ID: 902724244

View in Genome Browser
Species Human (GRCh38)
Location 1:18324444-18324466
Sequence GGCTCATGACCGCCCCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 164}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902724244_902724254 16 Left 902724244 1:18324444-18324466 CCTGCAGGGGGCGGTCATGAGCC 0: 1
1: 0
2: 2
3: 13
4: 164
Right 902724254 1:18324483-18324505 TTTGACGGATCACCTGGTCCAGG 0: 1
1: 0
2: 0
3: 2
4: 55
902724244_902724255 19 Left 902724244 1:18324444-18324466 CCTGCAGGGGGCGGTCATGAGCC 0: 1
1: 0
2: 2
3: 13
4: 164
Right 902724255 1:18324486-18324508 GACGGATCACCTGGTCCAGGTGG 0: 1
1: 0
2: 2
3: 8
4: 138
902724244_902724256 24 Left 902724244 1:18324444-18324466 CCTGCAGGGGGCGGTCATGAGCC 0: 1
1: 0
2: 2
3: 13
4: 164
Right 902724256 1:18324491-18324513 ATCACCTGGTCCAGGTGGCCCGG 0: 1
1: 0
2: 1
3: 10
4: 208
902724244_902724249 1 Left 902724244 1:18324444-18324466 CCTGCAGGGGGCGGTCATGAGCC 0: 1
1: 0
2: 2
3: 13
4: 164
Right 902724249 1:18324468-18324490 CCATTTCCCAGAACCTTTGACGG 0: 1
1: 0
2: 1
3: 29
4: 210
902724244_902724252 10 Left 902724244 1:18324444-18324466 CCTGCAGGGGGCGGTCATGAGCC 0: 1
1: 0
2: 2
3: 13
4: 164
Right 902724252 1:18324477-18324499 AGAACCTTTGACGGATCACCTGG 0: 1
1: 0
2: 0
3: 0
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902724244 Original CRISPR GGCTCATGACCGCCCCCTGC AGG (reversed) Intronic
900179444 1:1304859-1304881 GGCACGTGACCACCCCCTCCGGG + Intronic
900606464 1:3525768-3525790 GGCCCATCACCACCCTCTGCAGG + Intronic
902724244 1:18324444-18324466 GGCTCATGACCGCCCCCTGCAGG - Intronic
903216010 1:21843610-21843632 GGCTCTTGACTTCCTCCTGCCGG - Intronic
904127111 1:28248648-28248670 GGTTCCTCAACGCCCCCTGCAGG - Intergenic
904478548 1:30779756-30779778 GGGTCAAGGGCGCCCCCTGCTGG + Intergenic
904899633 1:33846802-33846824 GGCTCATCACCTCTCCCTACTGG - Intronic
905110964 1:35594424-35594446 GGCTCAGGACCGCTCACCGCTGG + Exonic
905861905 1:41357659-41357681 GGCTCAGGCCTGGCCCCTGCAGG - Intergenic
914988700 1:152480248-152480270 GGCTCCTCTCCGCCCCCTGGTGG + Intergenic
915482110 1:156194058-156194080 CTGTCATTACCGCCCCCTGCAGG - Intronic
922912281 1:229227628-229227650 GGCTGATGCGCGCCCCCTGCCGG + Intergenic
923264679 1:232302825-232302847 GGCTCTTGTCTGGCCCCTGCTGG + Intergenic
1071759394 10:88583337-88583359 GCCTCCTTTCCGCCCCCTGCAGG - Intronic
1075223063 10:120601061-120601083 AGCTCAGGACCACCCCCTGGTGG + Intergenic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1078354614 11:10624637-10624659 GGATCATGAGCACCCTCTGCTGG - Intronic
1078618767 11:12888937-12888959 GGGGGATGATCGCCCCCTGCTGG + Intronic
1080395636 11:31887366-31887388 GGCTCAGGAGCGCCCTCTCCAGG + Intronic
1088250829 11:107859509-107859531 GGCTCACAACCGCCGCCTCCTGG - Intronic
1088745064 11:112798105-112798127 AGCACCTGACCGCCCCCTGCAGG - Intergenic
1090732450 11:129583433-129583455 GGCTCCTGGACGCCCCTTGCTGG - Intergenic
