ID: 902723768

View in Genome Browser
Species Human (GRCh38)
Location 1:18322149-18322171
Sequence CACAGGGTCTCGCACACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1102
Summary {0: 1, 1: 2, 2: 8, 3: 123, 4: 968}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902723763_902723768 13 Left 902723763 1:18322113-18322135 CCTGAGAATTGAATGAGATCAGT 0: 1
1: 0
2: 3
3: 19
4: 198
Right 902723768 1:18322149-18322171 CACAGGGTCTCGCACACAGGAGG 0: 1
1: 2
2: 8
3: 123
4: 968
902723762_902723768 14 Left 902723762 1:18322112-18322134 CCCTGAGAATTGAATGAGATCAG 0: 1
1: 0
2: 5
3: 29
4: 303
Right 902723768 1:18322149-18322171 CACAGGGTCTCGCACACAGGAGG 0: 1
1: 2
2: 8
3: 123
4: 968

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902723768 Original CRISPR CACAGGGTCTCGCACACAGG AGG Intronic
900264991 1:1753003-1753025 CACGGGGTCCCGCACACAGATGG + Exonic
900376968 1:2359279-2359301 CACAGGGCCTGGCACACAGCTGG + Intronic
900615779 1:3565090-3565112 CACAGGGCCTGGCACGCAGTGGG + Intronic
900766321 1:4508351-4508373 CACATGTTCTCACTCACAGGTGG + Intergenic
901065544 1:6492489-6492511 CCCAGCTTCTTGCACACAGGTGG - Intronic
901133701 1:6979252-6979274 CACAGGGTCTCCGGCACAGGGGG + Intronic
901405363 1:9041451-9041473 CACAGAGCCTGGCACACTGGTGG + Intronic
901635100 1:10666866-10666888 CACAGGGTCTGGCCCACAGAAGG - Intronic
901689902 1:10965988-10966010 CTCAGGGCCTGGCACACAGTAGG - Intronic
901785741 1:11623275-11623297 CACAGAGTCCAGCACACAGTAGG - Intergenic
901854730 1:12037472-12037494 AACAGTGCCTAGCACACAGGAGG - Intergenic
902430207 1:16357128-16357150 CACATGGTCTGGCACATAGTAGG - Intronic
902571903 1:17352392-17352414 CACAGGGTCTTAAACAGAGGAGG + Intronic
902611491 1:17600190-17600212 CAGAGGGCCTGGCTCACAGGAGG + Intronic
902620766 1:17649574-17649596 CCCAGGGTCTAGCACACAACAGG - Intronic
902719274 1:18293211-18293233 CCCAGGGCCTGGCACACAGTGGG + Intronic
902719728 1:18295943-18295965 CCCAGGGCCTGGCACACAGTGGG + Intronic
902723768 1:18322149-18322171 CACAGGGTCTCGCACACAGGAGG + Intronic
902784856 1:18726362-18726384 CACAGGATCTAGCACAGAGTTGG - Intronic
902796569 1:18804328-18804350 CACAGGGCCTGGCACACATAGGG - Intergenic
902819626 1:18936065-18936087 CACAGAGCCTGGCACATAGGAGG + Intronic
903003777 1:20284954-20284976 CACAGGGCCCCGCACACAGTAGG - Intergenic
903178930 1:21595785-21595807 CACAGTGTCTGGCACACATTAGG - Intergenic
903381835 1:22902631-22902653 CCCAGGGCCTGGCACACAGTGGG - Intronic
903418625 1:23202015-23202037 CACAGTGGCTGGCACACAGCAGG + Intergenic
903668901 1:25024081-25024103 CACAGTCTCTGGCACACAGTAGG + Intergenic
903747844 1:25600557-25600579 CACAGGGGCTGGCACACAGTAGG - Intergenic
903781268 1:25821337-25821359 CACAGAGCCTGGCACACAGAGGG + Intronic
904054391 1:27660424-27660446 CACAGCGCCTGGCACTCAGGAGG - Intergenic
904342588 1:29846470-29846492 CACAGGGCCTGGCACATAGTAGG - Intergenic
904391617 1:30189783-30189805 CACAGGGGCTGGCACACAGTAGG - Intergenic
904447579 1:30587436-30587458 CACAGTGGCTGGCACACAGTGGG - Intergenic
904461734 1:30684769-30684791 CACAAGGCCTGGCACACAGCAGG + Intergenic
904593067 1:31626061-31626083 CACAGGGTCAAGCACATAGTAGG - Intronic
904835135 1:33330917-33330939 CACAGTGACTAGCACACAGCAGG + Intronic
904894076 1:33800919-33800941 CACAGGGCCTGGCACAGAGAGGG + Intronic
905242147 1:36588268-36588290 CTCAGGGCCTGGCACACAGTAGG + Intergenic
905278114 1:36832252-36832274 CACAGTGTCTGGCACATAGTAGG + Intronic
905284955 1:36873191-36873213 CACAGGGCCTGGCACTCAGGTGG + Intronic
905349310 1:37333654-37333676 CACAGTGCCTGGCACACAGTCGG + Intergenic
905775204 1:40663874-40663896 CACAGTGCCTGGCACTCAGGAGG - Intronic
905861500 1:41355086-41355108 CACAGTGCCTGGCACACAGGAGG + Intergenic
906113356 1:43338976-43338998 CCCAGTGTCTGGCACACAGTAGG - Intronic
906212547 1:44020152-44020174 CTCAGGGCCTGGCACACAGTGGG - Intronic
906267679 1:44445904-44445926 CACAGTGTCTGGCACAGAGCAGG + Intronic
906542528 1:46598587-46598609 CACAGTGCCTGGCACACAGTAGG - Intronic
906575112 1:46881980-46882002 CACATGGTCTCACTCATAGGTGG + Intergenic
906632820 1:47386810-47386832 CACAGTGTCTAGCACAGAGTAGG + Intergenic
906687175 1:47770190-47770212 CACAGGGCCTGGGTCACAGGTGG + Intronic
906708948 1:47915104-47915126 AACAGGGCCTGGCACACAGTAGG + Intronic
906722751 1:48021201-48021223 CACATGTTCTCACTCACAGGTGG + Intergenic
906947267 1:50305708-50305730 CACAGGGTTTGGCAAACAGTAGG - Intergenic
907245566 1:53106251-53106273 CACGGGACCTCGCACATAGGTGG + Intronic
907274715 1:53310825-53310847 CACAGGGCCCAGCACAGAGGAGG - Intronic
907294426 1:53440376-53440398 CACAGGGCCTAGCACAAAGTGGG - Intergenic
907297321 1:53463534-53463556 CACAGGGTCTGGCACATAGTAGG + Intronic
907311684 1:53542426-53542448 CACAGGGGCTGGCACAGAGCGGG + Intronic
907337000 1:53706342-53706364 GACAGAGTCTGGCACACAGTAGG + Intronic
907366460 1:53964671-53964693 CACAGTGTCTGGCACACAAAAGG - Intronic
907460687 1:54603778-54603800 CACAGGGCCTAGCACAGAGTAGG + Intronic
907486782 1:54783509-54783531 AACAGTGTCTGGCACAGAGGAGG - Intronic
907675937 1:56518078-56518100 CACAGGGTCTGTCACAGAAGAGG + Intronic
907776117 1:57517093-57517115 CACAGGGTCAGGCATACAGTAGG + Intronic
907776138 1:57517429-57517451 CACAGTGTCTTCCACACAGTAGG + Intronic
907919935 1:58903032-58903054 CACAGTGCCTGGCACACAGTAGG + Intergenic
908202779 1:61814925-61814947 CACAGTGTCTGGCACAGAGTAGG - Intronic
910262140 1:85303225-85303247 CACATGGCCTGGCACACAGAAGG - Intergenic
910437379 1:87219155-87219177 TACAGGGTCTGACACACAGTAGG - Intergenic
911013462 1:93306542-93306564 CACAGTGCCTGGCACATAGGAGG - Intergenic
911128472 1:94364494-94364516 CACATGTTCTCACTCACAGGTGG - Intergenic
911685223 1:100768124-100768146 CACATGGTCTCACTCACAGATGG + Intergenic
911729006 1:101272276-101272298 CACATGTTCTCACTCACAGGTGG - Intergenic
911932983 1:103928274-103928296 CACATGTTCTCGCTCATAGGTGG - Intergenic
912632652 1:111259726-111259748 CACATGTTCTCACTCACAGGTGG + Intergenic
912746108 1:112247013-112247035 CATGGGGCCTGGCACACAGGAGG + Intergenic
912967897 1:114252140-114252162 CACAAGATCTGGCACACAGCAGG + Intergenic
913527695 1:119709730-119709752 CACAGGGCCTAGCCCATAGGAGG + Intronic
914174202 1:145260322-145260344 CACATGTTCTCACTCACAGGTGG + Intergenic
914413053 1:147450194-147450216 CACATGTTCTCACTCACAGGTGG + Intergenic
914436471 1:147664623-147664645 CAAAGGGCCTCACACACAGTAGG + Intronic
915478868 1:156171515-156171537 CACAGGATCTGGCACACAGTTGG - Intronic
915604929 1:156944495-156944517 CACAATGTCTGGCACACAGTAGG - Intronic
915678816 1:157559376-157559398 CACATGCTCTCACTCACAGGTGG - Intergenic
915735912 1:158084833-158084855 CACGGTGTCTGGCACACAGTAGG - Intronic
916446433 1:164876577-164876599 CACAGTGTCTGGGTCACAGGAGG - Intronic
916526936 1:165619325-165619347 CACATGTTCTCACTCACAGGTGG + Intergenic
917123140 1:171661840-171661862 CACAGTGTCAGGCACACAGAAGG - Intergenic
917291413 1:173476114-173476136 CACAGTGTCCAGCACACAGCAGG + Intergenic
917670892 1:177272424-177272446 CACAGTTTCTGGCACACAGTAGG - Intronic
917724406 1:177815262-177815284 CACAGAGTCTCACACTCAGAAGG - Intergenic
917815718 1:178708005-178708027 CACAGCCTCTGGCACACAGTAGG - Intergenic
918139902 1:181711418-181711440 AACAGGGTCTGGCACAAAGTAGG - Intronic
918545841 1:185682968-185682990 CACAGTGTCTCTCACACAGTGGG + Intergenic
918834718 1:189446707-189446729 CACATGTTCTCACTCACAGGTGG + Intergenic
919681467 1:200439524-200439546 CACAGTTTCTCGCACATAGTAGG + Intergenic
919801645 1:201357961-201357983 CACAGTGTCTAGCACATAGTTGG + Intergenic
919897620 1:202018909-202018931 CACAGCGCCTGGCACAGAGGAGG + Intergenic
919921766 1:202170234-202170256 CACAGAGTCCAGCACACAGAAGG - Intergenic
920360596 1:205413221-205413243 CACAGGGTCTTGCACATAGTAGG - Intronic
920550976 1:206860485-206860507 CACAGTGTCTTGCACATAGTAGG + Intergenic
921246800 1:213251815-213251837 CACAGTGCCTGGGACACAGGAGG - Intronic
921469518 1:215531974-215531996 CACAGTGCCTGGCACATAGGAGG - Intergenic
922518044 1:226223191-226223213 TACAGGGTCTAGCACATAGCAGG + Intergenic
923248388 1:232156334-232156356 CACATGCTCTCACTCACAGGTGG + Intergenic
923316530 1:232785735-232785757 CACATGTTCTCACTCACAGGTGG - Intergenic
923630524 1:235646670-235646692 CACGGCGTCTTGCACACAGCCGG + Intronic
923838568 1:237642625-237642647 CACAATTTCTGGCACACAGGAGG - Intronic
924174134 1:241372450-241372472 CACAGTGTCTGGCACACGAGAGG + Intergenic
924386058 1:243498578-243498600 CTCAGGGTCTCTCACACACTGGG + Intronic
1063519934 10:6732124-6732146 CACAGGGTCTCACCAACATGTGG - Intergenic
1064430754 10:15268066-15268088 CACAGGGCTTCCCACACAGCCGG - Intronic
1064849489 10:19694988-19695010 CACATGTTCTCACTCACAGGTGG + Intronic
1065414650 10:25471183-25471205 CACATGTTCTCACTCACAGGTGG - Intronic
1065992542 10:31027008-31027030 CACATGTTCTCACTCACAGGTGG + Intronic
1066079387 10:31915051-31915073 CACATGGTCTCACTCACATGTGG + Intronic
1066758675 10:38735765-38735787 CACAGGCTCTAGCACCCAGCAGG - Intergenic
1066805734 10:39250766-39250788 CACATGTTCTCACTCACAGGTGG - Intergenic
1067472847 10:46548869-46548891 CACAGTATGTGGCACACAGGAGG + Intergenic
1067513173 10:46911970-46911992 AACAGCATCTGGCACACAGGAGG - Intronic
1067649080 10:48139872-48139894 AACAGCATCTGGCACACAGGAGG + Intergenic
1067685669 10:48464977-48464999 CACAGGGTGCCTCCCACAGGAGG - Intronic
1068382479 10:56274597-56274619 CACAGGTTCTCACTCACAAGTGG - Intergenic
1068603659 10:58981563-58981585 CACAGTGCCTGGCACATAGGAGG + Intergenic
1069446707 10:68479456-68479478 CACAAGGTCTGGCACACAATTGG + Exonic
1069579299 10:69554587-69554609 TACTGGGTCTCCCACAGAGGTGG - Intergenic
1069747325 10:70724062-70724084 CACAGTGCCTGGCACACAGTAGG + Intronic
1069854837 10:71434388-71434410 CACAGTGCCTAGCACACAGTAGG + Intronic
1069928308 10:71866188-71866210 CACAGAGTCCCGCACACAGTAGG - Intergenic
1070189587 10:74099594-74099616 CTCAGGGTCTGGCACATAGTAGG + Intronic
1070491677 10:76982418-76982440 CACAGGGCCTGGCACTCAGGGGG + Intronic
