronic
1128338385 15:66803034-66803056 CCTGAGCCCCCAACCCACCATGG - Intergenic
1128963261 15:72030879-72030901 ACAGGGGGCCCCAACCCCCAGGG + Intronic
1130908832 15:88257289-88257311 CCTGCGCCCCCCACCCACCCAGG - Intergenic
1131413434 15:92230393-92230415 CTTGGGGCCAACACCCACCAGGG + Intergenic
1132348464 15:101122485-101122507 AATGGAGCCCCCAGCCACCAAGG + Intergenic
1132621737 16:871067-871089 CCTGGCGTCCCCAACCCACACGG + Intronic
1132640592 16:976529-976551 CCTGGGGCCCCAAGCAGCCAGGG - Intronic
1132640695 16:976986-977008 CCTGATGCCCCCGACCTCCACGG - Intronic
1132882858 16:2170131-2170153 CCTGGTGTCCCCCACCAGCAAGG + Intronic
1133212767 16:4272458-4272480 CTTGGGGCCCCCATGCTCCAAGG + Intronic
1136393894 16:29982621-29982643 TCTGGGGCCCACGCCCACCACGG - Intronic
1136415000 16:30097455-30097477 CCAAGTGACCCCAACCACCAAGG - Intergenic
1138657401 16:58499343-58499365 CCAGGGGCTCCAGACCACCAGGG - Intronic
1138657958 16:58501483-58501505 TCTGAGGCCCCCAACCCTCAGGG - Intronic
1140393526 16:74608148-74608170 CCTGGGGCTTCCCACCACCCTGG + Intergenic
1140424756 16:74851403-74851425 CCTTGGGCCGCCCACCAGCAAGG - Intergenic
1141688621 16:85584214-85584236 CCAGGGGCCCCGAACCAGCCTGG - Intergenic
1142143846 16:88484503-88484525 CCTGCGGCCGCCAAGCCCCATGG - Intronic
1142285096 16:89168439-89168461 GCTGGGGCCACCAGCCCCCACGG - Intergenic
1142362827 16:89635414-89635436 CCTGGGACCCCCATCCTCCTGGG - Intronic
1142466471 17:140191-140213 CCTGCGGCTCCCAACCCCCTTGG - Intergenic
1143099763 17:4498752-4498774 CCCCGGGCCCCCCACCCCCAGGG + Intergenic
1143368752 17:6425433-6425455 CCTGAGGCCCACAGCCACCCAGG - Exonic
1144573666 17:16416006-16416028 CCTGGGACCCTCACCCACCCTGG - Intronic
1144601403 17:16617884-16617906 CCTTGGGCCCCCGCCCGCCACGG - Intergenic
1146521567 17:33529351-33529373 CCTGGGGCTGAGAACCACCAAGG + Intronic
1146917514 17:36687590-36687612 CCTGAGGCCCCCACCCACCCGGG - Intergenic
1147186815 17:38717517-38717539 CCTGGGGCCCCCAGGGACCTCGG + Exonic
1147261459 17:39211771-39211793 CCTGGGTCCCCTCCCCACCAAGG + Exonic
1147526977 17:41234486-41234508 CTTGGGGCCTCCTACCAGCAGGG + Intronic
1148743364 17:49905496-49905518 TCAGGAGCCCCCAACCACCCAGG + Intergenic
1148870572 17:50656805-50656827 CATGGTGACCCCCACCACCAAGG - Exonic
1150020427 17:61607084-61607106 CCTAGGTCCCCAAACAACCACGG - Intergenic
1150527812 17:65942040-65942062 CAAGGGGTCCCCAACCCCCAGGG + Intronic
1150982041 17:70153689-70153711 CATGGGGCCCCCATCAGCCATGG + Intergenic
1152146506 17:78571910-78571932 CCTGGTGCCTCCAGCCACCTCGG + Intronic
1152198004 17:78928770-78928792 CCTGAGGGCCCCAAGCAGCAGGG - Intergenic
1152472886 17:80500098-80500120 CCTGGGGCCCCCTGACTCCATGG - Intergenic
1152539514 17:80967868-80967890 CGCTGGGCCCCCACCCACCACGG + Intergenic
1152990445 18:358705-358727 CCAGAGGTCCCCAACCCCCAGGG - Intronic
1154358996 18:13643405-13643427 CCTGGGGCCCCTTACCTCCGAGG - Exonic
