ID: 902725597

View in Genome Browser
Species Human (GRCh38)
Location 1:18334020-18334042
Sequence GCTTTTGTGCTGCAAGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 179}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902725593_902725597 5 Left 902725593 1:18333992-18334014 CCAATTTGTTTACACACCGATTG 0: 1
1: 0
2: 0
3: 8
4: 158
Right 902725597 1:18334020-18334042 GCTTTTGTGCTGCAAGGACAGGG 0: 1
1: 0
2: 2
3: 25
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902725597 Original CRISPR GCTTTTGTGCTGCAAGGACA GGG Intronic
900979245 1:6036952-6036974 GCTTCTGGGCTCCAAGGGCAGGG - Intronic
901118803 1:6873359-6873381 CCTTTAGTGCTAGAAGGACATGG - Intronic
902329211 1:15722798-15722820 GCATGTGTGCTGCAAGAAGAGGG - Intronic
902600685 1:17538990-17539012 GCTTTGGAGCTGCAAAGGCAGGG + Intergenic
902725597 1:18334020-18334042 GCTTTTGTGCTGCAAGGACAGGG + Intronic
904284787 1:29446905-29446927 GCCACTGTGCTGCAAGGCCAGGG + Intergenic
906554424 1:46696905-46696927 GATCTTGTGCTGCCAGGACAGGG - Intronic
906653806 1:47533555-47533577 GTATTTGGGCTGCGAGGACAAGG + Intergenic
906656498 1:47552212-47552234 GATTTTATGCTGCCAGGGCATGG - Intergenic
907271140 1:53291910-53291932 GTCTCTGTGCTGCAGGGACAGGG - Intronic
908199134 1:61776444-61776466 TCTTTTTTGTTGCAAGCACATGG - Intronic
911533088 1:99069340-99069362 GCAATTGTGATGCAAAGACAAGG + Intergenic
911873827 1:103133548-103133570 GATTTTGGGCTGAGAGGACAAGG - Intergenic
912420478 1:109539258-109539280 GCTTTTGGGAGGCAAGGGCAGGG + Intergenic
917834830 1:178933187-178933209 GCTTTTGTGCTGCAGGTTCTGGG - Intergenic
918241238 1:182622362-182622384 GCATTTCTGCTGCAACCACATGG - Intergenic
918800271 1:188961714-188961736 GGTTTTGAAATGCAAGGACAAGG + Intergenic
922060898 1:222090357-222090379 GCTTTCAAGCTGCAAGGATAAGG - Intergenic
922500927 1:226096389-226096411 GCCTCAGTGCTTCAAGGACAGGG + Intergenic
922802108 1:228369121-228369143 GCTTTTGTCTTGCAGGGCCATGG + Exonic
924298284 1:242611237-242611259 GCTTTTGAGCGGGAAGGAAAGGG + Intergenic
924571540 1:245241581-245241603 GCCATTGGGCTGCAAGGAAAGGG - Intronic
924933948 1:248752380-248752402 GCTTTGGAGCTGGAAGGACCTGG - Intronic
924941230 1:248813466-248813488 GCTTTGCTGCTGCCAGGAAAGGG + Intronic
1066163377 10:32758846-32758868 GATTTTGGGCTGAAATGACAGGG - Intronic
1066514641 10:36144190-36144212 TCTTTTGTGCTGCATTGATAGGG + Intergenic
1068433968 10:56967376-56967398 GCTGTTGTGCCTCAAGGACAGGG - Intergenic
1072314947 10:94193030-94193052 GCTTTTGTGCTACAGTGTCAGGG + Intronic
1072795953 10:98354732-98354754 GCTTCTGGGCTGCAAAAACAGGG - Intergenic
1075942777 10:126405673-126405695 GGTTTTGTGCTGCAAGAGGAGGG + Intergenic
1076036157 10:127200108-127200130 GCTTTTGTGTAACAAAGACATGG - Intronic
1076458904 10:130624705-130624727 GCTGTTCAGGTGCAAGGACAAGG + Intergenic
1076549296 10:131267632-131267654 GCTTATGGGCTCCCAGGACATGG + Intronic
1076724767 10:132408165-132408187 GCTTTGGTGCTGAAAGGATCCGG - Intronic
1077728409 11:4701372-4701394 GGTTTTGTGCTGCCATTACATGG - Intergenic
1078512709 11:11997510-11997532 GCTTCTGTGCTGCCAGGGCTGGG + Intronic