1070649829 10:78227196-78227218 CACTGGGTCTCACACATAGAAGG - Intergenic
1070733577 10:78848398-78848420 CATAGGGTCTGGCACATAGTAGG - Intergenic
1071258624 10:83898170-83898192 CACAGGGCTTAGCACACAGGAGG + Intergenic
1071290507 10:84185567-84185589 CAAAGGGCCTGGCACACAGAGGG + Intergenic
1071573572 10:86710947-86710969 CACAGCGTCTGTCACACGGGAGG + Intronic
1071779465 10:88826913-88826935 CACAGCGTCTGGCACATAGTAGG + Intronic
1071904083 10:90153676-90153698 CACATGTTCTCACTCACAGGTGG - Intergenic
1072032578 10:91535542-91535564 CACATGTTCTCACTCACAGGTGG + Intergenic
1072323557 10:94274196-94274218 CCGAGGGTCTCCTACACAGGTGG - Intronic
1072474445 10:95746247-95746269 CACAGACTCTGGCACATAGGTGG - Intronic
1072631717 10:97151188-97151210 CACAGAGCCTGGCCCACAGGAGG + Intronic
1072743253 10:97922854-97922876 CTCAGTGCCTGGCACACAGGAGG + Intronic
1072765004 10:98088094-98088116 CACAGTGCCTGGCACACAGCAGG + Intergenic
1073393648 10:103200282-103200304 CCCAGGGTCTGACACACTGGGGG + Intergenic
1073453518 10:103623142-103623164 CACAGGGCCGGGCACACAGCTGG + Intronic
1074028156 10:109658253-109658275 CACATGTTCTCACTCACAGGTGG + Intergenic
1074077014 10:110137777-110137799 CACAGGGTCTGGCACACAGATGG - Intergenic
1074149322 10:110744231-110744253 CACAGTGCCTGGCACACAGTAGG + Intronic
1074543452 10:114384924-114384946 CAGAGTGTCTGGCACACAGGTGG - Intronic
1075227251 10:120640735-120640757 CCCAGGGCCTGGCACACAAGGGG + Intergenic
1075339620 10:121635833-121635855 AACAGTATCTGGCACACAGGAGG + Intergenic
1075516437 10:123112533-123112555 CAGGGGGGCTGGCACACAGGGGG - Intergenic
1075544357 10:123343231-123343253 CACAAGGTTTGGCACACAGCAGG - Intergenic
1075591393 10:123694050-123694072 CACAGGGCCTGGCACACAGTAGG - Exonic
1075735627 10:124662989-124663011 AACAGGGTCTCACACAGAGCAGG + Intronic
1075978028 10:126713750-126713772 CACAGCATCTGGCACACACGAGG + Intergenic
1076074863 10:127525249-127525271 CACAGTGACTGGCACACAGTAGG + Intergenic
1076131681 10:128017993-128018015 CACAGGGGCTGTGACACAGGAGG + Intronic
1076134853 10:128038573-128038595 CACAGGTTCTCACTCATAGGTGG + Intronic
1076364771 10:129914724-129914746 CCCAGGGTCTCCCATGCAGGTGG - Intronic
1077544102 11:3161548-3161570 CCCAGGGGCTGGCACACAGTAGG - Intronic
1077684140 11:4275131-4275153 CACAGGTTCTCACTCATAGGTGG + Intergenic
1077685901 11:4291634-4291656 CACAGGTTCTCACTCATAGGTGG - Intergenic
1077691050 11:4342794-4342816 CACAGGTTCTCACTCATAGGTGG - Intergenic
1077795846 11:5491176-5491198 CACAGTGTCTGGCACACAGTAGG + Intronic
1078368227 11:10723822-10723844 CACAAGGGCTGGCACACAGCAGG + Intergenic
1078556820 11:12334679-12334701 CACATGTTCTCACTCACAGGTGG - Intronic
1078740796 11:14064622-14064644 CACAGGGTGTGGCACACAGTAGG - Intronic
1079005018 11:16785447-16785469 CACAGGGCCTGGCACACAGTGGG - Intronic
1079610706 11:22429509-22429531 CACAGTGTCTGACACATAGGAGG - Intergenic
1079809536 11:24979906-24979928 CACAGTGTCTGGCACATAGCAGG + Intronic
1080291830 11:30679703-30679725 CACATGTTCTCACTCACAGGTGG + Intergenic
1080366460 11:31579701-31579723 CACAGGTTCTCACTCATAGGTGG + Intronic
1080515124 11:33013400-33013422 CACAGGTTCTCACTCATAGGTGG + Intergenic
1080615996 11:33945357-33945379 CACAGTGCCTGGCACACAGTAGG - Intergenic
1080752515 11:35164028-35164050 CACAGAGCCTGGCACACAGTAGG + Intronic
1081482969 11:43506187-43506209 CACTGTGTCTGGCACACAGCAGG - Intergenic
1081583049 11:44365618-44365640 CCCAGGGCCTGGCACACGGGAGG - Intergenic
1081670397 11:44939109-44939131 CACAGGGGCTGGCACGCAGTAGG - Exonic
1082135985 11:48549719-48549741 CACATGTTCTCACACATAGGTGG - Intergenic
1082654920 11:55842588-55842610 CACATGGTCTCACTCATAGGTGG - Intergenic
1083144740 11:60749844-60749866 CACAGTGCCTGGTACACAGGAGG - Intergenic
1083509827 11:63198486-63198508 CACATGGTCTCACTCATAGGTGG + Intronic
1083885421 11:65571159-65571181 CGCAGTGGCTGGCACACAGGAGG - Intronic
1083927765 11:65818900-65818922 CACAGTGCCTCCCACACAGTAGG + Intergenic
1083990385 11:66242872-66242894 CCCAGGGGCTGGGACACAGGTGG + Intronic
1084127387 11:67108870-67108892 CACAGGGACTCGAGCCCAGGAGG + Intergenic
1084185220 11:67467867-67467889 CACAGGGTCTCCTACACTGTAGG - Intronic
1084213735 11:67635626-67635648 CACAGGGGCTGGTGCACAGGGGG + Intronic
1084231199 11:67754623-67754645 AACAGGGTCCTGCACACAGTAGG - Intergenic
1084581606 11:70027603-70027625 AACAGGATCTCGCACACAGTAGG + Intergenic
1084855597 11:71983642-71983664 CACAGGGCCTGGCACACAGTAGG - Intronic
1084944113 11:72629666-72629688 CACAGGGCCTGGTGCACAGGAGG - Intronic
1085051934 11:73384370-73384392 CACAGAGTCTGGTATACAGGCGG - Intronic
1085141795 11:74151210-74151232 CACAGCGCCTGGCCCACAGGAGG + Intronic
1085284690 11:75351954-75351976 CACACGGACTCGCACGCGGGTGG - Intergenic
1085392888 11:76191480-76191502 CTCAGGGTCACGCACACAGCAGG - Intronic
1085419361 11:76342290-76342312 CACAGTGCCTGGCATACAGGAGG + Intergenic
1085446327 11:76603498-76603520 CCCAGGGTCTGGCATAAAGGGGG + Intergenic
1085450401 11:76628796-76628818 CCCAGGGCCTGACACACAGGTGG - Intergenic
1085479591 11:76810198-76810220 CACAGGGCCTGGCACACTGAGGG + Intergenic
1085517259 11:77118794-77118816 CACAGAGCCTGGCACACAGGTGG - Intronic
1085532123 11:77198127-77198149 CACAGGGCCTGGCACACAGCAGG - Intronic
1085548731 11:77346683-77346705 CACAGAGCCTGGCACACAGTTGG - Intronic
1085711350 11:78831640-78831662 CAGCGGGGCTGGCACACAGGAGG + Intronic
1085722015 11:78920917-78920939 CACAGAGCCCGGCACACAGGAGG - Intronic
1085753074 11:79178772-79178794 CACAGTATCTGGCACACAGTAGG + Intronic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1085786827 11:79459568-79459590 CACAGGGTTTGGCACACAGTAGG - Intergenic
1085850906 11:80118553-80118575 CACAGTGTCTGGCACATAGTAGG - Intergenic
1085996189 11:81917058-81917080 CACATGTTCTCACTCACAGGTGG + Intergenic
1086079131 11:82884526-82884548 GACAGGGTCTCACTCCCAGGTGG - Intronic
1086408774 11:86522605-86522627 CACATGTTCTCGCTCACATGTGG - Intronic
1086499390 11:87436598-87436620 CACAATGTCTGGCACACAGTAGG + Intergenic
1086916943 11:92541142-92541164 CACAGTGCCTAGCACACAGTAGG - Intronic
1087194828 11:95294828-95294850 CACAGGGCTTGGCACACAGGAGG - Intergenic
1087342671 11:96927998-96928020 CACATGTTCTCACTCACAGGTGG - Intergenic
1087373308 11:97313145-97313167 AACAGTGTCTGGCACACAGTAGG - Intergenic
1088158537 11:106839775-106839797 CACATGTTCTCACTCACAGGTGG + Intronic
1088369976 11:109078305-109078327 CACATGTTCTCGCTCATAGGTGG - Intergenic
1088403391 11:109445427-109445449 CACATGTTCTCACTCACAGGTGG + Intergenic
1088411946 11:109544074-109544096 CACATGTTCTCGCTCATAGGTGG + Intergenic
1088418056 11:109611603-109611625 CACAGGGTCCCCCACTCAGAAGG + Intergenic
1088426657 11:109712393-109712415 CACATGTTCTCACTCACAGGTGG + Intergenic
1089180052 11:116577301-116577323 CACAGTGTCTGGCATACAGCAGG + Intergenic
1089245071 11:117113236-117113258 CACATGTTCTCACTCACAGGTGG + Intergenic
1089732724 11:120529281-120529303 CACAGTGTCTGGCTTACAGGAGG + Intronic
1089770836 11:120801788-120801810 CACAGGATCTTGCACACAGGAGG - Intronic
1089825087 11:121267869-121267891 TACAGGGTCTGCAACACAGGAGG - Intergenic
1090030291 11:123200455-123200477 TGCAGTGTCTCGCACATAGGAGG + Intergenic
1090451778 11:126812535-126812557 CACGGTGTCTGGCACACAGTAGG + Intronic
1090606542 11:128427909-128427931 AACAGTGTCTTGCACACAGTAGG + Intergenic
1090724262 11:129509133-129509155 CACATGTTCTCACACATAGGTGG - Intergenic
1091012332 11:132014120-132014142 CACAGGTTCTCACACATATGTGG - Intronic
1091605220 12:1945799-1945821 CACATGTTCTCACTCACAGGTGG + Intergenic
1092291309 12:7160875-7160897 CACAGGGCCTGGCACACAGTAGG + Intergenic
1092799008 12:12144829-12144851 CACATGTTCTCACTCACAGGTGG + Intronic
1092947824 12:13473224-13473246 CACAGTGTCTTGTACACAGTGGG - Intergenic
1093348154 12:18065844-18065866 CACAGTGTCTGGCACATAGTTGG - Intergenic
1093660460 12:21750786-21750808 CACATGTTCTCACTCACAGGTGG + Intronic
1093787078 12:23205217-23205239 CACAGTGTCTAGAACACAGTAGG + Intergenic
1093822231 12:23635434-23635456 CACATGTTCTCACTCACAGGTGG + Intronic
1093873934 12:24326992-24327014 CACAGCGTCTCAGACACAGTAGG + Intergenic
1094444419 12:30514275-30514297 CACAGGGTCTGGCAGAGAGTAGG - Intergenic
1094646569 12:32330340-32330362 CACAAGTTCTCGCTCATAGGTGG + Intronic
1094711920 12:32973063-32973085 CACAGTGTCTAGCACAAAGTGGG - Intergenic
1094790056 12:33902384-33902406 CACATGTTCTCACTCACAGGTGG + Intergenic
1094838056 12:34331440-34331462 CCCGGGGCCTCGCACAGAGGCGG + Intergenic
1095292631 12:40493034-40493056 CACAGTGTCTGACACACAGATGG - Intronic
1096103975 12:48986111-48986133 CACAGGGTCTGGCATTCAGCTGG - Intergenic
1096393454 12:51247762-51247784 CACAGGGCCTAGCAAAGAGGAGG - Intronic
1096492086 12:52018564-52018586 AACAGAGCCTGGCACACAGGAGG + Intergenic
1096895033 12:54812796-54812818 CACATGTTCTCACTCACAGGTGG - Intergenic
1097181159 12:57172809-57172831 GACAGCGCCTGGCACACAGGAGG + Intronic
1097285074 12:57870865-57870887 CACAGTGCCTGGCACACAGTAGG + Intergenic
1097911773 12:64978010-64978032 CACATGTTCTCACTCACAGGTGG - Intergenic
1097997615 12:65906993-65907015 CACAGGTCCTGGCACACTGGAGG - Intronic
1098234118 12:68402094-68402116 CACAGGGTTTGGCACAGAGGAGG - Intergenic
1098307967 12:69120320-69120342 GACAGTGTCTGGCACACAGTAGG + Intergenic
1098314619 12:69180385-69180407 CACAGAGCCTGGCACACAGAAGG + Intergenic
1098699977 12:73611601-73611623 CACATGTTCTCACTCACAGGTGG + Intergenic
1099870832 12:88347233-88347255 CACATGTTCTCACTCACAGGCGG - Intergenic
1100057141 12:90525460-90525482 CACATGTTCTCACTCACAGGTGG - Intergenic
1100233496 12:92633941-92633963 CAAAGTGTCTGGCCCACAGGAGG + Intergenic
1100324277 12:93526252-93526274 CACAGTGGCACGCACTCAGGAGG - Intergenic
1100399128 12:94212550-94212572 CACATGTTCTCACTCACAGGTGG - Intronic
1101030101 12:100650003-100650025 CACAGTGTCTGGCACAAAGTAGG - Intergenic