1154491520 18:14925712-14925734 CCTGGGAGCCCCAGCCTCCAGGG - Intergenic
1157491302 18:48125661-48125683 TCTGGGTCCACCATCCACCAGGG + Intronic
1157495063 18:48151090-48151112 CCAGGGGCCACTAACCAGCAAGG - Intronic
1159089308 18:63829657-63829679 CCTGGTGCAGCAAACCACCATGG - Intergenic
1160860953 19:1237070-1237092 CCTGGGGCCGCCGAGCACCCCGG - Intronic
1160871892 19:1281521-1281543 CCTGGGGCACCCCGGCACCAGGG - Intergenic
1161011512 19:1961493-1961515 CCTGGGACCACCCACCAGCAGGG - Intronic
1161014659 19:1977822-1977844 CCTGGGGCCACCAGCCACATAGG - Intronic
1161396168 19:4045930-4045952 ACAGGGGCCCCCCACCTCCAGGG - Exonic
1161592466 19:5135043-5135065 CCAGGGGCCACCCAGCACCAGGG + Intronic
1161766520 19:6211740-6211762 CCTGGGACCCCCAGCCACGATGG + Intergenic
1162523465 19:11194866-11194888 CTTGGGGCCCCCCAGCCCCAGGG - Intronic
1162966301 19:14157757-14157779 CCAGGGGCCCCCCACACCCATGG + Intronic
1163384111 19:16988738-16988760 GCAGGGGTCCCCAACCCCCAGGG + Intronic
1163446877 19:17352247-17352269 CCCGCCGCCCCCAACCACCCAGG - Exonic
1163525954 19:17821503-17821525 CCCGGCGCCACCCACCACCATGG - Exonic
1163529990 19:17843334-17843356 CCTTGGACCCCCAACCCCCTGGG + Intronic
1164015576 19:21253626-21253648 CCTGCTGCCCCCAACCACTCTGG - Intronic
1164305699 19:24002812-24002834 GCTGGGGCCCGCCACCTCCAAGG + Intergenic
1166296644 19:41893211-41893233 CCTGGGGTCCCCATCCACCCAGG - Intronic
1166297469 19:41896131-41896153 CCTGGGGTCCCCATCCACCCAGG + Intronic
1166966833 19:46534022-46534044 CCCGGGGGTCCCAGCCACCACGG - Intronic
1167113316 19:47474493-47474515 CCCTGGGCCCCCAACCCCCTAGG + Intergenic
1167782934 19:51612260-51612282 CCAGGAGGCCCCAAGCACCACGG - Exonic
925731782 2:6924291-6924313 CCTCGGGCCCCCCAGCAACACGG - Intronic
926125187 2:10267631-10267653 CCTGGGCCCCCCAGCTCCCAGGG - Intergenic
926151173 2:10426327-10426349 CCGGGGGCCCCCAACCAGCATGG + Intronic
927285645 2:21354284-21354306 CCTGGGGCCCTCCCCCACCTGGG - Intergenic
927943677 2:27121817-27121839 CCAGGGGTCCCCAACCCCCTGGG - Intergenic
928880609 2:36092511-36092533 CCTGAGCCTCCCCACCACCATGG + Intergenic
929895908 2:45960682-45960704 GCAGGGGCCCCCAATCCCCAGGG - Intronic
931088076 2:58856238-58856260 CCTGGGGCACTCAACTAGCAAGG - Intergenic
933834273 2:86232698-86232720 CCTCGGGCCCCCCACCACCGGGG - Exonic
934569416 2:95359473-95359495 CCTGGGCACCCCCACCCCCATGG + Intronic
934645173 2:96055098-96055120 CCTGGGGCCTTCAAGAACCAAGG + Intergenic
934715615 2:96541578-96541600 ACTGGGGCCCCCAACCAATGAGG + Intronic
934838577 2:97611187-97611209 CCTGGGGCCTTCAAGAACCAAGG + Intergenic
935146645 2:100399911-100399933 CCCGGGCCCTCCACCCACCATGG + Intronic
935215161 2:100970197-100970219 CCAAGGGCCCCCTACCCCCAGGG + Intronic
935707138 2:105866742-105866764 CCAGGGGTCCCCAACCCCCCGGG - Intronic
936010670 2:108923371-108923393 CCTGGCACCCCCCAACACCAAGG - Exonic
936122021 2:109755192-109755214 GCTTGGGCCCCCCCCCACCAAGG - Intergenic
