ID: 902724491

View in Genome Browser
Species Human (GRCh38)
Location 1:18325746-18325768
Sequence CTGGGAAAACAGATGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 491}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902724491 Original CRISPR CTGGGAAAACAGATGGAGAC AGG (reversed) Intronic
900927799 1:5717127-5717149 CTGGGAGAGCAGATGCAGGCTGG + Intergenic
901140654 1:7027137-7027159 GTGGGAAAACAGTTGAAGAAGGG + Intronic
902174049 1:14636088-14636110 CTGGGAAAAGAGTTGAAGAGAGG + Intronic
902724491 1:18325746-18325768 CTGGGAAAACAGATGGAGACAGG - Intronic
902772399 1:18652899-18652921 CTGGGAAAACAGATACCCACGGG - Intronic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
903224945 1:21889214-21889236 CAGGGAACTGAGATGGAGACAGG + Intronic
903912996 1:26742226-26742248 CTGGGAAAACAGAAGTAAAATGG - Intronic
904810004 1:33157276-33157298 CCTGGGAAACAGAGGGAGACTGG + Intronic
905333077 1:37221541-37221563 TTGGCAAAATGGATGGAGACTGG + Intergenic
905489328 1:38331423-38331445 CTGGGAGCACTGATGCAGACAGG + Intergenic
906929634 1:50156439-50156461 CTGGGCCAACAGATGGATAAAGG + Intronic
906976650 1:50581567-50581589 CTGGGAAGACATATGTAGAATGG + Intronic
907695345 1:56721073-56721095 CTGTGAATACAAAAGGAGACTGG - Intronic
907990108 1:59572586-59572608 CTAGGAAACCAGAAGAAGACTGG + Intronic
908306149 1:62819281-62819303 CTGGGAAAAAAGCAGGAGATTGG + Exonic
908662972 1:66457145-66457167 CTGGGAAAACTGGTGAAGACTGG - Intergenic
908671075 1:66548321-66548343 GTGGGAAAGCTGATGGAGATTGG + Intronic
908696514 1:66848732-66848754 CTGGGAACACTGATGGGCACAGG + Intronic
909448192 1:75770776-75770798 AGGGGACAACAGAGGGAGACAGG - Intronic
910239365 1:85069766-85069788 CTGGGATAGCATATGGAGAAGGG + Intronic
911177413 1:94830970-94830992 CTGAGAAAACTGATGCAGAGAGG + Intronic
911370307 1:96988086-96988108 CTGGGAACACAGATGGGGAAGGG - Intergenic
911540831 1:99156356-99156378 CAAGGAGAACAGATGGACACAGG - Intergenic
911775016 1:101797982-101798004 CTGGGCATAGAGATGGAGATCGG + Intergenic
913062410 1:115220444-115220466 GAGGGGAAACAAATGGAGACTGG + Intergenic
914398884 1:147297267-147297289 CTGGGAAAGTAGAATGAGACAGG + Intergenic
915218038 1:154352932-154352954 CTGGGAGCACAGATGGAAGCGGG - Intergenic
918484531 1:185015301-185015323 CTGGAAATACAGATGCAGATTGG - Intergenic
919940483 1:202282650-202282672 CTGGGAAATCAGGTGGGGAGGGG + Intronic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920837986 1:209529686-209529708 TGGGGAGAACAGATGGAGCCAGG + Intergenic
921187094 1:212679404-212679426 CTGGGAGGACAGACAGAGACTGG + Intergenic
921274238 1:213502247-213502269 CTGGGATGACAGATTGAGAATGG + Intergenic
921413101 1:214857869-214857891 CTGGGAAAAAAAATGTAGAAAGG + Intergenic
921459032 1:215407182-215407204 CTGGGAAAAAACTTGGAGGCAGG - Intergenic
924089484 1:240487600-240487622 CTGGGAACACAGTTGGTGAGTGG - Intergenic
924251266 1:242135562-242135584 CTAGGAAAACAAATGCAGAGAGG + Intronic
924667352 1:246086921-246086943 CGGTGAAAACACATGGACACAGG - Intronic
1064967437 10:21029573-21029595 CTGACAAAACAGATACAGACTGG + Intronic
1065037267 10:21652555-21652577 ATATGAAAACAGAGGGAGACTGG + Intronic
1065378209 10:25063702-25063724 GTGGGAACAAAGATGGACACGGG - Intergenic
1065378759 10:25068044-25068066 CTGGGCAAGCTGATGGAGCCAGG - Intergenic
1066642575 10:37571077-37571099 CTGGGGACCCAGAGGGAGACAGG - Intergenic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1067288215 10:44922770-44922792 CTAGGAATACAGATGGTGTCTGG - Intronic
1067522541 10:47019223-47019245 CTGGGGAAAAAGAAGGAGATTGG + Intergenic
1068237152 10:54252132-54252154 GAGGGAAAAGAGATGTAGACAGG - Intronic
1068297006 10:55084122-55084144 CTGGGAAAAAGGAAGGAAACTGG + Intronic
1068486624 10:57667161-57667183 CAGGGAAAACTCATGGAGACAGG - Intergenic
1068520391 10:58071049-58071071 CTTGGCAAACAAATGGATACAGG - Intergenic
1068858885 10:61826509-61826531 CTCTGGAGACAGATGGAGACTGG + Intergenic
1069127481 10:64654326-64654348 CAGTGAAAACACATGGACACAGG - Intergenic
1069961249 10:72080695-72080717 CTGGATAAACAGAAGGAGACAGG + Intronic
1070523406 10:77274692-77274714 CTGGGATGACAAATGGAGTCGGG - Intronic
1070746267 10:78935827-78935849 CTGGGAAACCAGACGGGAACAGG + Intergenic
1072276586 10:93829265-93829287 GTGGCCAAACAGATAGAGACAGG - Intergenic
1072463260 10:95639771-95639793 GGGGGAAAACTGATGGAGAAGGG - Intronic
1072946493 10:99815140-99815162 CAGGGAGAACACATGGATACAGG - Intronic
1073293291 10:102423901-102423923 CAGGGGAAACAGATGGGGATAGG + Intronic
1074693339 10:116026475-116026497 CAGGGAATGCAGATGGAGTCTGG + Intergenic
1075064150 10:119278243-119278265 CTGAGAGAACAGGTGGAGACGGG - Intronic
1076764872 10:132627541-132627563 CTGGGGACACAGAGGGAGTCGGG - Intronic