1101315690 12:103627016-103627038 CACATGGTCTGACACACAGCAGG - Intronic
1101416794 12:104515556-104515578 AACAGTGTCTGGCACACAGCAGG - Intronic
1101493407 12:105231375-105231397 CACAGCGTCCAGCACATAGGTGG - Intronic
1101585227 12:106079914-106079936 CACAGGGTCAAGTACACAGTAGG + Intronic
1101631336 12:106498007-106498029 CACAGGGCCTGACACACAGCAGG + Intronic
1101738237 12:107479729-107479751 CACAGTGTCTGGCACAGAGAAGG - Intronic
1102121737 12:110447394-110447416 CACAGTGTCTTGCACATAGAAGG - Intronic
1102224855 12:111221001-111221023 CCCAGGGTCTGGCACACCGTTGG + Intronic
1102548268 12:113672177-113672199 CACTGGGTCTTGTACACAGTTGG - Intergenic
1102859752 12:116325553-116325575 CACAGGGCCTGGCACACAGTAGG - Intergenic
1103196610 12:119049000-119049022 AACAGTGTCTGGCACACAGTAGG - Intronic
1103448369 12:121009879-121009901 CACAGTGTCTAGCATACAGAAGG + Intronic
1103567777 12:121825469-121825491 CAGAGGGGCTGGCACACAGAGGG + Intronic
1103901321 12:124304898-124304920 CACAGGGCCCAGCACACAGTAGG + Intronic
1104364105 12:128161593-128161615 CACAGTGCCTGGCACACAGTAGG - Intergenic
1104963620 12:132499435-132499457 CCCAGGGCCTGGCACACAGCCGG - Intronic
1105277526 13:18944446-18944468 CCCAGGGTCTCCCTCACGGGGGG - Intergenic
1105497728 13:20945390-20945412 TACAGTGTCTGGCACACAGCAGG + Intergenic
1105539520 13:21303448-21303470 GACAGTGTCTGGCACACAGTAGG - Intergenic
1105818245 13:24056602-24056624 CACAGTGTCTAGCACATAGGAGG + Intronic
1106010690 13:25818793-25818815 CCTAGGATCTAGCACACAGGTGG - Intronic
1106030717 13:25999700-25999722 CATTGGGTCTCACACACAGTAGG + Intronic
1106229028 13:27807592-27807614 CCCAGGGCCTGGCACACAGTGGG + Intergenic
1106299869 13:28453815-28453837 CACAGGGTATAGTACACAGAAGG - Intronic
1106327408 13:28707316-28707338 CACATGTTCTCACTCACAGGTGG + Intronic
1106556057 13:30809607-30809629 CACAGTGCCTGGCACACAGTAGG - Intergenic
1106786235 13:33110573-33110595 CACAGGGCTTGGCACACACGCGG - Intronic
1106828684 13:33554394-33554416 CACAGGGTCACACAGACAGTAGG - Intergenic
1107423478 13:40271166-40271188 CACATGGCCTGGCACATAGGAGG - Intergenic
1107707488 13:43122220-43122242 CACAGGGCCTGGCACTCAGTGGG - Intergenic
1108574706 13:51781391-51781413 CACTGGGTCTGGCACTCAGTGGG - Intronic
1108681867 13:52787472-52787494 CACAGAGCCTGGCACACAGTGGG + Intergenic
1108714454 13:53065103-53065125 CACAGTGTCTAGCACACAGTAGG - Intergenic
1108804248 13:54134379-54134401 CACATGTTCTCACTCACAGGTGG + Intergenic
1109776593 13:67048792-67048814 CACACGGTTTTGCACACAGTAGG + Intronic
1110851848 13:80255055-80255077 CACATGTTCTCACTCACAGGTGG + Intergenic
1110904116 13:80863769-80863791 CACATGTTCTCACACATAGGTGG - Intergenic
1111749142 13:92305706-92305728 CACAGGGTCTTGAACACAATAGG - Intronic
1111771827 13:92606312-92606334 CACATGGTCTCACTCATAGGTGG - Intronic
1111815630 13:93149098-93149120 CACAGTGTCTGGCATATAGGAGG - Intergenic
1112373318 13:98815035-98815057 CACAGGGTCTCATACACACTGGG + Intronic
1112663271 13:101539277-101539299 CACATGTTCTCACTCACAGGTGG - Intronic
1112727279 13:102318855-102318877 GACAGGGTTTGGCACACAGTAGG + Intronic
1112867119 13:103918090-103918112 AACATGGTCTGGCACACAGTAGG - Intergenic
1112997032 13:105586785-105586807 CACATGTTCTCACTCACAGGTGG + Intergenic
1113061439 13:106326394-106326416 CACGGGATCTAGCACACAGTAGG - Intergenic
1113662930 13:112119327-112119349 CACAGTGACACGCACACAGCTGG + Intergenic
1113922323 13:113920052-113920074 CACAGGGTCCAGCACACACAGGG - Intergenic
1114447125 14:22797447-22797469 CACAGGGCCTGGAACACAGTGGG - Intronic
1114967123 14:27976182-27976204 CACATGTTCTCACTCACAGGTGG - Intergenic
1115046850 14:29005183-29005205 CACATGTTCTCACTCACAGGTGG + Intergenic
1115607317 14:35016753-35016775 CACAGTGTCTGGCACATAGTAGG + Intronic
1115704128 14:35980926-35980948 CACATGTTCTCACTCACAGGTGG - Intergenic
1116078508 14:40143753-40143775 CACATGTTCTCACTCACAGGTGG + Intergenic
1116275915 14:42830958-42830980 CACATGTTCTCACTCACAGGTGG + Intergenic
1116358324 14:43959997-43960019 CACATGTTCTCACTCACAGGTGG - Intergenic
1116404533 14:44551773-44551795 CACATGTTCTCACTCACAGGTGG - Intergenic
1116443043 14:44976539-44976561 CACAGTGCTTGGCACACAGGAGG + Intronic
1117616504 14:57539041-57539063 CACATGTTCTCACTCACAGGTGG - Intergenic
1117683573 14:58230161-58230183 AACAGGGTCTGGCACATAGGAGG - Intronic
1117747831 14:58889421-58889443 CACATGTTCTCACTCACAGGTGG + Intergenic
1117829944 14:59740198-59740220 CACAGTGCCTGGCACACCGGAGG + Intronic
1117934460 14:60887459-60887481 CACATGTTCTCACTCACAGGTGG - Intronic
1118713952 14:68546088-68546110 CACAAAGTCTGGCACACAGTGGG + Intronic
1119273068 14:73326777-73326799 CACAGTTTCTGGCACACAGTAGG - Intronic
1119423293 14:74520960-74520982 CACAGTGCCTGGCACATAGGTGG + Intronic
1119647083 14:76355757-76355779 CACAGGGTCCAACACATAGGAGG + Intronic
1119746792 14:77050367-77050389 GACAGGGTCTGGCACATAGTAGG + Intergenic
1120051491 14:79872087-79872109 TACAGTGTCTGGCACAGAGGAGG + Intergenic
1120763573 14:88307872-88307894 CACAGTGCCTGGCACACAGGAGG - Intronic
1120875747 14:89373670-89373692 CACAGTGCCTGGCACACAGTAGG + Intronic
1121120868 14:91375168-91375190 CCCAGGGCCTGGCACACAGCAGG + Intronic
1121245851 14:92460352-92460374 CACTGTGTCTGGCACACAGTAGG + Intronic
1121248459 14:92482082-92482104 CACGGGGCCTGGCACACAGCAGG - Intronic
1121291685 14:92780794-92780816 AACAGTGCCTGGCACACAGGAGG - Intergenic
1121293398 14:92795632-92795654 CCCAGAGTCTAGCACACAGTAGG - Intronic
1121720784 14:96107250-96107272 CACAGGGTCTAGCACACAGGAGG - Intergenic
1121736884 14:96224998-96225020 CACTGGGTGTGGCACAAAGGAGG - Intronic
1121935846 14:98017785-98017807 CACTGGGTCTCACACACAGTAGG - Intergenic
1122030412 14:98907865-98907887 CAGAGGGTCTCACACATAGTAGG - Intergenic
1122251206 14:100441228-100441250 CACAGGACCTGGCACACAGAAGG - Intronic
1122271799 14:100571611-100571633 CACAGAGACTGGCACACAGTAGG + Intronic
1122406082 14:101501923-101501945 CACAGGGCCTGGCACTCAGCTGG + Intergenic
1122406629 14:101504752-101504774 CAGAGGGTCTCGCAGACGGGGGG + Intergenic
1202901729 14_GL000194v1_random:47601-47623 CACATGTTCTCGCTCATAGGTGG - Intergenic
1202887885 14_KI270722v1_random:125542-125564 CACATGTTCTCGCTCATAGGCGG + Intergenic
1124511235 15:30327785-30327807 CACATGTTCTCACTCACAGGTGG - Intergenic
1124558077 15:30746252-30746274 CACAGTGCCTGGCACACAGCAGG - Intronic
1124614984 15:31235033-31235055 CTCAGAGTCTCTCACACAGTAGG - Intergenic
1124673169 15:31659397-31659419 CACAGTGCCTGGCACACAGCAGG + Intronic
1124731680 15:32202980-32203002 CACATGTTCTCACTCACAGGTGG + Intergenic
1125483447 15:40095908-40095930 CATAGGGTGTTGCACACAGTAGG - Intronic
1125748935 15:42015575-42015597 CATAGGGCCTGGCACACAGTAGG - Intronic
1126939714 15:53753787-53753809 CACAAGGTCTGGAACACAGTTGG - Intronic
1127070005 15:55279671-55279693 CACAGTGTCTCACATACAGCAGG + Intronic
1127228299 15:56959150-56959172 CACAGTGTCTGGCACACAGTAGG + Intronic
1127326401 15:57899486-57899508 CACATGTTCTCACTCACAGGTGG - Intergenic
1127371727 15:58347853-58347875 CACATGTTCTCACTCACAGGTGG + Intronic
1127959435 15:63879902-63879924 CACAGTGTCTGGCACATATGAGG + Intergenic
1128261000 15:66232763-66232785 CACAGGGCCTGGCACACGGTAGG - Intronic
1128404910 15:67326191-67326213 CACATGTTCTCACTCACAGGTGG - Intronic
1128568455 15:68716449-68716471 CGCAGGGTCTGGTACACAGCTGG - Intronic
1129607524 15:77032100-77032122 CACAGGGCCTTGCACACAGAAGG + Intronic
1129695130 15:77736363-77736385 CCCAGGGTCTGGCACACAGTAGG - Intronic
1129696872 15:77745644-77745666 CACAGGGTCTCGTCCGCAGCAGG - Intronic
1129704179 15:77785170-77785192 CTCAGGGCCTGGCACACAGTGGG + Intronic
1130337634 15:82970935-82970957 CACAGGCTCTGGAACACAGCTGG - Intronic
1130656061 15:85792949-85792971 CTCAGGGCCTGGCACACAGCAGG + Intronic
1130807552 15:87341991-87342013 AACAGTGTCTACCACACAGGAGG - Intergenic
1130830499 15:87593801-87593823 CACATGTTCTCACTCACAGGTGG + Intergenic
1131118429 15:89808456-89808478 CACAGTGCCTGGCACACAGTAGG + Intronic
1131170643 15:90175592-90175614 CATAGTGTCTGGCACATAGGAGG - Intronic
1131303976 15:91224791-91224813 CACATGTTCTGGCACACAGTAGG + Intronic
1132344018 15:101096756-101096778 CACACGGTCTCGCCCACATGTGG + Intergenic
1132391434 15:101441479-101441501 CACAGGGTCCTGCACTCAGCAGG + Intronic
1132698381 16:1211929-1211951 CACAGGCTGTGGCACAGAGGCGG - Exonic
1133047958 16:3099607-3099629 AACAGTGCCTGGCACACAGGAGG - Intergenic
1133438168 16:5797994-5798016 CCCAGGGCTTCGCACACAGTAGG - Intergenic
1133477226 16:6135070-6135092 CACATGTTCTCACTCACAGGTGG - Intronic
1133719003 16:8476820-8476842 CACAGTGCCTGGCACAGAGGAGG - Intergenic
1133743025 16:8665694-8665716 CACAGCGTCTGGCACACAGCAGG - Intergenic
1133827452 16:9291053-9291075 CATAGTGTATGGCACACAGGAGG - Intergenic
1133979096 16:10620253-10620275 CACAGAGACTGGCACACAGCAGG - Intergenic
1134051889 16:11143136-11143158 CACAGGGCGTGGCACACAGTAGG - Intronic
1134657384 16:15957451-15957473 CTCAGTGTCTCACACACAGTGGG + Intronic
1134673300 16:16071843-16071865 CCCGGGGTCTCGCAGACAAGCGG - Intronic
1134836035 16:17361581-17361603 CACAGGGCCTGGCACCTAGGAGG - Intronic
1135305019 16:21360308-21360330 CACAGGCACTGGCACCCAGGTGG + Intergenic
1135578393 16:23604437-23604459 CGCAGTGCCTGGCACACAGGAGG + Intronic
1135614233 16:23897049-23897071 CACAGGGTCTGGCACACAGTAGG - Intronic
1136072890 16:27799012-27799034 CCCAGGGCCTAGCACACAGTAGG - Intronic
1136124702 16:28169582-28169604 CCCAGGGTCTAGCACACAGTAGG - Intronic
1136160213 16:28415038-28415060 CCTAGGGGCTTGCACACAGGTGG - Intergenic
1136202875 16:28700252-28700274 CCTAGGGGCTTGCACACAGGTGG + Intronic
1136466881 16:30450456-30450478 CACAGTGGCTGGCACAGAGGAGG - Intergenic
1136628306 16:31474971-31474993 CACAGTGCCTGGCACACAGTAGG - Intronic
1137324629 16:47421903-47421925 CACATGTTCTCACTCACAGGTGG - Intronic
1137541626 16:49366513-49366535 CACAGGGTCTGCCACATAGAAGG - Intergenic