936614312 2:114033042-114033064 CCTGCTGCCCCCAACCCCCATGG + Intergenic
937134199 2:119538320-119538342 CCTGGCGCCCCAAACATCCATGG + Intergenic
940446641 2:153785293-153785315 ACTGGGGTCCCCAACCACCCTGG + Intergenic
943981611 2:194559682-194559704 CCTGGATCCCACACCCACCATGG + Intergenic
945279607 2:208023748-208023770 CCTGGTGCCAAAAACCACCAGGG + Intronic
946306650 2:218860149-218860171 CCCGGGGTCCCCACCCTCCAGGG - Intronic
948508809 2:238449292-238449314 CCTGGGGCGCCCAAGTCCCATGG + Exonic
948559518 2:238842279-238842301 CCTTGGGCCCCCTACCCCCAGGG + Intergenic
948798375 2:240418697-240418719 CCTGCGGCCCCCAGACAGCATGG - Intergenic
948908320 2:240990491-240990513 GTTAGGGTCCCCAACCACCAAGG + Intronic
1168773519 20:430804-430826 CCTCAGGCCTCCAACCACAAAGG - Exonic
1168924160 20:1565974-1565996 TATGGGGCTCCCAACCCCCAGGG - Intronic
1171290735 20:23981620-23981642 CCTGGGTCCCCCAACCCCCCAGG + Intergenic
1171978044 20:31607747-31607769 CCTGGGGGCACCAACCCTCAAGG + Intergenic
1172201270 20:33127745-33127767 CCTGGGGGGCTCAACCTCCAGGG + Intergenic
1172352786 20:34256322-34256344 CCGGGGGACCACTACCACCAAGG - Intronic
1172537779 20:35687604-35687626 CCAGGGGACCACTACCACCAAGG - Intronic
1174142015 20:48421716-48421738 CCTGGGTCCCCAAACCACAGGGG + Intergenic
1175470245 20:59222341-59222363 CCCCGGGCGCCCACCCACCAGGG - Intronic
1175530856 20:59673574-59673596 CCTGGGGCTCCCAAACACAAGGG + Intronic
1175973536 20:62699072-62699094 CCTGGGACCCCCACCCTCCTGGG - Intergenic
1176079132 20:63262888-63262910 CCTGGGACCCCCAGTCCCCAGGG + Intronic
1176142840 20:63552909-63552931 CCTGGGGCCTCCATGCACCAAGG + Intronic
1176218467 20:63959084-63959106 CCAGGGGCCCCACACCCCCAGGG + Exonic
1177897471 21:26871802-26871824 CCAGGGGACCACTACCACCAAGG + Intergenic
1178581337 21:33841013-33841035 CTTGGGGAACTCAACCACCATGG - Intronic
1179205979 21:39278992-39279014 CCTGTGGTCCCCAGCCACTAGGG - Intronic
1180790109 22:18571199-18571221 CCTGTGTCCCCACACCACCAAGG + Intergenic
1180876557 22:19177739-19177761 CATGGGGCACACGACCACCACGG + Exonic
1180877343 22:19180698-19180720 CCTGTAGCCCCCAACCCCCTGGG - Intronic
1181049481 22:20231823-20231845 CCTGGGGCCCCTGGCCAGCACGG - Intergenic
1181231630 22:21424116-21424138 CCTGTGTCCCCACACCACCAAGG - Intronic
1181247021 22:21510752-21510774 CCTGTGTCCCCACACCACCAAGG + Intergenic
1181281039 22:21720738-21720760 CCTTGGCCTCCCACCCACCACGG + Intronic
1181401239 22:22651300-22651322 CCTGGGTCCCCCCACCCCCCAGG - Intergenic
1181984854 22:26793106-26793128 CCTGGGCCCCACATCCATCATGG - Intergenic
1182102386 22:27667323-27667345 CCTGGGGCGCACAGCCACCGAGG - Intergenic
1183021791 22:35033375-35033397 CCTGGGGCTCTCAATCTCCATGG + Intergenic
1183172932 22:36201432-36201454 TCTGGGGCCCCCATGCAACAAGG + Intronic
1183933910 22:41250947-41250969 CCTGGGGCCCACGAGCATCAAGG + Intronic
1183958613 22:41397490-41397512 CCTGGGACTCTGAACCACCACGG - Exonic