1092000023 12:5024241-5024263 GGCTCATGCCGGACCTCTGCAGG + Intergenic
1094872160 12:34604591-34604613 GGCAGATGTCCGCCCCCTGCGGG + Intergenic
1101253848 12:102958464-102958486 GACTTGTGACCGCCCCCTGAGGG - Exonic
1104087823 12:125492539-125492561 GGCTCCTGTCCGCCCTGTGCAGG - Intronic
1105375686 13:19842246-19842268 GGCTCTTGACAGCCCCCTGCGGG - Intronic
1105624881 13:22103183-22103205 GCCTCATGAGGGCCCCCTGCTGG + Intergenic
1107302758 13:38983213-38983235 GGCTTATGACCTCCCCCTCAGGG + Intronic
1113569669 13:111344933-111344955 GGCCCATAACCTCCCCCTGCAGG - Intergenic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1118821114 14:69346884-69346906 TGCTCCTCACCTCCCCCTGCTGG + Intronic
1119428190 14:74549673-74549695 GGCTCCTGGCAGCCCTCTGCTGG - Intronic
1119522056 14:75293958-75293980 CGCTCCTGACCAGCCCCTGCTGG + Intergenic
1122760303 14:104019995-104020017 AGCTAATGACTGCCTCCTGCTGG - Intronic
1123142541 14:106095004-106095026 GGTTAATGAGCGCCCCCTGGTGG + Intergenic
1123148055 14:106153539-106153561 GGGTCACGAGCGCCCCCTGGTGG + Intergenic
1123203645 14:106691887-106691909 GTGTCCTGAGCGCCCCCTGCAGG + Intergenic
1123214080 14:106790609-106790631 GGTTCCCGACCGCCCCCTGGTGG + Intergenic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202853644 14_GL000225v1_random:36965-36987 GGCTCAAGAAAGCCCCCTGTGGG - Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1123582638 15:21730650-21730672 GGTTCCTGAGCGCCCCCTGGTGG + Intergenic
1123582700 15:21730866-21730888 GTGTCATGAGCGCCCCCTGGTGG + Intergenic
1123619288 15:22173246-22173268 GGTTCCTGAGCGCCCCCTGGTGG + Intergenic
1123619350 15:22173462-22173484 GTGTCATGAGCGCCCCCTGGTGG + Intergenic
1124884887 15:33676192-33676214 GGCTCATGACCCCTTCCTTCAGG - Intronic
1126958550 15:53963128-53963150 GGCTAATGCTCGCCCTCTGCTGG - Intergenic
1127994482 15:64145160-64145182 GGGTCATGAGTGCACCCTGCAGG - Intronic
1128775004 15:70313571-70313593 GGCCCATGCCTGCCCCATGCTGG + Intergenic
1129195687 15:73964901-73964923 TGCTCTTGCCCGCCCCCTGGTGG + Intergenic
1129263630 15:74382552-74382574 GGGGCAGTACCGCCCCCTGCTGG - Intergenic
1131218530 15:90560780-90560802 GGCTCCTGATTGCACCCTGCAGG + Intronic
1132701282 16:1223143-1223165 GCCTCCTGACCAGCCCCTGCTGG - Intronic
1135555802 16:23435611-23435633 GGCTCCTGTCCGCCCCCTTCTGG + Intronic
1136275368 16:29176653-29176675 GGCTCATCAGCTCACCCTGCGGG + Intergenic
1137773838 16:51039830-51039852 GGCTCCTCACTGCCCCCAGCAGG - Intergenic
1139684285 16:68590662-68590684 GGCGCATCACCGCCCCCCGGTGG - Intergenic
1142079728 16:88142718-88142740 GGCTCATCAGCTCACCCTGCGGG + Intergenic
1142117238 16:88365474-88365496 GCCTCATGCCCGCCACCTCCTGG - Intergenic
1142221679 16:88857917-88857939 GACTCGAGACCGCTCCCTGCTGG + Intronic
1142287021 16:89175630-89175652 GGCTGATGAAGGCCCCATGCTGG + Intronic
1142496547 17:309410-309432 GGCTCCTGCCAGCCCCCTGCTGG + Intronic
1142496615 17:309584-309606 GGCTCCTGCCAGCCTCCTGCTGG + Intronic