1137576212 16:49602017-49602039 CACTGGGTCTTGCATACAGTTGG + Intronic
1137633149 16:49962273-49962295 CACAGTGCCTAGCATACAGGAGG + Intergenic
1137645277 16:50067794-50067816 CTCAGTGTCTGGCACACAGTTGG - Intronic
1137732943 16:50702678-50702700 TACAGTGTCTGGCACACAGTAGG - Intronic
1137752367 16:50876055-50876077 AACAGGGTCTAGCACATAGTAGG + Intergenic
1138271758 16:55700532-55700554 CACAGTGTCTGGCGCACAGGAGG + Intronic
1138489737 16:57369780-57369802 CACAGTGCCTGGCACGCAGGAGG - Intergenic
1138561420 16:57802776-57802798 CACACGGGCTGGCACACACGAGG + Intronic
1138692358 16:58780103-58780125 CACATGTTCTCACTCACAGGTGG - Intergenic
1138714078 16:59001712-59001734 CACACGCTCTCACCCACAGGTGG - Intergenic
1138822534 16:60278958-60278980 CACAGGGCCTGGCACACAGCAGG + Intergenic
1139128872 16:64115760-64115782 CACATGTTCTCACTCACAGGTGG + Intergenic
1139256709 16:65549640-65549662 CACAGGGTCTCCCAGGCTGGAGG - Intergenic
1139520312 16:67479007-67479029 GACAGGGCCTGGCACACAGTTGG - Intronic
1139552667 16:67684047-67684069 GACAGTGACTGGCACACAGGAGG + Intronic
1139657324 16:68396945-68396967 CACAGTGCCTGGCACACAGTGGG - Intronic
1139776828 16:69321658-69321680 GACAGGGCCGGGCACACAGGAGG - Intronic
1139786243 16:69394580-69394602 CATAGGGTCTTGCACTCAGCAGG + Intronic
1140407175 16:74718661-74718683 AACAGTGTCTCGCACACAGGAGG + Intronic
1140477924 16:75248289-75248311 CACAGAGCCTCGCACATAGCAGG + Intronic
1141203454 16:81914610-81914632 CACAGGGCCCGGCACACAGTAGG - Intronic
1141569918 16:84928230-84928252 CACAAGCTCTTGCAAACAGGGGG - Intergenic
1141624558 16:85254411-85254433 CACAGCGCCTCGCACACAGCAGG + Intergenic
1141662364 16:85448337-85448359 CACAGGGTCTTGCACCCCAGGGG - Intergenic
1141764554 16:86049883-86049905 CACTGGGCCTGGCGCACAGGAGG - Intergenic
1141922402 16:87144886-87144908 CCCAGGGTCTTGCATACATGAGG - Intronic
1142734656 17:1888898-1888920 CACAGTGCCTGGCACACGGGAGG - Intronic
1143015929 17:3891185-3891207 CACAGAGTCTGGCAGACAGCAGG - Intronic
1143045859 17:4078787-4078809 CACAGGGCCTAACACACAGCAGG + Intronic
1143276694 17:5716741-5716763 TACAGGGTCAGGCACACAGTAGG + Intergenic
1143333463 17:6155356-6155378 CCCACGGTCACGCACACAGCTGG - Intergenic
1143478208 17:7214865-7214887 CACAGGGCCTAGCACGCAGTAGG + Intronic
1143653000 17:8275863-8275885 CACAGGGTCTTACATACAGCAGG - Intergenic
1143974669 17:10821088-10821110 CACAGGGTCTGGCACAGAGGAGG + Intergenic
1144004400 17:11087194-11087216 CAAAGGGGCTAGCACACCGGAGG + Intergenic
1144283575 17:13750735-13750757 CACAGGGTCTAGAAAAGAGGAGG + Intergenic
1144789252 17:17848281-17848303 CACAGGGTCTGGCAGACCTGGGG + Intronic
1144882038 17:18435318-18435340 CACAGTGTCAGGCACACAGTAGG + Intergenic
1144944815 17:18964464-18964486 CCCAGGGCCTGGCACACAGTAGG - Intronic
1144971110 17:19110508-19110530 CACAGGGCTTGGCACAGAGGAGG + Intergenic
1144991412 17:19236671-19236693 CACAGGGCTTGGCACAGAGGAGG + Intronic
1145150195 17:20509068-20509090 CACAGTGTCAGGCACACAGTAGG - Intergenic
1145199787 17:20933128-20933150 CACATGTTCTCACTCACAGGTGG - Intergenic
1145260841 17:21353615-21353637 CACAGTGCCTGGCACACAGTAGG - Intergenic
1145811578 17:27767449-27767471 CACAGTGTCTGACACACAGTAGG + Intronic
1146566525 17:33917739-33917761 CACAGTGTCTGACACAGAGGAGG - Intronic
1147653225 17:42073626-42073648 CACAGGGTCCAGCACACAGTGGG + Intergenic
1148358545 17:46993419-46993441 CATAGTGTCTGGCACATAGGAGG + Intronic
1148467003 17:47871099-47871121 AACAGTGTCTGGCACACAGTAGG + Intergenic
1148646146 17:49220499-49220521 CACAGGGTCTGGTATACAGCAGG - Intronic
1148697355 17:49568541-49568563 AACAGCGTCTGGCACACAGTAGG - Intergenic
1148750101 17:49940684-49940706 CACAGTGCCTGGCACACAGCAGG - Intergenic
1148773009 17:50077691-50077713 CTCAGGGGCTGGCACACAGTTGG - Intronic
1148905614 17:50909949-50909971 CACAGGGACTGGCACACAGGTGG - Intergenic
1149021401 17:51969688-51969710 CACAATCCCTCGCACACAGGGGG - Intronic
1149087259 17:52733029-52733051 CCTAGGGTCTGGTACACAGGTGG + Intergenic
1149851334 17:60037258-60037280 CACTGGGTGGCGCACACACGGGG - Intergenic
1150161851 17:62905114-62905136 CATAGAGTCTGGCACACAGTAGG + Intergenic
1151257712 17:72891955-72891977 CACAGTGTCCAGCACACAGTAGG + Intronic
1151492706 17:74442396-74442418 CACAGGGGCTGGCACAGAGCAGG - Intronic
1151680114 17:75618728-75618750 CACAGGCTCTAGCACACAGTAGG + Intergenic
1151877498 17:76875256-76875278 CACAGGGTCTATCCCACAAGAGG - Intronic
1152311616 17:79554659-79554681 CACAGGGTCTCACACATGGAAGG + Intergenic
1152348279 17:79768258-79768280 CACAGGGCCTGGCACACAGTGGG + Intergenic
1152386433 17:79977511-79977533 CACAGGGCCTGGCACGCAGCAGG + Intronic
1152594605 17:81232209-81232231 CCCAGGGCCTCCCACACAGCAGG - Intronic
1152661910 17:81546318-81546340 CAGAGGGTCTCACACACATGGGG + Intronic
1152926313 17:83089320-83089342 TACTGGGTCTCCCACACAGGTGG - Intronic
1152947216 17:83204578-83204600 CACAGGGACTCACGCACAGAGGG + Intergenic
1153046149 18:857219-857241 CTCAGGGTCTCAAACACAGATGG + Intergenic
1153220925 18:2860462-2860484 CACATGTTCTCACTCACAGGTGG - Intronic
1153407189 18:4753986-4754008 CACATGTTCTCACTCACAGGTGG - Intergenic
1153528459 18:6019991-6020013 CTTAGGGTCTGGCACACAGTAGG - Intronic
1153883031 18:9437142-9437164 CACAGGGTCTCCCATCCATGAGG - Intergenic
1154096421 18:11420204-11420226 CACATGTTCTCACACATAGGTGG + Intergenic
1155885600 18:31204895-31204917 CACAGTGCCTGGCACACAGCAGG - Intergenic
1156234770 18:35191804-35191826 CACAGCGTCTGGCACATAGTAGG - Intergenic
1156368827 18:36454257-36454279 CACAGGGGCACACACACAAGAGG + Intronic
1156589111 18:38465971-38465993 CACAGAGCCTCGCTCACAGGAGG + Intergenic
1156876661 18:42022360-42022382 CACATGTTCTCACTCACAGGTGG - Intronic
1157354838 18:46923295-46923317 CACATGTTCTCACTCACAGGTGG - Intronic
1157473377 18:48006815-48006837 CACAGCGTCTTGTCCACAGGGGG + Intergenic
1157699956 18:49756006-49756028 CACAGGGCCCAGCACACAGCAGG + Intergenic
1158591407 18:58781999-58782021 CACAGGGTTGTGCACACAAGAGG - Intergenic
1158742452 18:60158950-60158972 CACAGGGTCCCACATACAGTAGG - Intergenic
1158943018 18:62423653-62423675 CATAGTGTCTGGCACATAGGGGG + Intergenic
1159085808 18:63790554-63790576 CACATTGTCTCACACAAAGGAGG - Intronic
1159295569 18:66482657-66482679 CACATGTTCTCACTCACAGGTGG + Intergenic
1159327121 18:66936598-66936620 CACATGTTCTCACTCACAGGTGG - Intergenic
1159902313 18:74059133-74059155 CACATGGTCTCACTCATAGGTGG + Intergenic
1160737809 19:672290-672312 CCCAGGGCCTGGCACACAGTGGG + Intergenic
1160979052 19:1808064-1808086 CCCAGGGCCTGGCACACAAGAGG - Intronic
1161113820 19:2485564-2485586 CACAGGCCCTCGCACACAGTAGG - Intergenic
1161262588 19:3346007-3346029 AACAGGGCCTGGCACACAGCAGG + Intergenic
1161457768 19:4378102-4378124 CACAGGGCCTGGCACCCAGGTGG + Intronic
1161503984 19:4634180-4634202 AACAGGGCCTGGCACACAGTAGG - Intergenic
1161609644 19:5234742-5234764 CACAGTGCCTGGCACACAGTAGG - Intronic
1161631796 19:5360667-5360689 CACAGGGTCTGGCACACACAGGG - Intergenic
1161701423 19:5797999-5798021 CACAGGGTCTGGTACACAGGAGG + Intergenic
1162337223 19:10069364-10069386 AACAGGGTCTGGCACACAGTAGG - Intergenic
1162694348 19:12460927-12460949 CACATGTTCTCACTCACAGGTGG + Intronic
1162854172 19:13455472-13455494 AACAGAGTCTGGCACACAGCAGG - Intronic
1163598972 19:18236728-18236750 TACAGGGCCTGGCACACAGTGGG + Intronic
1164207255 19:23069259-23069281 CACTGGGTCTTGTACCCAGGTGG - Intergenic
1164210723 19:23095210-23095232 CACTGGGTCTTGTACCCAGGTGG + Intronic
1164282596 19:23781958-23781980 CACAGGGTGTTGCACCCAGGTGG + Intronic
1164350412 19:27330095-27330117 CACATGTTCTCACTCACAGGTGG + Intergenic
1164616056 19:29667383-29667405 CACAGTGTCTGGCACACAGTGGG + Intronic
1164714060 19:30378868-30378890 CACAGCGTTTTGCACACAGGAGG - Intronic
1165324820 19:35108462-35108484 CCCAGGGTCTGGCACATAGTAGG - Intergenic
1165725444 19:38109671-38109693 CACAGTGCCTGGCATACAGGAGG - Intronic
1165926793 19:39331398-39331420 CACAGGGCCCCGCACCCAGGAGG - Intronic
1165990966 19:39813446-39813468 CACAGGGCCTGGCACTCAGTAGG - Intergenic
1165995242 19:39839464-39839486 AGCAGGGTCTGGCACACAGTAGG - Intronic
1166067632 19:40369489-40369511 AACAGGGCCTGGCACACAGTAGG + Intronic
1166318941 19:42004483-42004505 CCCAGGGTCTGGCACACAGTTGG - Intronic
1166419143 19:42621366-42621388 CACAGGGCCTGGCATATAGGAGG - Intronic
1166521460 19:43483043-43483065 CCCAGGGTCTAGCACACAGTAGG + Intronic
1166835886 19:45667807-45667829 CACAGTCTCTCACTCACAGGTGG - Intergenic
1167062535 19:47158693-47158715 CACAGTGCCTTGCACACAGTAGG - Intronic
1167204241 19:48089458-48089480 GACAGTGCCTGGCACACAGGAGG + Intronic
1167268665 19:48496020-48496042 CTCAGGGCCTCGAACACAGGAGG + Intronic
1167460032 19:49620281-49620303 AACAGTGTCTGCCACACAGGTGG + Intronic
1167496782 19:49824098-49824120 CACAGGGCCTGGTACACAGGAGG + Intronic
1167573812 19:50307903-50307925 CACAGTGTCTGGCACATAGCAGG - Intronic
1167574424 19:50311133-50311155 AACAGTGTCTGGCACACAGCAGG + Intergenic
1167717943 19:51155893-51155915 AACAGTGTCTGGCACACAGTAGG - Intergenic
1167767329 19:51492183-51492205 CCCAGGAACTCACACACAGGAGG - Intronic
1167849886 19:52193389-52193411 AACAGAGTCTGGCACACAGGAGG - Intronic
1168180826 19:54662169-54662191 CACAGGGTCTGGGCCTCAGGAGG - Exonic
1168524286 19:57076320-57076342 CACAAGGTCTGGCAAACAGTAGG - Intergenic
1168714791 19:58520354-58520376 CACAGGGTCTAGCTCAGGGGAGG - Intronic
925168213 2:1732405-1732427 CACAGGGTCACACACACACGGGG + Intronic
925168219 2:1732438-1732460 CACAGGGTCACACACACACTGGG + Intronic
925390746 2:3492264-3492286 CCCAGTGTCCAGCACACAGGAGG + Intergenic
925518224 2:4708861-4708883 CACATGTTCTCACTCACAGGTGG + Intergenic
925724910 2:6863333-6863355 CACAGGGCCTGCCACACAGTAGG + Intronic
926060076 2:9799752-9799774 CTCAGTGTCTTGCACACAGTGGG + Intergenic
926590294 2:14733529-14733551 CATAGGGCCTAGCACACAGTAGG - Intergenic
926764787 2:16314802-16314824 CACAGGGCCTGGCACAAAGCAGG + Intergenic