1078970332 11:16402914-16402936 GGTTTTGTTTTGAAAGGACAGGG - Intronic
1081287600 11:41290234-41290256 GCTTTTTTAATGCAATGACAGGG + Intronic
1083527093 11:63378619-63378641 GCTTTTGGGCTACAACTACAGGG - Intronic
1085061590 11:73452390-73452412 GCTTTTTGGCAGGAAGGACAGGG - Intronic
1086607696 11:88716128-88716150 GATTTTGTTCTGTAAGGTCAAGG + Intronic
1086927870 11:92660252-92660274 CCATTTGTGCTGCTGGGACAAGG + Intronic
1088168918 11:106972577-106972599 TCTTTTTTGCTGGAAGAACATGG - Intronic
1088219243 11:107550164-107550186 GCTTTTGTTCTGCAAGTACTTGG - Intronic
1090243152 11:125197972-125197994 GCATTGGTCCTGCAAGGACAAGG - Intronic
1091204723 11:133812320-133812342 GCTCTTCTCCTGAAAGGACACGG - Intergenic
1091765025 12:3114175-3114197 ACTTCTATGCTGCAAGGACAGGG - Intronic
1091969214 12:4771895-4771917 GCTTTAGTGCTACAAAGTCAGGG - Intronic
1092294469 12:7187322-7187344 GCTTTTGTGCTCCAACAGCAGGG + Intergenic
1093637543 12:21489266-21489288 GCTTTTGTGCTACAATGGCAGGG + Intronic
1098578163 12:72068362-72068384 GCTTTTGCACTTCAATGACAGGG + Intronic
1099753521 12:86808881-86808903 GCTTTTGGGCTGAGACGACAAGG - Intronic
1099934779 12:89111790-89111812 GCTGTTTTGTTGCAAGGAAATGG - Intergenic
1101992403 12:109497759-109497781 GCTTTTGTTCTGGATGCACACGG + Intronic
1105400914 13:20095184-20095206 GCTATTTTGCTACAAGGACAAGG - Intergenic
1105805759 13:23950873-23950895 GGCTCTGGGCTGCAAGGACAAGG + Intergenic
1105939523 13:25134929-25134951 TCCTTTGTGCTGCATGGACTGGG - Intergenic
1110366269 13:74689301-74689323 ACGTTTGTGCTGCAACGAAATGG - Intergenic
1110709811 13:78638064-78638086 CCTCTTGTGCTGAAAGGAGATGG - Intronic
1113131750 13:107044553-107044575 GCTTGTGTGGTGGAAAGACAAGG + Intergenic
1113344635 13:109465285-109465307 GCTTTTCTGCAGCATGCACATGG - Intergenic
1116358092 14:43957054-43957076 GCTTTTGTGCTGAAACTACGTGG - Intergenic
1117052824 14:51879013-51879035 CCTTTTGTGAACCAAGGACAGGG - Intronic
1117060192 14:51954425-51954447 CCTCTTGTGCTCTAAGGACAAGG - Intronic
1117709858 14:58516304-58516326 GCTTTTGTTCTTAAAGGAGAAGG - Intronic
1118976033 14:70677377-70677399 GCCTCTGAGCTGCAAGGAGACGG + Intergenic
1120766746 14:88334299-88334321 GCTTTTGTTGTTCAAGGAAAGGG + Intergenic
1120790898 14:88580892-88580914 ACTTTTGTGCTGGAAGAAAATGG + Intronic
1121588416 14:95079924-95079946 GCTTTTGTTTTGGATGGACATGG + Intergenic
1122733560 14:103820797-103820819 GCTTTTCTTCTGAAAGGACTAGG - Intronic
1123040494 14:105488317-105488339 GCCTTCGTGCTGCAAAGAGAAGG - Exonic
1124342468 15:28899145-28899167 ACTTCTGGGCTGCGAGGACATGG - Intronic
1124431332 15:29611246-29611268 GCTTTTGTGATGCAAAGACCAGG - Intergenic
1125100214 15:35903570-35903592 GCTTTTCTGTTGTAAGGGCAGGG + Intergenic
1125214924 15:37261023-37261045 GCTTCTGTGCAACAAAGACATGG + Intergenic
1125728607 15:41880677-41880699 GCGTCTGTGCTGCAGGGACCTGG + Intronic
1126942434 15:53781155-53781177 GGAATTGTGCTGCAAGGGCAGGG - Intergenic
1126958501 15:53962506-53962528 CCATGTGTGCTGCAAGAACAGGG - Intergenic
1127632947 15:60843123-60843145 GCTGTTCTGCTGCAAGGAAATGG + Intronic