1076841620 10:133048796-133048818 CTGGGAAAGCAGCTGGGGAAGGG - Intergenic
1077474645 11:2780555-2780577 CTGAGAAAACAGTTGGAGGCTGG - Intronic
1078084415 11:8225100-8225122 GTGGGGAGACAGATGGAGAAAGG + Intronic
1078404782 11:11060924-11060946 CAGTGAAAACACATGGACACGGG + Intergenic
1079282071 11:19096566-19096588 CTAGAAACACAGCTGGAGACTGG + Intergenic
1079397308 11:20075939-20075961 CTGAGAACACAGGTGTAGACAGG - Intronic
1080068808 11:28053699-28053721 CTCGGAGAACACATGGACACAGG - Intronic
1080130381 11:28787562-28787584 CTATGAAAACATATGGACACAGG - Intergenic
1083833347 11:65247658-65247680 CTGGGAGGTCAGGTGGAGACAGG + Intergenic
1084088013 11:66863594-66863616 CTCTGAAAACAGCTGGAGTCTGG + Intronic
1084609295 11:70191918-70191940 CTGGGAGGACCCATGGAGACAGG - Intergenic
1084884075 11:72192025-72192047 CTGGGAAAACTGAGGGAGATGGG + Intronic
1085051836 11:73383976-73383998 CTGGAAACACAGCTGGACACAGG - Intronic
1086740682 11:90364312-90364334 CTGGAATAAAAGCTGGAGACTGG - Intergenic
1086899066 11:92345837-92345859 TTGAGGAAACAGATTGAGACAGG - Intergenic
1087481085 11:98701164-98701186 CAGTGAAAACACATGGACACAGG + Intergenic
1087596680 11:100262736-100262758 CAAGGAAAACACATGGACACAGG + Intronic
1087723082 11:101688695-101688717 CTGGGAGAACAGTTTGAGGCTGG - Intronic
1088515951 11:110634027-110634049 CTATGAACAAAGATGGAGACTGG + Intronic
1088690610 11:112323480-112323502 CAAGGAAAACACATGGACACAGG - Intergenic
1088970383 11:114769760-114769782 CAAGGAAAACACATGGACACAGG + Intergenic
1089367089 11:117927483-117927505 CTTGGAAAAGAGGTGGAGAAGGG - Intronic
1089671956 11:120062817-120062839 CTGGGAAGCCTGATGGAGTCGGG + Intergenic
1090408847 11:126493782-126493804 CTGGGCAAACACATGGTGACAGG + Intronic
1090627595 11:128619787-128619809 CCAGGAAAACAGATGGGGAAGGG + Intergenic
1091058075 11:132437360-132437382 CTGGGAAGAAAGAAGCAGACAGG + Intronic
1091163655 11:133450474-133450496 CTGGGATATAATATGGAGACTGG + Intronic
1091541068 12:1463129-1463151 CCGAGAAAACAAATGGAGAAAGG - Intronic
1091632393 12:2171772-2171794 CTAGGATAACAGGTGGAGAGGGG + Intronic
1091701992 12:2669540-2669562 CTCACAAAACAGAAGGAGACGGG + Intronic
1092202210 12:6592818-6592840 CTGGTGAAGCAGATGGAGAAAGG + Intronic
1092547792 12:9466823-9466845 CTGGGAATAAAGATGGAGAGAGG + Intergenic
1092865028 12:12752886-12752908 CTGGCTAAACAGATAGAGAAGGG - Intronic
1093264551 12:16987355-16987377 CAGGAAAAGCTGATGGAGACAGG - Intergenic
1093903802 12:24665564-24665586 CTGGGGAAACAGAAGCAGAAAGG + Intergenic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1095095678 12:38147194-38147216 GTGGGAGAACAGATGGACAGAGG - Intergenic
1095750408 12:45704347-45704369 CTGGGACAACAGGTGTAAACGGG + Intergenic
1096569140 12:52509903-52509925 CAGTGAGAACACATGGAGACAGG - Intergenic
1096644410 12:53022535-53022557 CTGACAAAACAGATACAGACTGG + Exonic
1096933234 12:55239357-55239379 AGGGGAAAAGAGATGGAGAATGG + Intergenic
1097239328 12:57564231-57564253 CTGGGCATTCAGATGGGGACTGG + Intronic
1097241784 12:57580628-57580650 GGGGGAAACCAGATGGAGACAGG + Intronic
1097822890 12:64145511-64145533 TAGGGAAATAAGATGGAGACAGG - Exonic
1098389710 12:69956605-69956627 CTGGGCAAGCAGAGGGAGAGAGG - Intronic
1098391366 12:69972966-69972988 CTGGGAAAACACATGGATTCTGG + Intergenic
1098529126 12:71520664-71520686 CAGTGAGAACAGATGGACACAGG + Intronic
1098593175 12:72238587-72238609 CAGGGAGAACACATGGACACAGG - Intronic
1099004687 12:77222159-77222181 TTGGGAGAACAGGAGGAGACAGG - Intergenic
1099052192 12:77793517-77793539 CAGTGAAAACACATGGACACAGG - Intergenic
1100548722 12:95627135-95627157 ATGGGAAAATACAGGGAGACAGG - Intergenic
1101498823 12:105281844-105281866 AAGGGAAAACAGAAGGAGCCTGG + Intronic
1102473984 12:113176778-113176800 CTGGGAAAGCAGAGGCAGAGAGG - Intronic
1102605498 12:114064560-114064582 CTGGTAAACCAGAGGGAGTCAGG - Intergenic
1103123073 12:118396912-118396934 CTAGGAAACCTGATGGATACAGG - Intronic
1103186922 12:118966226-118966248 CTGAGAACACACATGGACACAGG - Intergenic
1103197547 12:119058031-119058053 CTGGGAAAGAAGATGGGGAAGGG + Intronic
1104332136 12:127856818-127856840 CTGGGAAAACACAAGGAGGGAGG + Intergenic
1104380323 12:128301688-128301710 CTTGGCAAACAGATGCAGAATGG + Intronic
1105964912 13:25374777-25374799 CTGGGGACACTGATGGAAACAGG + Intronic
1106008056 13:25789957-25789979 CTGGCAAAAGAAATGGAGAAAGG + Intronic
1106819655 13:33450768-33450790 TTGGGAAAACACAGGGAGAGGGG + Intergenic
1107890573 13:44910678-44910700 TTGGGAGAAAAGATGGAGAGAGG + Intergenic
1107962189 13:45568322-45568344 AAGTGAAAACAGATGGAAACTGG - Exonic
1108348613 13:49569969-49569991 CTTACAAAACAGATGGAGAAAGG + Intronic
1108917721 13:55636374-55636396 CAGTGAGAACAGATGGACACAGG + Intergenic