927155202 2:20217328-20217350 CACAGGGCTACGCACACAGCAGG + Intronic
927284430 2:21341818-21341840 CACATGTTCTCACTCACAGGTGG + Intergenic
927385272 2:22525300-22525322 CACAGGGTCATGCATAGAGGAGG + Intergenic
927481419 2:23457082-23457104 CACAGGGCCTGGCACAAGGGAGG - Intronic
927515491 2:23669544-23669566 CACAGGGCCCGGCACACAGTGGG + Intronic
927579738 2:24231302-24231324 CCCAGTGTCTGACACACAGGAGG + Intronic
928201712 2:29251445-29251467 CTCAGGGTCTGGCACATAGTAGG - Intronic
928294291 2:30069472-30069494 CACAGGGTCAGGCACATTGGAGG - Intergenic
928486073 2:31733564-31733586 CACATGTTCTCACTCACAGGTGG + Intergenic
928766785 2:34655857-34655879 CACATGTTCTCACTCACAGGTGG + Intergenic
928923018 2:36545391-36545413 AACAGGGTCTGGCATACAGCAGG - Intronic
929317476 2:40497319-40497341 CACAGTGTCTGACACACAGTGGG - Intronic
929360468 2:41082772-41082794 CACATGTTCTCACTCACAGGTGG + Intergenic
929753149 2:44738517-44738539 CACAGTGCCTGGCACACAGAAGG - Intronic
930236850 2:48896843-48896865 CACAGAGTCTGGCACATAGTAGG - Intergenic
930451812 2:51550378-51550400 CACAGGTTCTCACTCACAGGTGG - Intergenic
930732267 2:54739542-54739564 CACAGGGTATGACACACAGGAGG - Intronic
930741489 2:54836695-54836717 CACAGGGCCTGGTACTCAGGAGG + Intronic
930879675 2:56257128-56257150 CATAGCATCTCGCACACAGAAGG - Intronic
931044139 2:58331027-58331049 CACATGTTCTCGCTCATAGGTGG + Intergenic
931633854 2:64324807-64324829 CACAGTGGCTGGCACACAGCGGG - Intergenic
932314911 2:70773603-70773625 CACTGGGTCTCTCCCACAAGTGG - Intergenic
933117446 2:78492631-78492653 CACATGTTCTCACTCACAGGTGG - Intergenic
933404927 2:81845820-81845842 CACATGTTCTCACTCACAGGTGG + Intergenic
933529591 2:83489999-83490021 CGCATGTTCTCGCTCACAGGTGG + Intergenic
933943263 2:87262910-87262932 CACCTGGCCTGGCACACAGGAGG - Intergenic
934930631 2:98419715-98419737 CACAGGGGCTGGCACAGAGTGGG + Intergenic
935411118 2:102763987-102764009 AACAGTGTCTAGCACACAGTAGG - Intronic
935575781 2:104708862-104708884 AACAGTGCCTGGCACACAGGAGG + Intergenic
935715776 2:105937810-105937832 CCCAGTGTCTGGCAGACAGGAGG - Intergenic
936336951 2:111598651-111598673 CACCTGGCCTGGCACACAGGAGG + Intergenic
936392538 2:112088077-112088099 CAAACGGGCACGCACACAGGAGG - Intronic
936756442 2:115718744-115718766 CACAGGGCCTAGCACATAGGAGG + Intronic
937098923 2:119253882-119253904 CCCAGGGCCTGGCACACAGTAGG + Intronic
937509976 2:122584342-122584364 CACATGTTCTCACTCACAGGTGG + Intergenic
937745291 2:125404898-125404920 CACATGTTCTCACTCACAGGTGG - Intergenic
937816473 2:126256393-126256415 CACAGGGTCCCACAGACAGGTGG - Intergenic
939035892 2:137130603-137130625 CACATGTTCTCACTCACAGGTGG - Intronic
939172607 2:138712846-138712868 CACACGGCCTAGCACACAGCAGG + Intronic
939256806 2:139754562-139754584 CACTGGGTCTCTCCCACAGTAGG - Intergenic
939491505 2:142882554-142882576 CACATGTTCTCACTCACAGGTGG - Intronic
940043440 2:149384954-149384976 CACATGTTCTCACTCACAGGTGG - Intronic
940134879 2:150424990-150425012 CACAGTGCCTGGCACACAGTGGG - Intergenic
940602412 2:155878543-155878565 CACATGTTCTCACTCACAGGTGG + Intergenic
941640317 2:167980634-167980656 CAGAGGCTCTCTCACACATGTGG + Intronic
941763497 2:169270522-169270544 CACATGTTCTCACTCACAGGTGG + Intronic
941962420 2:171266807-171266829 CACAGGGCCTGGTACACAGTAGG + Intergenic
942375043 2:175328109-175328131 AACAGTGTCTGGCACACAGTAGG + Intergenic
942399640 2:175588284-175588306 CACATGTTCTCACTCACAGGTGG - Intergenic
942557444 2:177186393-177186415 CACAGGGTCTCTCCCACAAGTGG + Intergenic
942611567 2:177747324-177747346 AACAGGGTCTTTCCCACAGGTGG - Intronic
942894415 2:181034443-181034465 CACAGGTTCTCACTCATAGGTGG + Intronic
943277238 2:185882913-185882935 CACATGTTCTCACTCACAGGTGG - Intergenic
944422101 2:199542305-199542327 CACAGGGTCTGGCACATAGTAGG + Intergenic
944614640 2:201448002-201448024 CACAGTGTGTGGCACACAGAAGG + Intronic
945121107 2:206458229-206458251 CACAGTGCCTGGCATACAGGAGG + Intronic
945344455 2:208696402-208696424 CACATGTTCTCACTCACAGGTGG - Intronic
946049941 2:216854263-216854285 CCCTGGGTCTAACACACAGGAGG - Intergenic
946359537 2:219210806-219210828 CACAGGGTACAGGACACAGGTGG - Exonic
946408819 2:219506543-219506565 CACAGGGCCTGGCACACAGCAGG - Intronic
946416198 2:219541021-219541043 CACAGGGTCACGCACAGGGTGGG + Exonic
946453405 2:219800435-219800457 CACAGGGCATGGCACAGAGGAGG - Intergenic
946667265 2:222064088-222064110 CACAGTGTCTGGCACATAGAGGG - Intergenic
947227152 2:227851567-227851589 CCCAGAGTCTTGCAAACAGGTGG - Intergenic
947744704 2:232501554-232501576 CACAGGGCCCCGTGCACAGGAGG - Intergenic
947786464 2:232825929-232825951 CACATGTTCTCACTCACAGGTGG - Intronic
947813480 2:233020555-233020577 CACAGGGCCCAGCACACAGTGGG - Intergenic
948373527 2:237505482-237505504 CCCAAGGTCCAGCACACAGGCGG - Intronic
948561977 2:238860363-238860385 GACAGTGTCTCAAACACAGGTGG - Intronic
948619973 2:239228150-239228172 CGTAGCGTCTGGCACACAGGAGG - Intronic
948869304 2:240790253-240790275 CCCAGGTTCTCACACCCAGGAGG + Intronic
1168798534 20:628671-628693 CACAGGGCCTGGCACACAGTAGG + Intergenic
1168966854 20:1903975-1903997 CACAGGGCCTGACACACAGTAGG + Intronic
1169104463 20:2982489-2982511 CACAGGGTCTCACACATAACAGG - Intronic
1169149689 20:3279631-3279653 CACAGTGCCTTGCCCACAGGAGG - Intronic
1169900504 20:10547824-10547846 TACTGGGTCTGGCACACAGATGG - Intronic
1169948272 20:11012950-11012972 CACAGCGTTTGGCACACAGTAGG + Intergenic
1170432178 20:16286127-16286149 CACAGTGTCTCGTACACAGTAGG + Intronic
1170695029 20:18650316-18650338 CACAGGGCCTCGCACTCAACTGG - Intronic
1170859647 20:20090759-20090781 AACAGGGTCTGGCACACAGTTGG + Intronic
1170900111 20:20454361-20454383 CTGAGGCTCTCGCACACAGCAGG + Intronic
1171103653 20:22411014-22411036 AACAGGGCCTGGCACACAGAAGG + Intergenic
1171279837 20:23887039-23887061 CACATGGTCTTGTACAAAGGTGG - Intergenic
1171437946 20:25138111-25138133 CACAGGGCCTGACACACAGCAGG - Intergenic
1171749147 20:29030822-29030844 CACAGGGCATCTCATACAGGGGG + Intergenic
1171820057 20:29827877-29827899 TACAGTGTCTGGCACACAGTAGG - Intergenic
1171991506 20:31700186-31700208 CACAGGGCCTGGCACATAGTTGG + Intronic
1172193691 20:33077666-33077688 AACAGGGCCTTGCACACAGCTGG - Intergenic
1172212975 20:33213949-33213971 CACAGTGCCTGGCACACAGTTGG + Intergenic
1172287844 20:33753497-33753519 CACAGTGTCTGGCACACAGCTGG - Intronic
1172524092 20:35587147-35587169 TACAGAGCCTGGCACACAGGAGG + Intergenic
1172624333 20:36338629-36338651 CCCAGGGCCTTGCACACAGGCGG - Intronic
1172832342 20:37846547-37846569 CACAGGGCCTGGCACACAGAAGG + Intronic
1172873608 20:38150878-38150900 CACAGGGCCGGGCACACAGAAGG + Intronic
1172877741 20:38176207-38176229 CACAGAGCCTGGCACACAGGAGG - Intergenic
1172892022 20:38272253-38272275 CACAGGGCCAGGCACACAGCAGG + Intronic
1172943083 20:38667823-38667845 CACAGGGTCTAGCATACATCAGG - Intergenic
1173163801 20:40671898-40671920 CACAGTGCCTGGCACAGAGGGGG - Intergenic
1173551635 20:43936951-43936973 CACAGTGCCTGGCACACAGCAGG - Intronic
1173659543 20:44723783-44723805 CACAGTGGTTGGCACACAGGCGG + Intronic
1173820399 20:46016021-46016043 CACAGAGCCTAGCACACAGTAGG - Intronic
1173839375 20:46147382-46147404 CTCAGGGCCTGGCACACAGTAGG - Intergenic
1173895705 20:46549238-46549260 CACAGGGTCTGGCACAGAAGAGG + Intronic
1174202930 20:48819807-48819829 CACAGTGCCTGGCACACAGTGGG + Intronic
1174275499 20:49400839-49400861 CACAGGGTCGGGCACAGAGTAGG + Intronic
1174287845 20:49484521-49484543 CACCGCGGCTCGCGCACAGGAGG - Intergenic
1174391850 20:50222681-50222703 CACAGGGCCCCGCACACAGTAGG + Intergenic
1174409333 20:50323405-50323427 CACAGCATCTGGCACACAGTAGG - Intergenic
1174431346 20:50472017-50472039 CACAGTGCCTTGCACACAGGAGG - Intergenic
1174485238 20:50856819-50856841 CAGAGGGCCTGGCACACAGTAGG - Intronic
1174520078 20:51122542-51122564 CGCAGTGTCTGGCACACAGTAGG + Intergenic
1174600996 20:51724696-51724718 CACAGGGCCTGGCACACAGCAGG + Intronic
1174829873 20:53802826-53802848 CACAGGGCCTGGTACCCAGGAGG - Intergenic
1175169983 20:57073600-57073622 CACAGTGCCCGGCACACAGGAGG + Intergenic
1175599450 20:60260905-60260927 GACAGGGCCTGGCACACAGCAGG + Intergenic
1175885405 20:62287876-62287898 CACAGGGCCTGGCAGGCAGGAGG - Intronic
1176621097 21:9062368-9062390 CACATGTTCTCGCTCATAGGTGG - Intergenic
1176710768 21:10147461-10147483 GACAGGGGCTCTCACAAAGGAGG - Intergenic
1177019054 21:15829446-15829468 GACAGGCTCTCTCACACAGTGGG - Intronic
1178093303 21:29187374-29187396 CACAGAGTCCTGCACGCAGGAGG - Intergenic
1178428510 21:32498780-32498802 AACAGGGTCCTGCACACAGTAGG + Intronic
1178494594 21:33076053-33076075 CAGAGGATCTCTCACAGAGGTGG - Intergenic
1178781048 21:35603728-35603750 CTCAGGGCCTCGCACACAGCAGG - Intronic
1178804177 21:35824669-35824691 CACAGGGGCTGGCACAGAGGGGG + Intronic
1178938604 21:36885784-36885806 CACAGGATCTTGCACACAGCTGG + Intronic
1179034180 21:37745724-37745746 CACAGGATCTGGCACATAGCAGG - Intronic
1179499345 21:41797349-41797371 CACAAGGACTTGCTCACAGGTGG + Intergenic
1179766751 21:43579670-43579692 CACAGGGTCAGGCACAAGGGTGG - Intronic
1179796414 21:43787198-43787220 CACAGTGTCAGGCACACAGTGGG - Intergenic
1180065767 21:45411452-45411474 CACGGCCTCTCGCACACAGAAGG - Intronic
1181463922 22:23100683-23100705 CAGAGGGCCTGGCACACAGTGGG + Intronic
1181570412 22:23765162-23765184 CATAGGGGCTGGCACACAGTAGG + Intronic
1181629461 22:24142987-24143009 CCCAGGGCCTGGCACACAGCAGG - Intronic
1181727367 22:24820757-24820779 CACAGAGTCTGGTACACAGTAGG - Intronic
1181765788 22:25090980-25091002 CACAGGGCCTGGAACACAGTAGG + Intronic
1181784892 22:25219872-25219894 CACAGTGCCTGGCACACAGTGGG + Intronic
1181991525 22:26840515-26840537 CTCTGGGCCTGGCACACAGGAGG - Intergenic
1182041235 22:27240243-27240265 CATAGGGCCTGGCACACAGCGGG + Intergenic
1182061465 22:27401228-27401250 CACAGGGACTGGCACACAGTGGG + Intergenic
1182878251 22:33711017-33711039 CACAGTGCCTCGTACACAGTAGG - Intronic