1130300323 15:82675648-82675670 GCTTTTGTGCTACAACAGCAGGG - Intronic
1133631037 16:7621886-7621908 GCTTTTCTGCTAAAATGACAGGG - Intronic
1134303931 16:13015216-13015238 CCTTTTGTGCTGCAATGACATGG + Intronic
1134571288 16:15293287-15293309 GCTTTTGTACTACAATGGCAGGG + Intergenic
1135151153 16:20007183-20007205 GCTTTTGTGCTACAATGATAGGG + Intergenic
1135505869 16:23035672-23035694 GCTTTTGCACTACAATGACAGGG + Intergenic
1136494250 16:30632410-30632432 GCTTTTGTTGTGTATGGACATGG + Intergenic
1136612538 16:31375381-31375403 GCCTTTGTGCTGCATGTGCAAGG - Intronic
1137819404 16:51429387-51429409 GCTGTTGTGCTGGTGGGACAGGG - Intergenic
1140799631 16:78473849-78473871 GCGTGTGTGCTGCAAGGACTAGG - Intronic
1140980677 16:80105906-80105928 GCTTTTCTGCTGCAATGGCAGGG - Intergenic
1141817703 16:86424239-86424261 GCTTTTATGCTACAATGGCAGGG - Intergenic
1142642113 17:1290244-1290266 GATTTTGTCCTGCAGGAACAGGG - Intronic
1145107735 17:20133908-20133930 TCTTTTTTGTTTCAAGGACAAGG + Intronic
1147373386 17:40009558-40009580 GCTTTTGTGCTAGAAAGACAGGG - Intergenic
1147694589 17:42341793-42341815 GCTTTGGTGCTGCAGTGGCAGGG - Intronic
1147960813 17:44166649-44166671 GCTTTTGTGCCACAAGGCCAGGG + Intergenic
1148089216 17:45012875-45012897 GCAATTGTGCAGCTAGGACAGGG + Intergenic
1148247886 17:46047395-46047417 GCTTTTGTGCTACAATGACAGGG + Intronic
1153961814 18:10146735-10146757 GCTTTTGTGCTGCAGCCTCAGGG + Intergenic
1153984005 18:10336855-10336877 GGTTTTGTGCTCCATGGCCAAGG + Intergenic
1155191802 18:23437134-23437156 GGTTTTGTTTTGCAAGGAGAGGG - Intronic
1155619461 18:27760426-27760448 GCTTTTGTGCTACGACGACAGGG - Intergenic
1157692194 18:49692529-49692551 GCTTTCATGCTGCAATGGCAGGG + Intergenic
1159412045 18:68090950-68090972 GCTTTTGTATTTCAAGGACTTGG - Intergenic
1159997103 18:74976387-74976409 TCCTTTGTGCTGCAAGGCGAGGG + Intronic
1164253076 19:23501295-23501317 GATTTTGAGAGGCAAGGACAGGG - Intergenic
1165223823 19:34339890-34339912 GCTTCTCTGCAGCAGGGACATGG - Exonic
1165342052 19:35219744-35219766 GCATGTGTGGTGCAAGGAAAAGG + Intergenic
925903985 2:8528325-8528347 GCATCTGTGCACCAAGGACATGG + Intergenic
928142865 2:28745658-28745680 GCTCTTGTGCAGGAAGGAGAGGG + Intergenic
930241334 2:48938423-48938445 GCTGCTGTGCTGCAGAGACAAGG - Intergenic
931170943 2:59803162-59803184 GTATTTGTGGTGCCAGGACAGGG - Intergenic
931233404 2:60393059-60393081 GCCTTTGTACTCCAAGGACAGGG - Intergenic
932160595 2:69455946-69455968 GCTTTTGCTATCCAAGGACAGGG - Intergenic
932781415 2:74560890-74560912 GCTTAAATGCAGCAAGGACAAGG - Intronic
933874849 2:86609258-86609280 GCTTCTGTGCTGCCAGAACATGG - Intronic
934751463 2:96796752-96796774 GTTTTTGTGGAGGAAGGACAGGG - Intronic
937472401 2:122185508-122185530 GGATTTGAGCTGCAAAGACATGG - Intergenic
939566887 2:143795653-143795675 GCTTTGTTGCTACAAGGACAAGG + Intergenic
940325856 2:152424182-152424204 GTTTTTGTGCCCTAAGGACAGGG - Intronic
942961553 2:181835355-181835377 TCTTTTGTGCTGCCATAACAAGG - Intergenic
944129346 2:196330143-196330165 TCTATTGTGCTGCAGGTACATGG + Intronic