1110337819 13:74352503-74352525 CAGTGAGAACAGATGGACACAGG + Intergenic
1110597484 13:77335270-77335292 ATTGGGAAACAGATGTAGACTGG - Intergenic
1111908292 13:94281392-94281414 CAGGGAGAACACATGGACACAGG - Intronic
1113380274 13:109797665-109797687 CTTGGAATAGAGACGGAGACTGG + Intergenic
1115343496 14:32317719-32317741 CTGGCAAACCAGATGGTGCCTGG - Intergenic
1115794073 14:36912971-36912993 CTGGGAAAAAAAAAGGAGAAAGG - Intronic
1115882494 14:37935338-37935360 CAGTGAAAACACATGGACACAGG - Intronic
1117931861 14:60851745-60851767 CAGTGAAAACACATGGACACAGG - Intronic
1118686667 14:68298319-68298341 CTGGGAGAACAAAAGGAGAAAGG + Intronic
1118879533 14:69814433-69814455 CTGGCAAAACAGATAGAAAAAGG + Intergenic
1118971889 14:70643751-70643773 CTGGGAAGACAGAGGTAGGCTGG - Intronic
1119294692 14:73523306-73523328 CTTGAAAAACAGATGGAAAGGGG + Intronic
1119520843 14:75284044-75284066 CTGGGACAACAGAAGCACACTGG - Intergenic
1120145349 14:80972967-80972989 AAGGGAAAACAGATGTAAACAGG + Intronic
1120611285 14:86645249-86645271 ATGGGAAAATTGATGGAGAAAGG - Intergenic
1120933489 14:89871777-89871799 ATGGGAAATCTGATGGAGTCAGG - Intronic
1121078633 14:91089927-91089949 CTGGGACAACAGATGTAACCCGG + Intronic
1121088921 14:91167902-91167924 CTGGGAAAGCAGATGATGACAGG - Intronic
1121708269 14:96017520-96017542 CTGGGAAGCCACATGGAGTCAGG - Intergenic
1124017870 15:25892988-25893010 CTGGGACAACAGCAGGAAACAGG - Intergenic
1124798361 15:32804704-32804726 CAGTGAGAACAGATGGACACAGG - Intronic
1124973986 15:34516551-34516573 CTGGGAAAAGAGATCGTGCCCGG + Intergenic
1125442063 15:39713821-39713843 CAGTGAAAACAGCTGGAGCCAGG + Intronic
1126146757 15:45481561-45481583 CTGGGAAAACAGATTATGACAGG - Exonic
1127601937 15:60546485-60546507 CAGGAGAAACAGATAGAGACAGG + Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1128379853 15:67104579-67104601 ATGGGAAAACAGCTGGAAAAAGG - Intronic
1129160466 15:73744835-73744857 CTCGGCAAACACATTGAGACAGG - Intronic
1130542284 15:84829103-84829125 CTGGGAAGACAAATTGAGAGGGG - Intronic
1130646305 15:85730187-85730209 CTGGGAAAGCAGTTGCAGAGTGG + Intronic
1131666971 15:94581084-94581106 AGGGAAAAAGAGATGGAGACAGG + Intergenic
1133449685 16:5893503-5893525 CAGATAAAACAGATGGACACAGG - Intergenic
1133670472 16:8014048-8014070 CTGGGAAAACAGGTGTCAACTGG - Intergenic
1133743244 16:8667499-8667521 CTGTGAGAACACATGGACACAGG - Intergenic
1133761166 16:8799305-8799327 CTGGGAAGAAAGATGGAGGAAGG - Intronic
1134101048 16:11451782-11451804 CTGGGGAAACTGAGGCAGACAGG + Intronic
1135801793 16:25504074-25504096 CTGGGTACACATATGGAGAATGG + Intergenic
1136109090 16:28053454-28053476 CTGGGAGGACAGAGGGGGACTGG + Intronic
1136492780 16:30621310-30621332 CTGGGCAAACAGATAGAAAAGGG - Intronic
1137030518 16:35519579-35519601 CTGGGCAAACAGATAGAAAAGGG + Intergenic
1137387975 16:48058390-48058412 CAGGGAAAACACATAGAGAAAGG - Intergenic
1137582128 16:49639872-49639894 CTGGGAAAACAAAGGCACACAGG + Intronic
1137824935 16:51484809-51484831 ATGGGAAAACAGAGAGAGAAAGG - Intergenic
1137833714 16:51570019-51570041 TAGGGACAAAAGATGGAGACGGG + Intergenic
1138074177 16:54024656-54024678 ATGGGAAAACCGAGGGAGAATGG - Intronic
1138247553 16:55479028-55479050 CGGGGAAAAGAGGTGGAGAAAGG + Exonic
1138697659 16:58830473-58830495 GTGTGAAAACAGATGAATACAGG + Intergenic
1139659144 16:68409085-68409107 CTGGGAGAATAGATAGAGACAGG - Intronic
1139728265 16:68920115-68920137 CTGGGAATACAGCAGGGGACAGG + Intronic
1140022225 16:71249325-71249347 AAGGGAAAACAGATGCAGAGAGG - Intergenic
1140437898 16:74963536-74963558 CAGTGAAAACACATGGACACAGG + Intronic
1142616540 17:1139720-1139742 GTGGGAAACCAGATGGACACAGG + Intronic
1142748716 17:1974646-1974668 CAGGGAAGCCAGGTGGAGACGGG + Intronic
1142984554 17:3688097-3688119 CTGGCAAATCTGAGGGAGACAGG + Exonic
1143855327 17:9843996-9844018 ATGGGGAAACTGATGCAGACAGG + Intronic
1144300959 17:13922784-13922806 ATGAGAAAAGAGATGGAGTCTGG - Intergenic
1144438269 17:15260591-15260613 CTGGGAACCCAGATGGGGAAGGG + Intronic
1144877681 17:18410982-18411004 TTGGGGAAAGAGATGGAGAGGGG - Intergenic
1145007019 17:19343858-19343880 CTGGGAACACAGAAGAACACAGG + Intronic
1145154550 17:20533421-20533443 TTGGGGAAAGAGATGGAGAGGGG + Intergenic
1145836903 17:27961245-27961267 CTGGGAAGAAAAATGGAGAAAGG - Intergenic
1147140342 17:38457155-38457177 CTGGGATTACAGGTAGAGACAGG + Intronic
1148216794 17:45837719-45837741 CTGGGCAGGCAGATGGAGCCTGG + Intergenic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1149569920 17:57665137-57665159 CTGGGAAGACTAATGGAGGCTGG - Intronic
1149662012 17:58338996-58339018 CTGGGGAATCAGCTGGAGGCAGG - Intergenic
1149869207 17:60167771-60167793 CTGGGAAGACACATGGAGCTAGG - Intronic
1150838732 17:68588378-68588400 CAGGGAACTGAGATGGAGACAGG + Intronic