1182953047 22:34395706-34395728 CACAGGGCCTGGCACAGAGTAGG + Intergenic
1183027241 22:35074561-35074583 CACAGGGCTTTGCAAACAGGAGG - Intronic
1183071847 22:35401679-35401701 CGCAGTGCCTGGCACACAGGTGG - Intronic
1183231683 22:36586217-36586239 CACAGGATCCAGCACACAGAAGG + Intronic
1183262697 22:36806089-36806111 CACAGTGCCTGGCACACAGTGGG + Intronic
1183311863 22:37114279-37114301 AACAGTGCCTGGCACACAGGAGG + Intergenic
1183317872 22:37146740-37146762 CACAGGGCCGGGCACACAGTCGG + Intronic
1183489728 22:38109929-38109951 GAAAGGGTCCTGCACACAGGAGG + Intronic
1183608339 22:38880227-38880249 CACAGGGCCCTGCACACAGTAGG + Intergenic
1183674668 22:39292597-39292619 CACAGGGCCTGGCCCACAGCAGG - Intergenic
1183780580 22:39996121-39996143 CACAGGGCCAGGCACACAGTAGG - Intronic
1183782330 22:40006887-40006909 GACAGGGCCTGACACACAGGAGG - Intronic
1184191687 22:42899167-42899189 CACAGGGTCTACCGCACAGCAGG + Intronic
1184277592 22:43419024-43419046 GCCAGGGCCTAGCACACAGGAGG - Intronic
1184402772 22:44283404-44283426 CACAGTGCCTGGCACACAGCAGG + Intronic
1184406522 22:44303812-44303834 CTCAGGGTCTCCCACCCGGGTGG - Intronic
1184434041 22:44459273-44459295 CACAGGGTGTAGCTCAGAGGCGG - Intergenic
1184449353 22:44573793-44573815 CACAGGGCCTGGCACACAGTTGG + Intergenic
1185420568 22:50732125-50732147 CACAGGGTCTCTCCCCAAGGAGG + Intergenic
950193001 3:10991361-10991383 GACAGTGCCTGGCACACAGGTGG + Intergenic
950638172 3:14330660-14330682 CACAGGGTCCGGCACATAGTAGG - Intergenic
950954745 3:17040181-17040203 CTCAGGGTCTCACACATAGAGGG + Intronic
951277276 3:20703459-20703481 CACATGTTCTCACTCACAGGTGG - Intergenic
951751045 3:26036752-26036774 CACATGTTCTCACTCACAGGTGG - Intergenic
951924821 3:27897576-27897598 CACAGTGTCTCGAACATAGTAGG + Intergenic
952157155 3:30655781-30655803 CACAGTGGCTGGCACACAGTAGG + Intronic
952554172 3:34512937-34512959 CACATGTTCTCGCTCATAGGTGG - Intergenic
953061717 3:39433510-39433532 CACAGGGCATAGGACACAGGAGG - Intergenic
953107821 3:39902518-39902540 CACAGGGCCTGGCACACCGTGGG + Intronic
953115343 3:39987232-39987254 CACATGATCTCGCTCACAAGTGG - Intronic
953481495 3:43256119-43256141 CACAGTGCCTGGCACAGAGGGGG - Intergenic
953683128 3:45054598-45054620 CACAGTGTCTTGCACATAGCAGG + Intergenic
954075358 3:48174610-48174632 CACAGGGCCTGGCACATAGTAGG + Intronic
954147038 3:48639603-48639625 CACAGGGCAGGGCACACAGGAGG + Intronic
954369281 3:50161805-50161827 CACAGGGCCTGGTACACAGCAGG - Intronic
954649791 3:52154156-52154178 CGCAGGGCCTGGCACGCAGGAGG + Intronic
954710134 3:52501493-52501515 CACAGGGCCTAGCACATAGCAGG - Intronic
954793457 3:53149251-53149273 CACAGAGTAGAGCACACAGGAGG + Intergenic
955070903 3:55571815-55571837 CACAGGGCCTAGCACACAGTAGG + Intronic
955309061 3:57865964-57865986 CGCAGGGTCTGGCACATAGTTGG - Intronic
955605231 3:60694830-60694852 CACATGTTCTCACTCACAGGTGG + Intronic
955821820 3:62904438-62904460 CACAGTGCCTGGCACACAGTAGG - Intergenic
956041598 3:65150794-65150816 CACAGTGTCTGGCACAGAGAAGG + Intergenic
956951705 3:74291124-74291146 CACATGTTCTCACTCACAGGTGG - Intronic
957244270 3:77698032-77698054 CACATGTTCTCACTCACAGGTGG + Intergenic
957527905 3:81400954-81400976 CACATGTTCTCACTCACAGGTGG + Intergenic
959058991 3:101598829-101598851 CACATGTTCTCACTCACAGGTGG - Intergenic
960048491 3:113219359-113219381 CACAAGGCCTGGCACACAGTAGG - Intronic
960085576 3:113587486-113587508 CACAGAGCCTGGCACACAGCAGG - Intronic
960743629 3:120861961-120861983 CACATGGTCTCACTCATAGGTGG - Intergenic
960909801 3:122638024-122638046 CACATGTTCTCACTCACAGGTGG - Intronic
961475908 3:127146219-127146241 CATAGGGCCTGGCACACAGCAGG + Intergenic
961519924 3:127461196-127461218 CACAGGGCCTAGCACAGAGCAGG - Intergenic
961879820 3:130053634-130053656 AACAGGGTCCTGCACACAGTAGG - Intergenic
962198592 3:133383445-133383467 CACAGTGTCTGGCACACAATGGG - Intronic
962284844 3:134076965-134076987 CACAGGGCCTGGCACATAGTAGG - Intronic
962375337 3:134854177-134854199 CACAGGGCCTGGCTCACAGTAGG + Intronic
962645744 3:137437805-137437827 CACATGTTCTCACTCACAGGTGG + Intergenic
962991893 3:140585206-140585228 CACAGGGTATGACTCACAGGAGG - Intergenic
963328686 3:143890317-143890339 CACAGCGCCTGGCACTCAGGAGG + Intergenic
964236358 3:154534833-154534855 CACATGTTCTCACTCACAGGTGG - Intergenic
964702812 3:159587694-159587716 CACATGTTCTCACTCACAGGTGG - Intronic
965116828 3:164500950-164500972 CGCATGTTCTCGCTCACAGGTGG - Intergenic
966487801 3:180490605-180490627 CACATGTTCTCACTCACAGGAGG + Intergenic
966621164 3:181965797-181965819 CACAGTGTCTGGTACACAGTAGG + Intergenic
966653192 3:182324001-182324023 CACAGTGTCTGGTACACATGAGG + Intergenic
966657006 3:182370476-182370498 AACAGTGTCTGGCACACAGTAGG + Intergenic
966879881 3:184344279-184344301 ACAAGAGTCTCGCACACAGGTGG - Intronic
967172528 3:186833301-186833323 CATAGAGCCTGGCACACAGGAGG - Intergenic
967183965 3:186930151-186930173 CTCAGGGTCTCGCAGTCAGCCGG + Intergenic
967251290 3:187542009-187542031 CACATGTTCTCACTCACAGGTGG + Intergenic
967316389 3:188154752-188154774 CACAGGGTCTGCCACACACAGGG - Intronic
967383478 3:188886067-188886089 CACATGTTCTCACTCACAGGTGG + Exonic
968156848 3:196388209-196388231 CACATGATCTCACTCACAGGTGG + Intronic
968318380 3:197743400-197743422 CACAGTGTCTTGCACATAGGAGG + Intronic
968876260 4:3269376-3269398 CACAGGGTCTCCAAGTCAGGAGG + Intronic
968962020 4:3750507-3750529 CCCAGGGCCTGGCACACAGTAGG - Intergenic
969066403 4:4485262-4485284 CACTGTGTCTGGCACACAGTAGG + Intronic
969089636 4:4684241-4684263 CACAGGGCCTGGCACACAGCAGG - Intergenic
969171234 4:5365370-5365392 CACAGTGCCTGGCACACAGTAGG + Intronic
969439418 4:7208469-7208491 CACACAGTCTGGCACACAGGGGG - Intronic
969456231 4:7301236-7301258 CACAGTGACTGGCACATAGGTGG - Intronic
969484188 4:7462685-7462707 CTCTGGGTCTGGCACGCAGGAGG + Intronic
969586622 4:8097695-8097717 CACAGAGTCTAGCACACAGTAGG - Intronic
969823313 4:9736937-9736959 AACAGGGTCCTGCACACAGTAGG + Intergenic
970045860 4:11852475-11852497 CACATGTTCTCGCTCATAGGTGG + Intergenic
970264702 4:14268661-14268683 CACAGTGACTGGCACACAGTAGG - Intergenic
970436505 4:16040739-16040761 CACCGGGCCTGGCACACAGTGGG + Intronic
970680041 4:18496325-18496347 CACATGTTCTCGCTCATAGGTGG + Intergenic
970740883 4:19236349-19236371 CACAGTGGCTGGCACACAGTAGG + Intergenic
970750319 4:19352331-19352353 CACAGGGTCCCTCCCACAAGTGG + Intergenic
971775837 4:30963512-30963534 CACAGGGTCAGGCACAAAGGAGG - Intronic
972405598 4:38743679-38743701 CACAGGGTCTCCTACATAAGGGG + Intergenic
972742435 4:41900807-41900829 CACATGTTCTCACTCACAGGTGG - Intergenic
972743105 4:41908172-41908194 CACATGTTCTCACTCACAGGTGG + Intergenic
973315813 4:48758997-48759019 CGCATGTTCTCACACACAGGTGG + Intronic
974216447 4:58853445-58853467 CACATGTTCTCACTCACAGGTGG + Intergenic
975036785 4:69694326-69694348 CACATGTTCTCACTCACAGGTGG - Intergenic
975179760 4:71331497-71331519 CACATGTTCTCACTCACAGGTGG + Intronic
975228926 4:71908002-71908024 CACAAGGTGTGGCAAACAGGGGG + Intergenic
975587205 4:75962123-75962145 CACATGTTCTCACTCACAGGTGG - Intronic
975902586 4:79170180-79170202 CACAGGGTCCTGCACTCAGAAGG + Intergenic
976039482 4:80865835-80865857 CACATGTTCTCACTCACAGGTGG + Intronic
976131601 4:81890681-81890703 CACATGTTCTCACTCACAGGTGG + Intronic
976207570 4:82637473-82637495 CTCAGGGTCTGGCACATAGCAGG - Intronic
976729933 4:88251677-88251699 CACAGGGTCTGACACATAGTAGG - Intergenic
977108829 4:92924165-92924187 CACATGTTCTCACTCACAGGTGG + Intronic
977543558 4:98348190-98348212 CACATGTTCTCACTCACAGGTGG - Intronic
977988499 4:103414546-103414568 CACAGGATCTGGCACACAGTAGG + Intergenic
978269413 4:106870994-106871016 CACATGTTCTCACACATAGGTGG - Intergenic
978413556 4:108451561-108451583 CACATGTTCTCACTCACAGGTGG - Intergenic
978843522 4:113244840-113244862 CACATGGTCTCGATCATAGGTGG - Intronic
978932636 4:114334426-114334448 CACATGTTCTCACTCACAGGTGG - Intergenic
979518580 4:121640250-121640272 AACAGGGCCTGGCACAAAGGAGG - Intergenic
980076466 4:128298953-128298975 CACAGGGCCTGGCACCCAGCAGG - Intergenic
980115059 4:128671538-128671560 CACAGTGACTTGCACACAGTAGG - Intergenic
980165563 4:129222526-129222548 CACAGTGCCTGGCACACAGTAGG + Intergenic
981034765 4:140157910-140157932 CACAGTGTGTGGCACACAGAAGG - Intergenic
981255292 4:142654136-142654158 CACATGTTCTCACTCACAGGTGG + Intronic
982222297 4:153135325-153135347 CACAGTGTCTGGTACACAGTAGG - Intergenic
982752930 4:159183966-159183988 CACACGTTCTCACTCACAGGTGG - Intronic
982849151 4:160290102-160290124 CACTGGGCCTCGCATACAGTTGG - Intergenic
983282034 4:165693366-165693388 CACATGTTCTCACTCACAGGTGG + Intergenic
983493599 4:168417694-168417716 CACAGTGTCTAGCACAGAGTAGG + Intronic
983708393 4:170686394-170686416 CAAATGGTCTCACTCACAGGTGG - Intergenic
984405492 4:179324495-179324517 CACAGGGGCATGCAGACAGGAGG + Intergenic
984705462 4:182844488-182844510 CCCAGGGTCTGGAACTCAGGAGG - Intergenic
984895505 4:184536170-184536192 CACAGCATCTAGCACACAGTGGG - Intergenic
985171933 4:187159378-187159400 CACATGTTCTCGCTCACAAGTGG - Intergenic
985330215 4:188823702-188823724 CACAGGGATGCACACACAGGAGG + Intergenic
985330285 4:188824291-188824313 CACAGGGACGCACACACAGAGGG + Intergenic
985330348 4:188824733-188824755 CACAGGGGCGCGCACACACAGGG + Intergenic
985683206 5:1267750-1267772 CACATGTTCTCACTCACAGGTGG + Intronic
985826817 5:2198165-2198187 AACAGGGCCTGGCACACAGTAGG + Intergenic
985827338 5:2202515-2202537 CACATGTTCTCGCTCATAGGTGG + Intergenic
985933345 5:3076686-3076708 CACAGTGCCTGGCACACAGTAGG - Intergenic
987470845 5:18325453-18325475 CACTGGGTCTCTCCCACACGTGG + Intergenic
987593664 5:19967406-19967428 CACAGTGTCAAGCACACAGAAGG - Intronic
987795694 5:22625076-22625098 CACATGTTCTCACTCACAGGTGG + Intronic
988513667 5:31887020-31887042 CACTGGTTCTTGCACCCAGGCGG - Intronic