1184298861 22:43543307-43543329 GCTGGGGGACCCAGCCACCAGGG + Intronic
1184301093 22:43561494-43561516 CCTGGGGTCCCCAGGCCCCATGG + Intronic
1184414938 22:44346787-44346809 TCTGTGGCTCCCAACCCCCATGG + Intergenic
1184454082 22:44599267-44599289 CCTGAGGCCCCCAAAGACCACGG + Intergenic
1184737682 22:46408970-46408992 ACTGGGGCCCCGTGCCACCAAGG - Intronic
1184744842 22:46450235-46450257 GCAGAGGCCCCCAGCCACCAGGG + Intronic
1184834374 22:47012414-47012436 CCTGAGGTCCCCAGGCACCAGGG + Intronic
1185081019 22:48709399-48709421 CCTGGGAACCCCAACCAGCAGGG - Intronic
1185162761 22:49239513-49239535 CCTGGGGCCGACAGCCACCAGGG - Intergenic
950198966 3:11029249-11029271 CCTGGGGTACTCATCCACCAGGG - Exonic
950584419 3:13882198-13882220 GCTGGGGCCCTGAGCCACCATGG + Intergenic
950771379 3:15314334-15314356 CCTGAGGCCCCCAAAAAGCATGG - Intronic
952826702 3:37530500-37530522 CCTGGGGCCACCTATCTCCAGGG - Intronic
953575991 3:44113650-44113672 CCAGGGTCCCCAAACCTCCAAGG - Intergenic
954108268 3:48420615-48420637 ACTGGGACCCCCAACCCCCCCGG + Intronic
954416545 3:50396064-50396086 CCTGGGGCCCCCAAAACCCTAGG - Intronic
954665350 3:52248516-52248538 CCTGGGGCCCCCCTCCACCTTGG + Intronic
955397853 3:58569648-58569670 CCTGGGCCCCGCAAGCACCTGGG - Intronic
957584937 3:82121101-82121123 CCAGGGGTCCCCAACCCCCCAGG - Intergenic
961832828 3:129633024-129633046 CCAGGGGCACCTGACCACCAGGG + Intergenic
963604687 3:147404534-147404556 CCTGAGGTCCCAAACAACCACGG + Intronic
965304836 3:167051519-167051541 CCAGGGGTCCCCAACCCCCAGGG + Intergenic
968619410 4:1597131-1597153 CCTGGGCTCCCCAGACACCAAGG + Intergenic
968643975 4:1729373-1729395 CCGGGGGACCACTACCACCAAGG + Intronic
971483710 4:27138631-27138653 CCAGGGCTCCCCAACCCCCAGGG + Intergenic
971587173 4:28418666-28418688 TCAGGGGTCCCCAACCCCCAGGG - Intergenic
972543246 4:40057077-40057099 CCCGGGACCCCTAACCTCCAGGG - Intronic
972923109 4:43968173-43968195 CCAAGGGCCCCCAACCCCCAGGG + Intergenic
978282579 4:107035717-107035739 CCTGGGTCCCCGAACCAGGAAGG - Exonic
984699422 4:182809182-182809204 CCTGCAGCCCCCACCCACCAGGG + Intergenic
985674790 5:1225459-1225481 CCTGGGGCACTCAGTCACCATGG + Exonic
985772652 5:1822627-1822649 CCAGGGGACCCAAAACACCACGG + Intergenic
990748528 5:58985948-58985970 CCTGGGGCCCGGAACAACCCTGG + Intronic
991081902 5:62609764-62609786 CCTGGGGACACCAACTAACATGG - Intronic
992151179 5:73905032-73905054 GCTGGGGTCCCCAAACCCCAGGG + Intronic
993692811 5:91023648-91023670 CCTGGGCCACCCAAGCTCCAGGG + Intronic
994449811 5:99928570-99928592 CCTGGGTCCCACAACTCCCAAGG + Intergenic
994759639 5:103836629-103836651 ACTGTGGCCCTCAACTACCATGG + Intergenic
997196762 5:131985522-131985544 CCTGGGCTCCCCAACCAGCCAGG + Intronic
997297352 5:132776665-132776687 CCTGGGGCCTCCATCCTCCCCGG + Intronic
998162915 5:139823433-139823455 GCAGGGGGCTCCAACCACCATGG - Intronic
1002276432 5:178107125-178107147 CCTGGGTCCCCCCACCCCCAGGG - Intergenic