1151207046 17:72515489-72515511 CTTGGAAACCAGATGGAAATAGG - Intergenic
1151313899 17:73310689-73310711 CTGGGAAAACACAGGGAACCTGG + Intronic
1151800356 17:76375870-76375892 CTGGAAAAAGACATGGAGCCCGG - Intronic
1152883595 17:82834664-82834686 CAGTGAAAACACATGGACACAGG + Intronic
1152905025 17:82965298-82965320 CTGGGACAACAGAGGGAGAAGGG - Intronic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1153044841 18:846545-846567 ATGGGAAACCAGGTGGAGATAGG - Intergenic
1153822390 18:8843394-8843416 CTGGGAAAGCAAATGGAGCCAGG + Intergenic
1154388619 18:13917607-13917629 ATGGGGAAACAGAAGGGGACAGG + Intergenic
1155195027 18:23466449-23466471 TTGGGATAGCAGATGGAGACAGG + Intronic
1155708184 18:28842429-28842451 CTGAGAAAAGATATGGAAACAGG - Intergenic
1156165031 18:34408112-34408134 CAAGGAAAACACATGGACACAGG - Intergenic
1157175051 18:45443977-45443999 CTGGAAACACACATGGAGAGTGG + Intronic
1157401860 18:47395442-47395464 CTGGGAACACAGATGATGGCTGG - Intergenic
1158793170 18:60806955-60806977 CTAGGAACACAGATGGAAAATGG + Intergenic
1159379896 18:67643481-67643503 CCTGGACAACAGAGGGAGACTGG - Intergenic
1159583427 18:70260768-70260790 AAGGGAAAACAGATGGAAAGTGG + Intergenic
1160178294 18:76613439-76613461 CTGAGAAAAGGGATGGAGGCAGG + Intergenic
1160665632 19:326723-326745 TTGGGTAAACAGATGGGCACAGG + Intronic
1160684782 19:428657-428679 CAAAGAAAACAGATGCAGACAGG + Intronic
1160955300 19:1688542-1688564 CTGGGAGACCAGGTGGAGACGGG + Intergenic
1161512644 19:4679946-4679968 CCTGGAAAACAGATGGGGAAGGG + Exonic
1161622125 19:5303572-5303594 CTGGAAAAAGAGAGGGGGACTGG + Intronic
1161761040 19:6173035-6173057 CTGGGAAAAGACATGGAGAAGGG - Intronic
1162595201 19:11623269-11623291 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1162913095 19:13860542-13860564 CTGGAATTACAGATGGAGCCCGG - Intergenic
1162957332 19:14106797-14106819 CTGGTGAAACACAAGGAGACCGG - Exonic
1164073505 19:21791387-21791409 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1165114164 19:33519022-33519044 GTGGGAGAGCAGATGCAGACAGG + Intronic
1165365427 19:35362230-35362252 CTGAGAAAACAGATGTGGAGAGG + Intergenic
1165846060 19:38818398-38818420 CTGGGGACACAGGTGGAAACAGG - Intronic
1166214323 19:41325612-41325634 CTGAGAACAGAGATGGAGAATGG - Intronic
1166910680 19:46154031-46154053 CTGTGAGAACACATGGACACAGG - Intronic
1167612502 19:50514197-50514219 TTGGGAGAAGAGATGGTGACAGG + Intronic
1167808630 19:51809015-51809037 CTGGAAAAACAGATAGAAAAGGG - Intronic
1167882849 19:52476477-52476499 CTGGAAAAACAGATAGAAAAGGG - Intronic
1168428303 19:56257310-56257332 CTGGGAGAACAAAGGGAGGCAGG + Intronic
1168576249 19:57513523-57513545 CTGGGCAAACAGATAGAAAAGGG + Intronic
925321822 2:2976227-2976249 GTGGGAAAAGAGATGGGGAAAGG + Intergenic
925779822 2:7371979-7372001 CTGGGAAGACAAATGGAGACTGG + Intergenic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
927229420 2:20806425-20806447 CTTGGAAAATATATGGTGACTGG + Intronic
928498660 2:31863307-31863329 CTGGGGCAACAGAGCGAGACTGG + Intergenic
929030079 2:37641799-37641821 CATGGAAAACAGATCGACACGGG - Intergenic
929451484 2:42040937-42040959 AGGGGAAAAAAGAGGGAGACAGG - Intergenic
930301191 2:49618101-49618123 CTGACAAAACAGATGAAGACAGG + Intergenic
930533129 2:52615085-52615107 TTGGGAACACAGATATAGACAGG + Intergenic
930551954 2:52847067-52847089 CAGTGAGAACAGATGGACACAGG - Intergenic
930606570 2:53499199-53499221 CGGGGAAAAGAGAGGGAGGCAGG + Intergenic
931074500 2:58694430-58694452 CTATGAAAACACATGGACACAGG + Intergenic
931189857 2:59989780-59989802 CTGGGACTACAGATAGCGACTGG - Intergenic
932379107 2:71265708-71265730 CAGTGAAAACACATGGACACAGG - Intergenic
932397268 2:71456553-71456575 ATGGGACAACAGATAGAGTCTGG - Intronic
934080936 2:88467331-88467353 CTGGGAAAGCAGAGGGATAGGGG + Intergenic
934973947 2:98787196-98787218 CTGGGGAAACAGATGTGTACGGG + Intergenic
935033827 2:99348490-99348512 CTGGGTAAGAAGATGAAGACTGG + Intronic
935096378 2:99948238-99948260 TTGGGAAAAAAGGTGGACACAGG - Intronic
935209601 2:100927512-100927534 TTGGGAAAGCAGAGGAAGACAGG - Intronic
935787238 2:106560333-106560355 CTGGGAAAAAAGAGGGAGGGAGG - Intergenic
937610196 2:123851967-123851989 CTGGGAACTCAGATGGGGAAAGG + Intergenic
938929486 2:136074194-136074216 CTGGAAAAACAGATAGAAAAGGG - Intergenic
939025026 2:137002332-137002354 ATGAGAAAACAGATCCAGACTGG + Intronic
939096354 2:137837413-137837435 CTGGAAAAATACATGGGGACAGG + Intergenic
939383156 2:141462440-141462462 CAGTGAAAACACATGGACACAGG + Intronic
939931011 2:148232879-148232901 TTGAGAAAAGAGAAGGAGACTGG - Intronic
940194106 2:151073887-151073909 CAAGGAAAACACATGGACACAGG - Intergenic
940405133 2:153292700-153292722 CAGGGAAAAGAGATGGAACCAGG + Intergenic