988726659 5:33933217-33933239 CACAGTGTCTAGCACAAAGTCGG + Intergenic
989302536 5:39911010-39911032 CACATGTTCTCACTCACAGGTGG + Intergenic
989694353 5:44182435-44182457 CACATGTTCTCACTCACAGGTGG - Intergenic
989813290 5:45704397-45704419 CACATGTTCTCGCTCATAGGTGG - Intergenic
990011070 5:50998802-50998824 CACAGAGCCTGGCACATAGGAGG + Intergenic
990346136 5:54873594-54873616 CACAGTGCCTGGCACACGGGTGG + Intergenic
990544554 5:56809520-56809542 TACAGTGTCTAGCACATAGGAGG + Intergenic
990714724 5:58624127-58624149 CACAGTGCCTGGCACACAGTAGG - Intronic
990947684 5:61266224-61266246 CACAGTGTCTGGCACAGAGTAGG + Intergenic
991441805 5:66658685-66658707 TACAGTGTCTGGCACCCAGGGGG - Intronic
991529405 5:67598559-67598581 CGCACGTTCTCGCTCACAGGTGG - Intergenic
991572078 5:68065605-68065627 CACATGTTCTCACTCACAGGTGG + Intergenic
991683630 5:69162284-69162306 CACACGGTCTCACTCATAGGTGG + Intergenic
991935031 5:71792844-71792866 CACATGTTCTCACTCACAGGTGG - Intergenic
992213798 5:74506356-74506378 CACAGGGCTTAGCACACAGTAGG - Intergenic
992337959 5:75792845-75792867 CACAGGTTCTCACTCATAGGTGG - Intergenic
993619803 5:90154723-90154745 CACAGGGTCTGGAACATAGTAGG - Intergenic
994472145 5:100220694-100220716 CACATGTTCTCGCTCATAGGTGG + Intergenic
995208077 5:109504996-109505018 CACATGTTCTCACTCACAGGTGG + Intergenic
995749337 5:115437972-115437994 CACATGTTCTCACTCACAGGTGG + Intergenic
995760712 5:115558517-115558539 CACAGTGTTTTACACACAGGAGG + Intergenic
996260359 5:121459326-121459348 GACAGTGTCTCAGACACAGGAGG + Intergenic
996464527 5:123784085-123784107 CACACTGTCTGGCACACAGAAGG - Intergenic
997117855 5:131145349-131145371 CACATGGTCTCACTCATAGGTGG + Intergenic
997252886 5:132404318-132404340 CACATGGTCTCACTCATAGGTGG + Intergenic
997390344 5:133510033-133510055 CACAGGGCCTAGCATACAGTGGG - Intronic
997657477 5:135566242-135566264 CACAGGGTCTGGCTCACAGTAGG + Intergenic
997658149 5:135570235-135570257 CACAGGGTCTGGCTCACAGTAGG + Intergenic
997660490 5:135585579-135585601 CACAGGGCCGGGCACACAGTAGG + Intergenic
997709249 5:135990235-135990257 CACAGGGCCTGGCACAGAGCAGG - Intergenic
997740451 5:136248390-136248412 CACAGGGTCTGGCACACAGCAGG + Intronic
997808324 5:136941877-136941899 CACATGTTCTCACTCACAGGTGG - Intergenic
998011788 5:138701166-138701188 CACAGGGCCTAGCACATAGTAGG - Intronic
998253900 5:140570477-140570499 CACAGAGCCTGGCACACAGGTGG - Intronic
999095839 5:148977499-148977521 CACAGCGCCTGGCACACAGCAGG - Intronic
999114766 5:149152987-149153009 CACAGTGTCTGGCACATAGTAGG + Intronic
999232349 5:150069212-150069234 GCCAGGGTCTGGCACACAGTGGG + Intronic
999905290 5:156134612-156134634 CACAGGTTCTCACTCATAGGTGG + Intronic
1000012152 5:157243142-157243164 CACAGTGTCTGGCACATGGGAGG - Intronic
1000152947 5:158520981-158521003 CACAGGGTCTGGCACCTAGTAGG + Intergenic
1000306831 5:160002385-160002407 CACAGTGTCTGGCACACAATAGG - Intergenic
1000335784 5:160240325-160240347 CACAGGGTATGGCACACAGAAGG + Intergenic
1000369700 5:160522961-160522983 CACAGAGCCTGGCACATAGGGGG - Intergenic
1000395944 5:160774888-160774910 CACAGAGTCTCCCTCACTGGAGG + Intronic
1000401744 5:160836013-160836035 CACATGTTCTCACTCACAGGTGG + Intronic
1000885835 5:166746325-166746347 CACAGTGTCTGGCACATAGTAGG - Intergenic
1001106010 5:168855113-168855135 CACAGTGCCTGGCACACAGGAGG + Intronic
1001141428 5:169147213-169147235 CAGAGGGTCTGGCACATAGCAGG + Intronic
1001228652 5:169967042-169967064 CACAGTGCCTGGCACATAGGAGG - Intronic
1001244844 5:170098370-170098392 GACAGTGTCTGGCACACAGTAGG - Intergenic
1001309939 5:170603437-170603459 CACAGGGCCTGCCACACAGCAGG - Intronic
1001419715 5:171577388-171577410 GCCAGGGTCTGGCACAGAGGGGG + Intergenic
1001551867 5:172608628-172608650 CACAGGGCCTAGCACATAGTAGG - Intergenic
1001586800 5:172838345-172838367 CACAGGGTCACACACTCAGAGGG - Intronic
1001702093 5:173714068-173714090 CACAGGGTCTGGCAGATAGGAGG - Intergenic
1001871597 5:175160788-175160810 CACAGTGTCTGGCACATAGTAGG - Intergenic
1001884105 5:175273192-175273214 CACATGTTCTCACTCACAGGTGG + Intergenic
1001896832 5:175389574-175389596 CACATGATCTCACTCACAGGTGG - Intergenic
1002047309 5:176549353-176549375 GACAGGCGCTGGCACACAGGTGG - Intronic
1002548067 5:179965275-179965297 CACAGTGCCTGGCACACAGTGGG + Intronic
1003244100 6:4369721-4369743 CACAGTGTCCTGCACACAGCAGG - Intergenic
1004937830 6:20525474-20525496 CACATGTTCTCACTCACAGGTGG + Intergenic
1005162746 6:22883457-22883479 CACAGGGTCCTGCACTCAGAGGG - Intergenic
1005289053 6:24360336-24360358 CACAGGGCCTTGCACACAGCAGG - Intergenic
1005904828 6:30253132-30253154 CGCATGGTCTCACTCACAGGTGG + Intergenic
1005997431 6:30939919-30939941 GACAGTGTCTGGCACACAGTAGG - Intergenic
1006864205 6:37195643-37195665 CACATGTTCTCACTCACAGGTGG + Intergenic
1007075394 6:39062991-39063013 CACAGGGCCTGGCATACAGTAGG - Intronic
1007262255 6:40571965-40571987 CACAGGGTCTCCAAAACAGGGGG + Intronic
1007546294 6:42697377-42697399 CCCAGGGACACCCACACAGGTGG - Exonic
1007632376 6:43279627-43279649 CACAAGGCCTGGCACACAGTTGG + Intronic
1007860762 6:44905941-44905963 CACATGTTCTCACTCACAGGTGG + Intronic
1010739126 6:79479246-79479268 CACATGTTCTCACTCACAGGTGG - Intergenic
1010938005 6:81884587-81884609 CACATGTTCTCACTCACAGGTGG - Intergenic
1010996830 6:82543237-82543259 CACATGTTCTCACTCACAGGTGG - Intergenic
1011249591 6:85357069-85357091 CACATGTTCTCACTCACAGGTGG + Intergenic
1011926036 6:92645844-92645866 CACATGTTCTCACTCACAGGTGG + Intergenic
1012990294 6:105919069-105919091 GACAGGGTCTGGCACACAGCAGG - Intergenic
1014195710 6:118555876-118555898 CACAGGTTCTCACTTACAGGTGG - Intronic
1015452708 6:133389480-133389502 CACAGGGCCTAGCACATAGCAGG + Intronic
1015737780 6:136419461-136419483 CACAGGGCCTGACACACAGTAGG + Intronic
1015941977 6:138461954-138461976 CTCAGGGCCTGGCACACAGTAGG - Intronic
1015971722 6:138749163-138749185 CACAGGTTCTGGGAAACAGGAGG + Intergenic
1016648614 6:146438652-146438674 CACAGTGGCTGGCACACAGCAGG - Intergenic
1016660001 6:146567311-146567333 CACATGTTCTCACTCACAGGTGG + Intergenic
1017121270 6:151026304-151026326 CACAGTCTCTCGCACAGAGCAGG - Intronic
1017773611 6:157662530-157662552 CACAGGGGCTCGCACACAGGAGG + Intronic
1017899635 6:158708350-158708372 CACTGGCTCTCGCTGACAGGAGG - Exonic
1020023856 7:4884588-4884610 CCTAGGGCCTGGCACACAGGTGG - Intergenic
1020314849 7:6898313-6898335 AACAGGGTCCTGCACACAGTAGG - Intergenic
1020520957 7:9186377-9186399 CACATGTTCTCACTCACAGGTGG - Intergenic
1020928322 7:14360229-14360251 CACATGTTCTCACTCACAGGTGG + Intronic
1020980580 7:15063366-15063388 CACATGTTCTCACTCACAGGTGG - Intergenic
1021282170 7:18734454-18734476 CACATGTTCTCACTCACAGGTGG - Intronic
1022221902 7:28321847-28321869 CACAGGGTCCCACACTCAGAAGG - Intronic
1022475306 7:30706090-30706112 CACAGGGTCTTGCACATAGTAGG - Intronic
1022957504 7:35394772-35394794 GACAGTGTCTTGCACACAGCAGG - Intergenic
1023031941 7:36097414-36097436 CACAGTGACTGGCACAAAGGAGG - Intergenic
1023498076 7:40818983-40819005 CACATGTTCTCGCTCATAGGTGG - Intronic
1024295404 7:47837707-47837729 CACAGTGTCTGGCACACAGTGGG + Intronic
1024956336 7:54925400-54925422 CACAGGTTCTCACTCATAGGTGG + Intergenic
1024976776 7:55120648-55120670 CACAGGGCCTGGCACACATCCGG + Intronic
1025959382 7:66206327-66206349 CCCAGAGTCTAGCACACAGTAGG + Intronic
1025963576 7:66246982-66247004 CACAGTGTCTGGCACATAGTAGG - Intronic
1026195677 7:68171432-68171454 TACAGGGCCTGGCACACAGCAGG - Intergenic
1026457432 7:70584858-70584880 CAGAAGCTCTGGCACACAGGTGG + Intronic
1026640553 7:72120859-72120881 CACAGGGCCTGGCCCAAAGGAGG + Intronic
1026737705 7:72959697-72959719 TCAAGGGTCTCGCAGACAGGTGG - Exonic
1026771387 7:73202748-73202770 CACAGTGCCTGGCACACATGGGG + Intergenic
1027012253 7:74756145-74756167 CACAGTGCCTGGCACACATGGGG + Intronic
1027075787 7:75189909-75189931 CACAGTGCCTGGCACACATGGGG - Intergenic
1027106029 7:75405371-75405393 TCAAGGGTCTCGCAGACAGGTGG + Exonic
1027170923 7:75871831-75871853 CACAAGGCCTGGCACACAGGAGG + Intronic
1028412437 7:90545158-90545180 CACAGGGTTAGGCACACAGAAGG + Intronic
1028647467 7:93114216-93114238 CACATGTTCTCACTCACAGGTGG + Intronic
1029288578 7:99484210-99484232 CTCAGCGTCTGGCACACAGAAGG - Intronic
1029647839 7:101869352-101869374 CACAGTGCCTGGCACACAGTAGG + Intronic
1029715713 7:102324378-102324400 CACTGGGTGTCGCAGACATGGGG + Intergenic
1030507169 7:110439113-110439135 CACATGTTCTCACTCACAGGTGG + Intergenic
1030913324 7:115280101-115280123 CACATGTTCTCCCTCACAGGTGG - Intergenic
1031105463 7:117536356-117536378 TACAGCGTCTGGCACATAGGAGG + Intronic
1031124471 7:117757445-117757467 AACAGGGTCTAGCACATAGCAGG + Intronic
1031396442 7:121279911-121279933 CAGAGGGTCCCTCAGACAGGAGG + Intronic
1031540167 7:122985956-122985978 CACATGTTCTCGCTCATAGGTGG - Intergenic
1032428919 7:131844724-131844746 CAAAGGGTCTAGCACATAGTAGG - Intergenic
1032610357 7:133405945-133405967 CACAGTGTCTGGCTCACAGTAGG - Intronic
1032738076 7:134711098-134711120 CACAGTGTCTGGCAAACAGGAGG + Intergenic
1032765791 7:134991659-134991681 CACTGGGTCTGGCACATAGTAGG + Intronic
1033250334 7:139753126-139753148 CACAGGGCTTTGCACACAGTGGG + Intronic
1033252489 7:139773084-139773106 CACAGGGCCTGACACACAGCAGG + Intronic
1033449912 7:141453467-141453489 CACAATGTCTAGCACACAGTAGG - Intronic
1034085741 7:148320715-148320737 CACAGGGTCTAGCACAGGTGGGG - Intronic
1034588170 7:152114777-152114799 CACAGAGCCTGGCATACAGGAGG - Intronic
1034588180 7:152114872-152114894 CACAGAGCCTGGCATACAGGAGG - Intronic
1034879560 7:154752946-154752968 CACAGGGCATGGCACACAGCAGG - Intronic
1034948559 7:155280733-155280755 CTCAGGGTCTCCCCCACAGCGGG + Intergenic
1035012310 7:155730099-155730121 CCCAGTGCCTGGCACACAGGCGG - Intronic
1036629896 8:10504385-10504407 CACATGTTCTCACTCACAGGTGG + Intergenic
1036740385 8:11355873-11355895 CACAGGGCCTGGCTCACAGGAGG + Intergenic