1002394155 5:178940561-178940583 CCAGGGGCCGCCAGCCACCATGG + Intergenic
1002514855 5:179750048-179750070 CCTGGAGCCTCCATCCAGCAGGG + Intronic
1002608333 5:180397094-180397116 CCTGTGGCCAACAACCAGCAAGG - Intergenic
1004034919 6:11914484-11914506 ACCGGGGCCCCCAACCCCCTGGG - Intergenic
1004157959 6:13187214-13187236 CCAGGGGTCCCCAACCACCAGGG - Intronic
1005922206 6:30412123-30412145 CCAGGGGACCACTACCACCAAGG - Intergenic
1006171463 6:32095767-32095789 CCCGGGGCCCGCAGCCTCCAGGG + Intronic
1006412466 6:33882417-33882439 CCTGGCGCCCACAGCCAGCATGG + Intergenic
1006626958 6:35404475-35404497 CCAGGGGCCTCCATCCTCCATGG - Intronic
1006634226 6:35450812-35450834 GCTGTGGCTCCCACCCACCAAGG - Intergenic
1007425023 6:41741010-41741032 GCTGGGGGTCCCAACCACTAGGG - Intronic
1008459962 6:51757143-51757165 TCAGGGGTCCCCAACCCCCAGGG - Intronic
1008508146 6:52251116-52251138 CCTCAGTCCCCCAACCATCAAGG + Intergenic
1010465722 6:76165586-76165608 CCTGGGGACCCCAGGCACCTAGG - Intergenic
1016183056 6:141170856-141170878 CCTGTGCCCCCCCACCACAAGGG - Intergenic
1017083047 6:150686826-150686848 ACCGGGCCCCCCACCCACCAAGG + Intronic
1019261822 7:86173-86195 CCTGGGGACCCCCACGGCCACGG + Intergenic
1019306004 7:336053-336075 CCCGGGCCCCTCCACCACCATGG + Intergenic
1019512154 7:1423064-1423086 CCAGGGGCCCCCCACTTCCAGGG + Intergenic
1019588315 7:1816450-1816472 CCTGGGACCCCCAACTGCCTGGG - Intronic
1019665396 7:2249728-2249750 CCTGGGTCTCCCATCCACCCTGG + Intronic
1020211898 7:6164132-6164154 CCTGGAGCCCCCAAGTGCCATGG + Exonic
1020383508 7:7570907-7570929 CCAGGGGTCCCCAACTCCCAGGG - Intronic
1021863815 7:24934503-24934525 CTTTTGGCCCCCAACCACTAGGG + Intronic
1022507601 7:30916361-30916383 TCTAGGGCCCCCACCCAGCAGGG + Intronic
1026178924 7:68021811-68021833 CTGGGAGCCCCCTACCACCATGG - Intergenic
1026311558 7:69190279-69190301 CCTGGAGCCCCAAAACACCTAGG + Intergenic
1027554714 7:79648622-79648644 CATGGGGCTGCCAAGCACCAAGG - Intergenic
1028480256 7:91296994-91297016 TCAGGGGTCCCCAAACACCAGGG + Intergenic
1029215353 7:98944589-98944611 CTCTGGGCCCCCAAACACCATGG - Intronic
1029692405 7:102191057-102191079 CCTGGGACCCCCAGCCTCCCTGG + Intronic
1031304096 7:120102142-120102164 CTGGGAGCCCCCAGCCACCAGGG + Intergenic
1032248691 7:130234339-130234361 CCTGGGGCCCTCCTCCACCTGGG - Intergenic
1035115791 7:156522912-156522934 CATGGGTCCCCCTCCCACCAAGG - Intergenic
1037887842 8:22604494-22604516 GCTGGGCCCCCCAAACACAAGGG - Intergenic
1038186385 8:25278675-25278697 CCTGGGGCTCCAAGCCACAAGGG - Intronic
1040850683 8:51898623-51898645 CCTCGGGCCCCCGACCTCCCCGG + Intronic
1041439204 8:57875584-57875606 TCTGGGTTCCCAAACCACCACGG + Intergenic
1044460708 8:92441050-92441072 CCTGGTCCCCCAAGCCACCAAGG - Intergenic
1047540343 8:125759164-125759186 CTTGGGGCTCTCAAACACCATGG + Intergenic
1049424935 8:142533738-142533760 CATGGGGCCCCCATCCTCAAGGG + Intronic