942366700 2:175235812-175235834 CAGTGAAAACACATGGACACGGG + Intergenic
942379921 2:175378589-175378611 CTGGGAAACAAGCTGCAGACAGG + Intergenic
942384838 2:175431740-175431762 CTTGAAAAACAGATGAAGAGTGG + Intergenic
942589828 2:177530759-177530781 CAGAGAAAACAGATGTAGTCTGG + Intronic
943169830 2:184384656-184384678 ATGTGAGAACAGATGGAGAACGG - Intergenic
943493539 2:188586762-188586784 CTGGGAAAAAACATGAAAACTGG + Intronic
943926148 2:193782937-193782959 ATGGGAACACACATGGACACAGG - Intergenic
944396019 2:199267038-199267060 CTGGCAAAGCAGATGGGGAAGGG + Intergenic
944620720 2:201512878-201512900 CTAGGAGAACACATGGACACAGG + Intronic
946118615 2:217488988-217489010 ATGGGATGACAGATGGATACAGG + Intronic
946248808 2:218401042-218401064 CAGGGCAAACAGATGGCCACTGG + Intronic
946713172 2:222526810-222526832 CAGTGAAAACACATGGACACAGG + Intronic
947732221 2:232437559-232437581 CTGGTAAAAGAGACGGAGGCTGG + Intergenic
947881609 2:233519104-233519126 CTTGGAATACAGATGGGTACAGG + Intronic
948192853 2:236073489-236073511 CTTGCAAAACAGCTGGGGACTGG + Intronic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
1168838122 20:891325-891347 CTGGGAGAACCCTTGGAGACTGG - Intronic
1169221741 20:3827187-3827209 CTGGGACAACAGATGATGACAGG + Exonic
1169783102 20:9330189-9330211 CTGGGAAAGCAGGTGGAGTCTGG - Intronic
1170096865 20:12655392-12655414 CAGTGAAAACACATGGACACAGG + Intergenic
1170276718 20:14599538-14599560 CTGGAAAAATAGGTAGAGACTGG + Intronic
1170919853 20:20667748-20667770 AAGGGGAAACAGATGGAGAAAGG + Intronic
1170943203 20:20866315-20866337 CTGGGAAAACACTTGGAGGGAGG - Intergenic
1171113609 20:22505355-22505377 CTGGGAAAGATGATGGAGAATGG + Intergenic
1172544548 20:35749353-35749375 CTGAGAAAAAAGATGGAGTCTGG + Intergenic
1172659311 20:36556752-36556774 CTGGGAAAGCAGACGGGGCCAGG - Intergenic
1173240379 20:41290642-41290664 ATGAGAAAACAGATGCAGAGAGG + Intronic
1173338391 20:42131952-42131974 CTGGGAAAACAGAGTGTGAGGGG + Intronic
1173939995 20:46902581-46902603 CAGGGCAGACAGATGGAGAAAGG - Intronic
1175349479 20:58308718-58308740 ATGGGATAAGAGATGGAGCCGGG + Intergenic
1175767827 20:61603426-61603448 CTAGGAAAACAAATGCAGGCAGG + Intronic
1175827232 20:61942786-61942808 CTGGGAGAGGCGATGGAGACAGG + Intergenic
1178711082 21:34917280-34917302 AAGAGAAAGCAGATGGAGACAGG + Intronic
1179992456 21:44955235-44955257 CTTGGAAAACAGAGAGAGACAGG + Intronic
1181352330 22:22267800-22267822 CTCTGAGAACAGGTGGAGACAGG + Intergenic
1181429877 22:22872808-22872830 CTGGGTACAGACATGGAGACAGG + Intronic
1182106684 22:27694821-27694843 CTGAATAAAGAGATGGAGACAGG + Intergenic
1182373773 22:29830967-29830989 ATGGAAACACTGATGGAGACTGG - Intronic
1182385168 22:29932868-29932890 CAGGGAAAAAATATGGAGAAAGG - Intronic
1182420670 22:30247147-30247169 CTGGACTAGCAGATGGAGACTGG + Intergenic
1182550927 22:31100398-31100420 AAGGGAAGACAGATGGAGAAGGG - Intronic
1182973203 22:34596897-34596919 ATGAGAATACACATGGAGACAGG - Intergenic
1182980669 22:34667745-34667767 ATGAGAACACACATGGAGACAGG - Intergenic
1183050331 22:35255733-35255755 CTGGGGAAACACATGGAAATGGG + Intergenic
1183714313 22:39524756-39524778 CTTGGCAGACAGATGGAGAGAGG - Intergenic
1184111010 22:42395078-42395100 GTGGGAAGATAGCTGGAGACCGG + Intronic
1184321882 22:43748150-43748172 CTGGGAAAGCAACTGGAGTCAGG - Intronic
1184402678 22:44282889-44282911 CTGGGACACCACATGGAGGCTGG + Intronic
1184747255 22:46463594-46463616 CGGGGAAAACAGCTGGAGGATGG - Intronic
1185363260 22:50422224-50422246 TGAGGAAAGCAGATGGAGACCGG - Intronic
1185420630 22:50732424-50732446 CTGGGCAAACAGCTGGACCCAGG - Intergenic
949346857 3:3084782-3084804 GTGAGAAAACAGATGCAGAGAGG - Intronic
949577842 3:5356052-5356074 CTGGGATTAGGGATGGAGACTGG - Intergenic
949729933 3:7097152-7097174 CAGGTAAAGCAGATGGAGAGTGG + Intronic
950348870 3:12327145-12327167 GTGGTAAAAGAGAAGGAGACTGG + Intronic
950467136 3:13162244-13162266 CTTGGAAGACAGAGGGAGAAGGG + Intergenic
950623603 3:14227512-14227534 CTGGAAAAACAGATAGAAAAGGG + Intergenic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950769631 3:15301224-15301246 CTAGGTAAGCAGATGGAGAGTGG - Intronic
952463177 3:33551340-33551362 CTGGCCAAACAGATGGATCCAGG - Exonic
952503142 3:33982983-33983005 GTGGGAGAACACATGGACACAGG - Intergenic
953750836 3:45607267-45607289 CAGGGAAACCAGCTGGACACAGG + Intronic
955292972 3:57709642-57709664 CTGGGCAAACTAATGGAGTCTGG + Intergenic
955943353 3:64167650-64167672 CTGGGCAGAAAGATGGAGGCTGG + Intronic
956363624 3:68475353-68475375 CAGTGAGAACACATGGAGACAGG - Intronic
956403845 3:68907569-68907591 GAGGGAACACAGATGCAGACTGG - Intronic
956931235 3:74045755-74045777 TTGGGAAAACTGTTGGAGAAGGG + Intergenic