1142496633 17:309638-309660 GGCTCCTGCCAGCCCCCTGCTGG + Intronic
1142496655 17:309697-309719 GGCTCCTGCCAGCCTCCTGCTGG + Intronic
1142709696 17:1716292-1716314 GGCCAATCACCGCCCACTGCTGG + Intergenic
1142875325 17:2848961-2848983 GGTACATCAGCGCCCCCTGCTGG - Intronic
1147949351 17:44098333-44098355 GGCTCTTGGCCGCCTCCTGGTGG + Intronic
1148838986 17:50482636-50482658 GGGTACTGAGCGCCCCCTGCGGG - Exonic
1151705424 17:75764725-75764747 GGCTCAAGCCCGCCCTCTGGGGG - Intronic
1160340811 18:78087347-78087369 GGCTCATGACAGCCCAGTTCAGG - Intergenic
1160662816 19:308925-308947 GGCTCCTGACCCCTCCCCGCAGG - Exonic
1160901340 19:1430224-1430246 GGCTATGGACCGCCCCCTGCAGG + Exonic
1163470891 19:17496427-17496449 TGCTCATGGGCTCCCCCTGCAGG - Intronic
1163529066 19:17839092-17839114 TGCTCATTAAAGCCCCCTGCAGG - Intronic
1164645795 19:29858181-29858203 GGCTCAGAACTGCCACCTGCTGG - Intergenic
1167051140 19:47079486-47079508 GACTGAGGACTGCCCCCTGCTGG - Intronic
1167155382 19:47735373-47735395 GCCTCATGGCCTCCTCCTGCTGG - Intronic
1167684848 19:50949860-50949882 TGCTCACGGCCGCCCACTGCAGG - Exonic
927210607 2:20636926-20636948 GGCTTAAGACCCTCCCCTGCTGG - Intronic
930023360 2:47014698-47014720 GGCTCACGTCAGCCCCCAGCAGG + Intronic
932793481 2:74675272-74675294 AGCTGATGGCCACCCCCTGCTGG + Exonic
937096601 2:119239676-119239698 GGCTCAGGCCCACCTCCTGCAGG + Intronic
945977728 2:216283714-216283736 GGCTCAGCAGCTCCCCCTGCAGG + Exonic
948953416 2:241270085-241270107 GGCTCATCACAGCTCCGTGCTGG - Intronic
1171388178 20:24784270-24784292 GGCTCAGGACCTCCTCCTGGTGG - Intergenic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171906134 20:30900590-30900612 GGCTCATGAAAGCCCCATGTGGG + Intergenic
1172284578 20:33731917-33731939 GGCTCCTGGGCGCCCCCTGGCGG + Exonic
1172693899 20:36808710-36808732 GCCTCAGGAGCGCCCTCTGCTGG + Exonic
1173503754 20:43571493-43571515 AGCTCAGGCCCTCCCCCTGCCGG - Intronic
1173872120 20:46348683-46348705 GGCTAGTCACCGCCCCCTCCTGG + Intronic
1174175526 20:48642216-48642238 GGCTCATGACTGGCCCCTTGAGG + Exonic
1174273243 20:49384691-49384713 TGCCCACGAGCGCCCCCTGCAGG - Intronic
1174386341 20:50190446-50190468 GGCCCCGGCCCGCCCCCTGCTGG - Intergenic
1174531825 20:51220386-51220408 GGCTCAGGCGCGCCACCTGCAGG - Intergenic
1174576603 20:51542126-51542148 TGCTCATGACTGCTCCCTGAGGG - Intronic
1175943794 20:62549711-62549733 GGCTCAGGAGCTCCCCCTTCCGG - Intergenic
1178092100 21:29174921-29174943 GGCTGATGACTGCCCTGTGCTGG + Exonic
1179718207 21:43300972-43300994 CGCTCAGGACAGGCCCCTGCTGG + Intergenic
1179830126 21:43991503-43991525 GGCTCCTGACCGGCCTCAGCAGG + Intergenic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180414305 22:12694068-12694090 GGCTCACGAAAGCCCCCTGAGGG + Intergenic
1181670550 22:24423872-24423894 CGCTCACGGGCGCCCCCTGCAGG - Intronic
1182311663 22:29412938-29412960 GGTGCAAGAGCGCCCCCTGCTGG + Intronic
1182688673 22:32140897-32140919 GGTGCAAGAGCGCCCCCTGCTGG - Intergenic