1037043728 8:14270963-14270985 CACATGTTCTCACTCACAGGTGG + Intronic
1037133494 8:15434760-15434782 CACATGTTCTCACTCACAGGTGG - Intronic
1037557130 8:20035552-20035574 CACAGGTTCTCACTCATAGGTGG - Intergenic
1038740294 8:30211280-30211302 CTCAGGGTCTGGCACACAGTAGG + Intergenic
1038809339 8:30824030-30824052 CACATGGTCTCATTCACAGGTGG - Intergenic
1040388407 8:46930009-46930031 CATAGACTCTCCCACACAGGTGG - Intergenic
1041412316 8:57570219-57570241 CACATGTTCTCGCTCATAGGTGG + Intergenic
1041780678 8:61575570-61575592 AACAGGGCCTAGCACACAGTGGG + Intronic
1042076875 8:65006054-65006076 CACATGTTCTCACTCACAGGTGG + Intergenic
1042119314 8:65467283-65467305 CACATGTTCTCACTCACAGGTGG + Intergenic
1042207308 8:66342361-66342383 CACAGGGCCTGCCAAACAGGAGG - Intergenic
1043084139 8:75806237-75806259 CACATTGTCTGGCACACAGTAGG - Intergenic
1043746177 8:83875843-83875865 CACAGGCTCTCACTCATAGGTGG - Intergenic
1043982169 8:86655733-86655755 CACAGTGTCTAACACACAGTAGG + Intronic
1045376713 8:101581678-101581700 CAAAGGGTCTGGCACATAGTAGG - Intronic
1045764218 8:105647602-105647624 CACATGTTCTCACTCACAGGTGG - Intronic
1046099675 8:109600176-109600198 CACAGGGTTTAGCACAGAGTAGG + Intronic
1046424602 8:114030379-114030401 CACATGTTCTCACTCACAGGTGG - Intergenic
1047226415 8:122958837-122958859 CACAGGGCCTAGCACAAAGAGGG - Intronic
1047404802 8:124576537-124576559 AACAGAGTCTAGCACAGAGGAGG + Intronic
1047432738 8:124806837-124806859 CACAGGGTCCTGCACTCAGAAGG + Intergenic
1047472891 8:125196428-125196450 CACATGTTCTCACCCACAGGTGG - Intronic
1047494483 8:125399762-125399784 CACAGTGCCTGGGACACAGGAGG + Intergenic
1047510137 8:125509598-125509620 CACAGGGTCCCACACTCAGAAGG + Intergenic
1047709917 8:127541192-127541214 CACATGTTCTCACTCACAGGTGG - Intergenic
1047710879 8:127551093-127551115 CAAAGGGCCTTGCACACAGTAGG + Intergenic
1047773079 8:128046235-128046257 GACAGTGTCTGGCACACAGTAGG - Intergenic
1047960555 8:130008550-130008572 CACGGGGCCTAGCACACAGGAGG + Intronic
1048054222 8:130848027-130848049 CAAAGTGTCTGGCACAGAGGAGG - Intronic
1048174884 8:132142635-132142657 CACAGAGCTTGGCACACAGGAGG + Intronic
1048252133 8:132875539-132875561 CACAGAGCCTTGCACACAGCAGG + Intronic
1048319096 8:133384746-133384768 CACAGTTTCTGGCACACAGTAGG + Intergenic
1048358499 8:133674104-133674126 CACAAGTTCTAGCACACAGTAGG + Intergenic
1048463440 8:134641652-134641674 CACAGGGTCTCGAACGGAGCTGG + Intronic
1048551726 8:135439305-135439327 CACAGAGTCTCTCACACAGTTGG - Intergenic
1048551730 8:135439363-135439385 CACAGAATCTCTCACACAGTTGG - Intergenic
1048551734 8:135439421-135439443 CACAGAATCTCTCACACAGTTGG - Intergenic
1048552155 8:135443345-135443367 CACAGAGTATCTCACACAGTAGG - Intergenic
1048566095 8:135599614-135599636 CCCAGTGTCTAGCACATAGGAGG - Intronic
1048614969 8:136064021-136064043 CACATGTTCTCGCTCATAGGTGG - Intergenic
1049022999 8:139970593-139970615 CCCAGGGTCTCACTCACAAGAGG + Intronic
1049106592 8:140617649-140617671 GACAGGGTCACGCCCACGGGTGG - Intronic
1049156701 8:141071626-141071648 CCCAGGGCCTTGCACACAGCAGG - Intergenic
1049537278 8:143188227-143188249 CACAAGGTCTCCCACACAGAGGG - Intergenic
1050302613 9:4274717-4274739 CACAGGGTCCTGCACTCAGAAGG - Intronic
1050578401 9:7024558-7024580 CACATGTTCTCACTCACAGGTGG - Intronic
1050752561 9:8957687-8957709 CACAGTGTCTCACACATAGTAGG + Intronic
1051222014 9:14858843-14858865 CACAGTGTCTGGCTCACAGTAGG - Intronic
1051741228 9:20254358-20254380 CACAGAGCCTGGCACACAGTGGG - Intergenic
1051808429 9:21023134-21023156 CACATGTTCTCCCTCACAGGTGG + Intronic
1051869594 9:21722096-21722118 CACATGTTCTCACTCACAGGTGG + Intergenic
1052141213 9:24987182-24987204 CACATGTTCTCACTCACAGGTGG + Intergenic
1052222880 9:26048620-26048642 CACATGTTCTCGCTCATAGGTGG + Intergenic
1052868340 9:33480157-33480179 CACAGGGCCTGTCACATAGGAGG + Intergenic
1053016837 9:34666608-34666630 CACAGTGCCTGACACACAGGTGG - Intergenic
1053222936 9:36326784-36326806 CACAGGGCCTGGCACATAGCAGG - Intergenic
1053306011 9:36985482-36985504 CATAGGGCCTGGCACACACGTGG - Intronic
1053545073 9:39014322-39014344 CATAGTGTCTGGCACACAGTTGG + Intergenic
1053647751 9:40133157-40133179 GACAGGGGCTCTCACAAAGGAGG - Intergenic
1053757980 9:41330686-41330708 GACAGGGGCTCTCACAAAGGAGG + Intergenic
1053809472 9:41837515-41837537 CATAGTGTCTGGCACACAGTTGG + Intergenic
1054536829 9:66243013-66243035 GACAGGGGCTCTCACAAAGGAGG + Intergenic
1054621120 9:67349913-67349935 CATAGTGTCTGGCACACAGTTGG - Intergenic
1055044883 9:71913303-71913325 CACAGGGCCTTGCACACGGAAGG - Intronic
1055508854 9:76974711-76974733 CACTAGGTCTTGCACACAGTTGG + Intergenic
1055617549 9:78088809-78088831 CACATGTTCTCACTCACAGGTGG + Intergenic
1055808599 9:80125089-80125111 CACGGGGTCTCACCCACAGCAGG - Intergenic
1056570576 9:87811084-87811106 CTCAGGACCTTGCACACAGGCGG - Intergenic
1057311611 9:93946566-93946588 CACAGTGTCTGGCACGCAGAGGG + Intergenic
1057567517 9:96178547-96178569 CACAGCTCCTGGCACACAGGGGG + Intergenic
1058081425 9:100704704-100704726 CACATGTTCTCACTCACAGGTGG - Intergenic
1058606443 9:106728574-106728596 CACAGGGACTGGCACACTGCAGG + Intergenic
1058814825 9:108673503-108673525 CACAGGGTTTTGCTCATAGGAGG + Intergenic
1059027104 9:110646664-110646686 CACATGTTCTCGCTCATAGGTGG + Intergenic
1059203666 9:112443294-112443316 CACAGTGTTTGGCACATAGGAGG - Intronic
1059461377 9:114432702-114432724 AACAGGGTCTGGCACATAGTAGG + Intronic
1059472007 9:114512384-114512406 CACAGTGCCTGGCACACAGTAGG - Intergenic
1059491427 9:114670831-114670853 CTCAGGGTCTGGCACAGAGTAGG - Intergenic
1059597293 9:115735152-115735174 CACATGATCTCACACACATGTGG - Intergenic
1059686636 9:116643994-116644016 CACAGTATCTGGCACACAGTAGG + Intronic
1059946615 9:119415065-119415087 CACAGGGTCTGGTACACAGCAGG - Intergenic
1059960705 9:119561699-119561721 CACATGTTCTCACTCACAGGTGG + Intergenic
1060108939 9:120892871-120892893 CACAGGGCCTTGCACAGAGCAGG + Intronic
1060254581 9:122015890-122015912 CACAGTGCCTGGCACACAGTAGG - Intronic
1060274695 9:122173502-122173524 CTCAGTGTCTTGCACACAGTAGG - Intronic
1060368330 9:123043226-123043248 AACAGGGTCTCTGACACAGGAGG + Intronic
1060390742 9:123274532-123274554 CACATGTTCTCACTCACAGGTGG - Intergenic
1060469777 9:123938800-123938822 CACAGGACCTGGCACACAGGAGG - Intergenic
1060477542 9:123997713-123997735 CACAGGGCCTGGCACACAACAGG + Intergenic
1060503379 9:124179925-124179947 CACAGTGTCTCTGCCACAGGAGG - Intergenic
1060527137 9:124327020-124327042 AACAGTGCCTCGCACACAGGAGG - Intronic
1061450023 9:130662769-130662791 GACAGGGTCTCGCTCATGGGAGG + Intergenic
1061614414 9:131770465-131770487 CACAGGGTCTGGCACAGAGCAGG - Intergenic
1061882268 9:133574322-133574344 GCCAGGGGCTGGCACACAGGGGG + Intronic
1061976678 9:134071703-134071725 CACAGGGCCTGGCACATAGTAGG - Intergenic
1062009970 9:134261677-134261699 CAGAGGGCCAGGCACACAGGAGG - Intergenic
1062501831 9:136855061-136855083 AACACGGTCTCGGACCCAGGCGG - Exonic
1202795528 9_KI270719v1_random:116449-116471 GACAGGGGCTCTCACAAAGGAGG - Intergenic
1203371724 Un_KI270442v1:313143-313165 TACAGTGTCTGGCACACAGTAGG - Intergenic
1186640454 X:11449698-11449720 CACAGGGGCTGGCACACTGCTGG + Intronic
1188102382 X:26105569-26105591 CACAGCTTCTGGCACATAGGAGG - Intergenic
1188570887 X:31583983-31584005 CACATGTTCTCACTCACAGGTGG - Intronic
1189585630 X:42458855-42458877 CATAGGGTCTGGGACACAGTAGG - Intergenic
1190257458 X:48774213-48774235 AACAGGGCCTGGCACACAGGTGG - Intergenic
1190879859 X:54484399-54484421 CACAGGGCCTAGCACATAGTAGG + Intronic
1191617528 X:63185368-63185390 CACATGTTCTCACTCACAGGTGG + Intergenic
1191618770 X:63193555-63193577 CACATGTTCTCACTCACAGGTGG - Intergenic
1192142431 X:68657375-68657397 CACAGTGTCTGGCACATAGTAGG - Intronic
1192268145 X:69554779-69554801 CACAGTGTCTGGCACATAGGAGG - Intergenic
1192270206 X:69571952-69571974 CACAGGGCCTGGCACACAGTGGG + Intergenic
1192589370 X:72347078-72347100 CACAGTGTGTGGCACACAGTAGG + Intronic
1193675736 X:84449873-84449895 CACATGTTCTCACTCACAGGTGG + Intronic
1195725392 X:107910226-107910248 CATATGATCTCGCACATAGGTGG - Intronic
1196345193 X:114647541-114647563 CACAGTGTCTGGCCCACAGTAGG - Intronic
1196594971 X:117534665-117534687 CACATGTTCTCGCTCATAGGTGG + Intergenic
1196947513 X:120842405-120842427 CACAGGGCCTGGCAAACGGGAGG + Intergenic
1197058211 X:122145930-122145952 CACATGTTCTCACTCACAGGTGG + Intergenic
1197275847 X:124478028-124478050 CACAGTGTATGGCACACAGTAGG + Intronic
1197312230 X:124918692-124918714 CACAGTGTCTGGCACAAAGTAGG - Intronic
1197406025 X:126051667-126051689 CACATGTTCTCGCTCATAGGTGG - Intergenic
1197626962 X:128813026-128813048 CACAGTGTCTGGAACACAGTAGG + Intergenic
1197865202 X:131009964-131009986 CACAGGGTTTGGCACACACCAGG - Intergenic
1198517970 X:137427696-137427718 CACTGGGTCTGGCACACAGTAGG - Intergenic
1199247486 X:145623862-145623884 CACAGTGTCTAGCACATAGTAGG + Intergenic
1199273436 X:145913239-145913261 CACATGTTCTCACTCACAGGTGG - Intergenic
1199307357 X:146281707-146281729 CACAGAGTCTAGCACATAGTAGG - Intergenic
1199562059 X:149173373-149173395 CACATGTTCTCACTCACAGGTGG - Intergenic
1199574240 X:149297993-149298015 CACAGAGCCTGGCACACAGTAGG + Intergenic
1199638133 X:149832956-149832978 CTCAGGGGCTGGCCCACAGGGGG - Intergenic
1199708245 X:150449726-150449748 CACAGGGCCAGGCACACAGAAGG - Intronic
1200182250 X:154157745-154157767 GACAGAGTCTGGCACACAGTGGG + Intronic
1200187904 X:154194859-154194881 GACAGAGTCTGGCACACAGTGGG + Intergenic
1200193554 X:154231999-154232021 GACAGAGTCTGGCACACAGTGGG + Intronic
1200199309 X:154269803-154269825 GACAGAGTCTGGCACACAGTGGG + Intronic
1201016118 Y:9603694-9603716 CACATGTTCTCACTCACAGGTGG - Intergenic
1201493749 Y:14570820-14570842 CACATGTTCTCACTCACAGGTGG - Intronic
1201506128 Y:14702387-14702409 CACATGTTCTCACTCACAGGTGG - Intronic
1202058851 Y:20864863-20864885 CACATGTTCTCACTCACAGGTGG - Intergenic