957535020 3:81491015-81491037 CTGGGATACCAGATGTAGGCAGG - Intronic
957618570 3:82566117-82566139 ATGTTAAAACAGATGGATACTGG + Intergenic
957663023 3:83185226-83185248 CAGTGAAAACACATGGACACAGG - Intergenic
959370724 3:105522011-105522033 CTGCCAAAACAAATGGAGTCAGG + Intronic
959569367 3:107866894-107866916 CTAGGAAAAGAGTTGGAGACTGG - Intergenic
959682302 3:109109414-109109436 ATGAGAAAACAAATGGAGATAGG - Intronic
959933194 3:112004199-112004221 CTTGGAAAACAGAAGGTGAATGG + Intronic
961438797 3:126938350-126938372 CTGAGAAGACAGATGAAGAGCGG - Intronic
961546649 3:127639013-127639035 AAGGGGAGACAGATGGAGACAGG - Intronic
962074649 3:132068764-132068786 CTGGGAAAGTAGATGTACACTGG - Intronic
962680509 3:137794969-137794991 CTGGGAAAAGAGAGAGAGAGAGG - Intergenic
963161216 3:142152214-142152236 ATGGGAAAACAGTTGGAGATGGG - Intergenic
963923333 3:150926032-150926054 CTGCGAGAAGAGAGGGAGACCGG + Intronic
965682479 3:171265746-171265768 CTGGGGAAACAGAGGGAAAGTGG + Intronic
966118780 3:176498601-176498623 CTGTGAAAACAGATTAATACAGG - Intergenic
966683847 3:182672254-182672276 CCTGGAGAACAGATGGGGACCGG + Intergenic
969083318 4:4636954-4636976 TTTGAAAAACTGATGGAGACTGG + Intergenic
970213512 4:13734909-13734931 TTGGGAAAAGAGATGGTGCCTGG + Intergenic
971630771 4:28990346-28990368 ATGGGAAGACAGAGAGAGACTGG - Intergenic
972763214 4:42127548-42127570 CTTGAGAAACAAATGGAGACAGG + Intronic
972947439 4:44273539-44273561 CTGGGAAAAAAGATGAAGATGGG + Intronic
973139541 4:46749404-46749426 TTGGGAAAATAGATGGAGGATGG - Intronic
974902810 4:68022039-68022061 CTGGGAAAAGGGATGTAGAGAGG - Intergenic
974938788 4:68439141-68439163 ATGGGAAAACAGATGAAGAAAGG + Intergenic
974997780 4:69183537-69183559 CAGTGAAAACACATGGAAACAGG - Intronic
975476594 4:74830737-74830759 CAGTGAAAACACATGGACACAGG + Intergenic
975817049 4:78229103-78229125 CTTTGAAATCAGATGGACACTGG + Intronic
975948986 4:79745046-79745068 GTGGGAAAAAAGAAAGAGACCGG - Intergenic
976056634 4:81076996-81077018 AGGGGAAAACTGATGGGGACTGG - Intergenic
976530946 4:86151232-86151254 CTGAGAAAACAGATGGACTCAGG - Intronic
976655400 4:87483280-87483302 CAGTGAAAACACATGGACACAGG - Intronic
977026400 4:91823612-91823634 CTTGGGAGAAAGATGGAGACTGG + Intergenic
977258359 4:94765770-94765792 CTGGGAAAACAAATGCAATCAGG - Intronic
978957989 4:114638520-114638542 CAAGGAAAACAGATGGAGGGAGG - Intronic
981048870 4:140291738-140291760 CTGAGAAATCAGATGGATCCTGG - Intronic
981541489 4:145851038-145851060 ATGTGAAAACAGACAGAGACTGG + Intronic
981922098 4:150096837-150096859 GTGGAAAAACAGATGAGGACTGG + Intronic
981944356 4:150323915-150323937 CTGGGAAAACTGATGAAACCTGG - Intronic
982085679 4:151834014-151834036 GTGAGAAAACAGATTAAGACAGG + Intergenic
983024903 4:162724518-162724540 CAGGGTAAACAGATGGGGGCTGG - Intergenic
983897056 4:173092433-173092455 GTGGGAAAAGAGCTGGAGAATGG + Intergenic
984220913 4:176973404-176973426 CAGGGAAAACACAGGGAAACTGG + Intergenic
985929291 5:3043707-3043729 ATGGATAAAGAGATGGAGACAGG - Intergenic
986684044 5:10260138-10260160 CTGGGAGGCCTGATGGAGACAGG + Intronic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
988385804 5:30563543-30563565 CTGGCAAGTCAGATGGAGGCTGG + Intergenic
988398913 5:30735273-30735295 CTAGGAAAACACATGAATACAGG + Intergenic
988953638 5:36291593-36291615 CAAGGAAAACACATGGACACAGG - Intronic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
990352712 5:54934851-54934873 CTGGGAGATCAGAAGGTGACAGG + Intergenic
990468226 5:56089127-56089149 CTGGGAACACAGGAGGAGAAAGG - Intergenic
990820355 5:59832898-59832920 ATGGAAAAACAGATGAAAACGGG + Intronic
990871140 5:60431800-60431822 CTGGGATTGCAGATGGAGTCTGG - Intronic
991146080 5:63306068-63306090 CTGTAAAAACAGGTGTAGACAGG + Intergenic
993535281 5:89076661-89076683 CTGAGAAAACAGATTTAGAGAGG + Intergenic
993865534 5:93190075-93190097 CTTGGAAGACAGATGGTTACAGG + Intergenic
994134958 5:96275551-96275573 CAGGGAAAGGAGGTGGAGACAGG - Intergenic
994368456 5:98943325-98943347 ATGGGAAAGCAGATGCAAACTGG - Intergenic
995991151 5:118241163-118241185 CTGGGACAAAAGACTGAGACTGG - Intergenic
997235820 5:132271482-132271504 GTGGGAAGGCAGATGGGGACAGG - Intronic
998023921 5:138796648-138796670 CTGGGAAATCAGTGGGAGAAGGG + Intronic
998024097 5:138798885-138798907 CTGGGGAAACTGAGGTAGACAGG - Intronic
998086937 5:139334210-139334232 CTGGGATTACAGGTAGAGACAGG + Intergenic
998516873 5:142763835-142763857 ATGGGAAAACAGAGGGAGCCAGG - Intergenic
998855152 5:146387543-146387565 AAGAGAAAACAGATGGAGATGGG - Intergenic
998911342 5:146963624-146963646 ATGGGAAAAAAAATGAAGACAGG - Intronic
1000098903 5:157995449-157995471 GTGGCCAAAGAGATGGAGACTGG - Intergenic
1000109607 5:158095227-158095249 ATAGGAAAACTGATGGAGAAAGG - Intergenic