1049516488 8:143060679-143060701 CCTGGGGACCACTACCACCAAGG - Intergenic
1049649719 8:143760054-143760076 TCTGGGGCCCCAAAACACCATGG - Intergenic
1049696210 8:143985472-143985494 CCAGGGGCCCCCCACCACTGCGG + Exonic
1049867913 8:144950721-144950743 CCTGGGCCCCCCAACCACGGGGG + Intronic
1051063849 9:13077502-13077524 GCAGGGGTCCCCAACCCCCATGG - Intergenic
1053450415 9:38189376-38189398 GCAGGGGTCCCCAACCCCCAAGG + Intergenic
1053503200 9:38620039-38620061 CCTGCGGCCCCCTCCCACCGCGG + Intergenic
1055520849 9:77079762-77079784 CCTGTGGCCCCCAACCCAGAGGG - Intergenic
1056590693 9:87963887-87963909 CCTGGGGCCCCCAGCAGCCAAGG - Intergenic
1057019903 9:91689062-91689084 CCTGGAGGCCCCAACCAGCCAGG + Intronic
1057211766 9:93204451-93204473 CCTGGGGCCCACAGCCCCGAGGG - Intronic
1057355035 9:94325516-94325538 CTGGGTGCCCCCAACCACCTGGG + Exonic
1057652716 9:96932118-96932140 CTGGGTGCCCCCAACCACCTGGG - Exonic
1057855776 9:98599744-98599766 CCTGGGGACCCCACCCCGCATGG + Intronic
1058918695 9:109592706-109592728 CCTGAGCCTCCCAACCACTAGGG + Intergenic
1058939954 9:109803900-109803922 CATGGGGCTCCCAAGCTCCAAGG - Intronic
1059346520 9:113632629-113632651 CCTAGGGCCCCCACCTTCCAGGG - Intergenic
1060528458 9:124333673-124333695 CCTGGGGGCCACAATCTCCAGGG - Intronic
1060899547 9:127245330-127245352 CCTCCGGCCGCCAATCACCACGG - Intronic
1061062424 9:128257371-128257393 CTTGGGGCTGCCAACCAGCAGGG - Exonic
1061615201 9:131774707-131774729 CCTGGGGCCCCCAAACCCTGGGG - Intergenic
1061801068 9:133113705-133113727 ACCAGGGCCCCCAACCACCCGGG + Intronic
1062289135 9:135786756-135786778 CCTGTGGCCTCCCAGCACCAGGG - Intronic
1062557649 9:137122197-137122219 CCAGGGGACCACTACCACCAAGG - Intergenic
1062642275 9:137525351-137525373 CCAGGGGACCACTACCACCAAGG + Intronic
1203361276 Un_KI270442v1:220677-220699 CCAGCGGCCTCCAAGCACCAAGG + Intergenic
1203561384 Un_KI270744v1:60854-60876 CATGGAGCACTCAACCACCATGG - Intergenic
1187155235 X:16715273-16715295 CCTGGACCCCCCAACACCCATGG - Intergenic
1189260440 X:39674866-39674888 TCTGGTGTCCCTAACCACCAAGG - Intergenic
1190292119 X:49000020-49000042 CCAGGGTCCCCCCACCTCCAAGG + Intronic
1192147294 X:68690100-68690122 GCGGGGGCCCCAAGCCACCAGGG + Intronic
1192395265 X:70774162-70774184 CCTGGGGCCCAGCAGCACCAGGG + Intronic
1192473670 X:71420749-71420771 CCTTGCGCCCCCCACCCCCACGG - Intronic
1199613285 X:149635339-149635361 CCTGGGCCAGCAAACCACCACGG + Intergenic
1199975816 X:152894375-152894397 CCTGGGGACCCCTGCCTCCAGGG + Intergenic
1200162898 X:154018450-154018472 CCCGAGGCCCAGAACCACCAAGG + Intronic
1201060367 Y:10038686-10038708 CCTGAGGCCACCTACCACCTGGG + Intergenic
1201792436 Y:17857033-17857055 CATGAGGACCCCAAACACCAGGG - Intergenic
1201809118 Y:18048953-18048975 CATGAGGACCCCAAACACCAGGG + Intergenic
1202353973 Y:24026281-24026303 CATGAGGACCCCAAACACCAGGG - Intergenic
1202516806 Y:25643831-25643853 CATGAGGACCCCAAACACCAGGG + Intergenic