950124802 3:10504707-10504729 GGCTCCTCCCTGCCCCCTGCAGG - Intronic
960974487 3:123161371-123161393 AGCCCTTGACCGCCTCCTGCTGG - Exonic
962575591 3:136752396-136752418 GGGTCCGGACCGCCCTCTGCTGG + Intronic
963071978 3:141311929-141311951 GGCTCACGAACGACCCCTGGAGG - Intergenic
969631709 4:8342890-8342912 GGCTCAGGAGGGCCCCCTGGAGG + Intergenic
970146994 4:13046424-13046446 GGCTGCTGACTGCCCACTGCTGG + Intergenic
972640050 4:40917079-40917101 GGCTCATTACTGCCACCTGTGGG + Intronic
972804975 4:42519998-42520020 AGCTCATGATCGCCATCTGCTGG + Intronic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985574835 5:669259-669281 GGCTCACCAGCGCCCCCTGGGGG - Intronic
989631249 5:43484398-43484420 GGCTCCTCACCGCCCCCTTGGGG + Intergenic
998261494 5:140635161-140635183 GGCTCATCACTGCCCCCTGCGGG + Intergenic
1002529701 5:179836853-179836875 CGCTCCTGACCCCTCCCTGCAGG + Exonic
1005993848 6:30920182-30920204 GGACCATGACCTCCCTCTGCGGG + Exonic
1019664983 7:2247326-2247348 CGCTCAGGCCTGCCCCCTGCAGG - Intronic
1020796788 7:12686807-12686829 GGCTCCTGCGCGCCCCCTACAGG + Intergenic
1023093528 7:36638313-36638335 GGCTGTTGACAGCCTCCTGCTGG - Intronic
1024088612 7:45917757-45917779 GGCTCAGGTCTGCCCCCTGCCGG - Intronic
1024992892 7:55250394-55250416 GACTCAGGACAGCCCCCTGGAGG - Intronic
1025139193 7:56448488-56448510 GGATCCTGACCCCGCCCTGCAGG + Intergenic
1026906891 7:74068006-74068028 GGCTCCTTACCGCCACCTGGTGG - Intronic
1029926871 7:104328312-104328334 GGCTCATGTCCACCCCTTGATGG + Intergenic
1030033231 7:105388251-105388273 GGCTCCGGCCCGCCCGCTGCGGG - Intronic
1033726825 7:144127897-144127919 GGCCCTTGGTCGCCCCCTGCTGG + Intergenic
1034468937 7:151245617-151245639 GGCCCATGGGCGCCCCCTGGTGG + Exonic
1034967288 7:155399155-155399177 CGCTCACTGCCGCCCCCTGCAGG + Intergenic
1036455718 8:8905385-8905407 GGCTCCTGACAGCCCACTACTGG - Intergenic
1036772630 8:11589634-11589656 GACCCATTACCGCCACCTGCTGG + Intergenic
1048039528 8:130712231-130712253 TGCTCATGACCCCACGCTGCAGG + Intergenic
1048986421 8:139737442-139737464 GGCTGATGACCCCCGCCTGAAGG - Intronic
1049510707 8:143025432-143025454 GCCCCAGGACCGCCCCCTTCAGG + Intergenic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1057147130 9:92765502-92765524 GGCCCCTGGGCGCCCCCTGCTGG - Intergenic
1057753451 9:97810448-97810470 GGCTCATAACTGCCCTGTGCAGG - Intergenic
1060005733 9:119997892-119997914 GGCTCATGATAGCCCTCTTCTGG + Intergenic
1060539423 9:124419727-124419749 GGCTCTTGGTCGCCCTCTGCTGG - Intergenic
1062497846 9:136839981-136840003 TGCTCCTGGCAGCCCCCTGCAGG + Intronic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1196031593 X:111099004-111099026 GGCCCTTTTCCGCCCCCTGCTGG - Intronic
1200923009 Y:8629757-8629779 GGCTCATGACTGCCCTCTCTGGG - Intergenic
1201175736 Y:11307522-11307544 GGCTCATGAAAGCCCCTTGTGGG - Intergenic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic
1202128496 Y:21589311-21589333 GGCTCATGTCTGCCCTCTCCTGG - Intergenic