1000332076 5:160213527-160213549 CTTGGAAAACAGACAGAGACAGG - Intronic
1001571700 5:172734389-172734411 CTAAGAAAACAGATGAAGAGGGG + Intergenic
1002439286 5:179256021-179256043 CTGGGGACAGAGAAGGAGACTGG - Intronic
1002569979 5:180134726-180134748 CTGGGTGAAGAGATGGGGACAGG - Intronic
1002615172 5:180448620-180448642 CTGGGAGAACAGGTGCAGGCCGG + Intergenic
1003149102 6:3533694-3533716 CAGAACAAACAGATGGAGACAGG + Intergenic
1003408991 6:5846799-5846821 CTGGGGAAACAGCCTGAGACAGG + Intergenic
1003556789 6:7147004-7147026 CTCCAAAAACAGCTGGAGACTGG - Intronic
1003876812 6:10445194-10445216 CAAGGAAAATAAATGGAGACAGG - Intergenic
1004181803 6:13386970-13386992 CTGAGAAATGAGATGGAGGCTGG - Intronic
1004327268 6:14686698-14686720 CTGTAAAAACAGATGAAGCCTGG + Intergenic
1004332098 6:14731193-14731215 AAGGGAATACAGAGGGAGACAGG - Intergenic
1004946885 6:20624979-20625001 CTCAGAAAACAGATGAAGAGAGG - Intronic
1005394259 6:25364980-25365002 CTGGGAATCCAGATAGAGAAAGG - Intronic
1005979779 6:30828121-30828143 CTGGGTCAACAGATGGAGGCAGG + Intergenic
1006228787 6:32564302-32564324 CTGGAAAAACAGATAGAAAAGGG - Intronic
1006443050 6:34063838-34063860 CTGGGGAGACAGATGGACAGAGG + Intronic
1007126137 6:39427168-39427190 CTGGGAATACAGACACAGACTGG - Intronic
1007783996 6:44270216-44270238 CACGGAGAACAGATGGAGAGGGG + Intergenic
1008627843 6:53335332-53335354 CAGGGAAGCCAGAGGGAGACAGG - Intronic
1009807629 6:68622791-68622813 CTTGGAAAATAGGTGGACACAGG + Intergenic
1009909925 6:69913466-69913488 CTGAGAGAACAGATGAAGCCAGG + Intronic
1010658305 6:78538805-78538827 CTGGGAACAAAAATGGAGGCAGG + Intergenic
1012287486 6:97409357-97409379 CAGTGAGAACACATGGAGACAGG + Intergenic
1012457242 6:99421208-99421230 CTTGGAAAACAAATGGGGTCTGG + Intronic
1012573259 6:100758413-100758435 CAGGGAGAACACATGGACACAGG - Intronic
1012599222 6:101073554-101073576 CTGGCAAGTCAGATGGAGATAGG - Intergenic
1012665309 6:101961519-101961541 CTGGGAACAAAGATGGATAGGGG - Intronic
1013648055 6:112164430-112164452 GTGGGAAAACAGAGGTGGACTGG + Intronic
1014336474 6:120142835-120142857 CTGGGAAAACAGTGGTGGACTGG - Intergenic
1014529018 6:122537360-122537382 CAAGGAAAACACATGGACACAGG - Intronic
1015571884 6:134630214-134630236 CAAGGAGAACACATGGAGACAGG - Intergenic
1016430858 6:143983776-143983798 GTGGGAGGACAGATGGAGAATGG + Intronic
1016505669 6:144776260-144776282 CTGGGAAAAAATGTGGAGACGGG - Intronic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1017355178 6:153496715-153496737 GTGGGAAAACAGCTGGATAGTGG - Intergenic
1017861511 6:158402495-158402517 CTGAGAAAACAAATGAAGACTGG + Intronic
1018266864 6:162034368-162034390 CTGGTAAAACAGCTAGAAACTGG + Intronic
1019526757 7:1483856-1483878 GTGGGAAAAGAGGTGGAGTCAGG + Intronic
1019911440 7:4102685-4102707 CTGGAAAAACTGGTGGAAACTGG - Intronic
1020105607 7:5421018-5421040 CTGGGAAGACAGGAGGGGACGGG + Intronic
1020461178 7:8432160-8432182 CTGGGAATCCAGATAGAGGCAGG + Intergenic
1020777596 7:12474026-12474048 CAAGGAAAAGAGATGGAGTCAGG + Intergenic
1020803172 7:12756842-12756864 CTGGGAAAGGAGAAGGAAACTGG + Intergenic
1020891691 7:13886192-13886214 CTGAGAAAATAGATGTAAACAGG + Intergenic
1021117730 7:16762729-16762751 GCAGGAAAGCAGATGGAGACTGG - Intronic
1021748003 7:23763162-23763184 CTGGGGAAATTAATGGAGACAGG + Intronic
1022365820 7:29715072-29715094 CAGTGAGAACAGATGGACACAGG + Intergenic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022740071 7:33112243-33112265 CTGGGAGAACATATGGGGGCAGG - Intergenic
1022779098 7:33560029-33560051 CTGGGTAAACTGATAGAGAGGGG - Intronic
1023230242 7:38020236-38020258 CTGGGAAACCAGAGAGAGCCCGG - Intronic
1023556331 7:41426908-41426930 ATTGGAAAAGAGATGAAGACAGG - Intergenic
1024134204 7:46390047-46390069 CTGGGGAAAGAGTTGGAGAGAGG + Intergenic
1024159915 7:46663516-46663538 CTGGGAAAGCAGAGGGAGTAAGG + Intergenic
1024192448 7:47026720-47026742 CTGTGAAAACAGGTGCAGAGAGG + Intergenic
1024993416 7:55253880-55253902 CTCGGAAGAAAGATGGAGGCGGG - Intronic
1025711197 7:63911587-63911609 CTGGTAGAATAGATGTAGACAGG + Intergenic
1026009799 7:66628266-66628288 CGGGACACACAGATGGAGACAGG - Intergenic
1026230247 7:68476571-68476593 CTGGAAAAGGAGAGGGAGACTGG + Intergenic
1026550806 7:71366829-71366851 TTGGCAAAACAAATGAAGACTGG - Intronic
1026849117 7:73713979-73714001 CTGGCAAAACAGGTGGAGCCTGG - Intronic
1027484977 7:78750075-78750097 CAGTGAAAACACATGGAGATGGG - Intronic
1028188457 7:87817686-87817708 CTGGGAACAGAGATGGGGATGGG - Intronic
1028524418 7:91767904-91767926 CGGGGAAAAAAAAGGGAGACAGG + Intronic
1029827867 7:103219756-103219778 CAGTGAGAACAGATGGACACAGG - Intergenic
1029958811 7:104668323-104668345 CTGACAAAACAGATACAGACTGG + Intronic
1030619408 7:111772846-111772868 TTGGGAAAGCATTTGGAGACTGG - Intronic
1030906285 7:115187407-115187429 CAATGAAAACAGATGGACACAGG - Intergenic
1032496749 7:132368532-132368554 CTGGGCAGACAGAGGGTGACAGG - Intronic
1034256526 7:149727759-149727781 CTGGGGCAACAGAGGGAGCCGGG - Intronic
1035053260 7:156016678-156016700 GTGGGAAAACACATGGAATCGGG + Intergenic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035457939 7:159021391-159021413 TTGGGAATACAGAGGCAGACTGG - Intergenic
1035851963 8:2929370-2929392 CTGGGACACCAGGTGGAAACAGG + Intergenic
1037192430 8:16142824-16142846 CTGGGAATACAGAGGGAGGGAGG + Intronic
1037282459 8:17257438-17257460 CAGTGAAAACACATGGATACAGG + Intronic
1037618936 8:20546049-20546071 CTGGTCAAAGAGATGGAAACAGG + Intergenic
1037745607 8:21641837-21641859 CTGGGAAGAAAGGTGGAGGCAGG - Intergenic
1038514449 8:28173908-28173930 CTAGAATAACAGATGGAAACTGG - Intronic
1038846827 8:31237772-31237794 CTATGAAAACACATGGACACAGG - Intergenic
1041206416 8:55502916-55502938 CTGGGAAAACATATGCAAAAAGG - Intronic
1041289975 8:56299438-56299460 CTGAGGAAACAGAAGGACACAGG - Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043398123 8:79858141-79858163 CTGGGAAGCCAGGTGGAGAATGG - Intergenic
1045384846 8:101662334-101662356 CTGGGCGAGCAGAAGGAGACTGG - Intronic
1046137727 8:110051625-110051647 TTGGGATAACAGATGTAAACCGG - Intergenic
1048340042 8:133531608-133531630 CAGTGAAAACACATGGACACAGG + Intronic
1049302692 8:141879972-141879994 CTGGGAGCACAGGTGGAGAGGGG - Intergenic
1049738674 8:144223522-144223544 CTGAGAAACCAGAGGGAGCCAGG - Intronic
1050193671 9:3057265-3057287 CAGTGAAAACACATGGACACAGG + Intergenic
1051549268 9:18311151-18311173 CTATGAGAACAGATGGACACAGG + Intergenic
1052207113 9:25855598-25855620 CAATGAAAACAGATGGACACAGG - Intergenic
1052216368 9:25971691-25971713 CTGAGAAAACAGAGGCAGAAGGG - Intergenic
1052768341 9:32664564-32664586 TTGAAAAAACAGATGGTGACAGG - Intergenic
1053271720 9:36754555-36754577 CTGGGCAATGAGATGGAGATAGG - Intergenic
1054737744 9:68772590-68772612 CTGGGAAGAGAGATGGGCACTGG - Intronic
1054795240 9:69295472-69295494 TGGGGAAAAAAGGTGGAGACAGG - Intergenic
1055307705 9:74947378-74947400 CTGGGAAAACAGGGGGAAGCAGG + Exonic
1055816322 9:80211057-80211079 GCGGGAAAAGAGATAGAGACAGG + Intergenic
1057159272 9:92875060-92875082 CTGAGAAAACAGATGGGTAGAGG + Intronic
1058140255 9:101350214-101350236 CTATTAAAACAGATAGAGACTGG - Intergenic
1059109716 9:111544153-111544175 CTAGGAAAATAGATGGGGGCTGG + Exonic
1060334694 9:122711057-122711079 CTGGGATTGCAGATGGAGTCTGG + Intergenic
1061050156 9:128190602-128190624 CTGGGAAAAAGGATGGGGATCGG + Intronic
1061067199 9:128285916-128285938 CTGGGATAAGCGATGGAGAGAGG - Intronic
1062320981 9:135990413-135990435 CTGGGATAACAGACAGAGAAGGG - Intergenic
1062633337 9:137477216-137477238 CTTGGAACAGAGATGGAGCCTGG - Intronic
1185734181 X:2485015-2485037 CTGGGAAAACAGTTCGAAGCAGG + Intronic
1186009680 X:5115563-5115585 CTGGGGAAAGATATGGAAACAGG + Intergenic
1186178500 X:6950035-6950057 CTGGTAAAAATGATGGAGTCAGG + Intergenic
1186627413 X:11309332-11309354 GTGGGAACAGAGAAGGAGACAGG + Intronic
1187235700 X:17465017-17465039 CTGGGAAGAAAGATGTAGAACGG + Intronic
1190454142 X:50609166-50609188 ATGGGAAGACAGCTTGAGACTGG + Intronic
1190584394 X:51923782-51923804 CTGGGCAAACAGCTGGCGAGTGG - Intergenic
1191110916 X:56802701-56802723 CTGGGAAACCACAGGAAGACTGG - Intergenic
1191830224 X:65407660-65407682 CTGGGCAAACAAATCCAGACGGG - Intronic
1191895135 X:65984706-65984728 CAGTGAAAACACATGGACACAGG + Intergenic
1191904654 X:66075760-66075782 CTGACAAAACAGATACAGACTGG - Intergenic
1192820876 X:74643756-74643778 CTGGGGAAAGAGATGGGAACAGG - Intergenic
1195457408 X:105084327-105084349 CTGTGAAAACAGCTGGGGACCGG + Intronic
1195476860 X:105297053-105297075 CAGGGAAAAGGGATGGAGATTGG + Intronic
1195580989 X:106502421-106502443 CTAGGACAACAAAGGGAGACAGG - Intergenic
1195857326 X:109345322-109345344 CTTGGATAACAGATGAAGAATGG - Intergenic
1196456769 X:115896399-115896421 CTCAGAGAAGAGATGGAGACTGG + Intergenic
1196687356 X:118522970-118522992 ATGGGAAAACAGATTAAGAGAGG - Intronic
1198231286 X:134692093-134692115 TTGGGAAGACGGATGGTGACAGG + Intronic
1198772751 X:140148337-140148359 CTGGGAGAAGGGATGAAGACAGG + Intergenic
1199767196 X:150949908-150949930 ATGGGAAAACTGCTGGAAACAGG - Intergenic
1200132002 X:153854890-153854912 CTGGGACACTAGAGGGAGACTGG - Intergenic
1200256789 X:154586573-154586595 CAGGGAAAGCTGCTGGAGACAGG - Exonic
1200260980 X:154617830-154617852 CAGGGAAAGCTGCTGGAGACAGG + Exonic
1200267022 X:154652198-154652220 CAGGGAAAGCTGCTGGAGACAGG + Exonic
1201727406 Y:17168972-17168994 CAGTGAAAACACATGGACACAGG - Intergenic