945896121 2:215483535-215483557 GATTTTGTGCTGCAACAGCAAGG - Intergenic
947541804 2:230985093-230985115 GCTTTTGAGCTTCAAGGTCCTGG - Intergenic
948896943 2:240932030-240932052 TCTGTTGTGCCACAAGGACAAGG + Intronic
1169138701 20:3213970-3213992 GTCTTTGTGCTGCAGGTACAGGG + Exonic
1169986597 20:11452031-11452053 GCTTGTGTCTTCCAAGGACATGG - Intergenic
1170302024 20:14894831-14894853 GCTTTTGTGGATCAGGGACAAGG + Intronic
1175810951 20:61856995-61857017 GCTTTTGGCCTCCAAGGCCATGG - Intronic
1175845182 20:62054543-62054565 GCTCTTGGGGTGGAAGGACATGG - Intronic
1176100026 20:63360647-63360669 CCTTTTCTGCAGGAAGGACAAGG - Intronic
1176675570 21:9774300-9774322 GCTTTTGTGCTGCAATGTACAGG + Intergenic
1180126137 21:45791463-45791485 GCTTTTGTCAAGCAAGGACAAGG + Intronic
1180703070 22:17792177-17792199 ACTTCTGTGCTCCAAGGAAAAGG - Intronic
950898321 3:16473829-16473851 GGTTTCGTGCTTCTAGGACAGGG - Intronic
950902613 3:16511883-16511905 GCTTTTTGGCTGTATGGACATGG - Intronic
956187857 3:66579570-66579592 TATTTTGTGCTGTATGGACAGGG + Intergenic
956692183 3:71888759-71888781 GCTTCTGTGCTGAAAAAACAGGG - Intergenic
957127163 3:76176354-76176376 GCTGCTGTGCTCCAAGGACAGGG + Intronic
959399672 3:105884259-105884281 GCTTTTCTGCTGCAACACCAAGG - Intergenic
959634496 3:108548501-108548523 GCTTCTGTGCTGCAATAGCAGGG + Intergenic
962866465 3:139451618-139451640 GCTTTCTTGCTGCAGGAACATGG + Intergenic
964721680 3:159773194-159773216 GCATTTGTGCTGAGAGCACAGGG - Intronic
965617770 3:170612479-170612501 AGGTCTGTGCTGCAAGGACAGGG - Intronic
967978697 3:195051529-195051551 GCTTTTGGGCTGCGAGTATAAGG + Intergenic
968349675 3:198043465-198043487 CCTCCTGGGCTGCAAGGACATGG - Intronic
969180419 4:5436390-5436412 GGTTTAGAGCTGAAAGGACATGG + Intronic
969574872 4:8030906-8030928 GCTGTTCTGCTGGAAGAACATGG - Intronic
969603980 4:8193079-8193101 GCTTTCCTGCTGTAAGGGCAGGG + Intronic
969604349 4:8194953-8194975 GGTTTGGTGCTGGAAGGACTGGG + Intronic
969687745 4:8685569-8685591 GCTTTTGTGCTACAATCTCATGG - Intergenic
969973434 4:11071977-11071999 TCTCATGTGCTGTAAGGACAGGG + Intergenic
977454406 4:97239780-97239802 TCAGTTGTGCTGCAAGGAGAGGG - Intronic
978368450 4:108006706-108006728 CCTTTTGTGGTTCTAGGACAAGG - Intronic
979410796 4:120376514-120376536 GCTTATGTGGTGGAAGGAAAGGG + Intergenic
980134962 4:128849927-128849949 GCTTTTGTGCTGTAGGTACACGG + Intronic
980453985 4:133014785-133014807 GCTTTTTGGCTGCAACAACAAGG - Intergenic
980800627 4:137744774-137744796 GCTTTTATGCAGCAAGTACAAGG - Intergenic
982339164 4:154276714-154276736 GCCTTTGTGCAGCAAGGTCTGGG - Intronic
984465891 4:180100468-180100490 GCTTGGGGGCAGCAAGGACAGGG + Intergenic
985321007 4:188711137-188711159 GATTGTGTGCTGCAGGGACTGGG + Intergenic
985399972 4:189584388-189584410 GCTTTTGTGCTGCAATGTACAGG - Intergenic
990895252 5:60692911-60692933 GCTTTTGAGCTTCAAGTAAATGG - Intronic
992070711 5:73146066-73146088 GCTTTTGTGCTATATTGACATGG + Intergenic
995379962 5:111520745-111520767 GCTTTTATGCTACAATGTCATGG + Intergenic
995674058 5:114642444-114642466 GCTTTTCTTCTGCAGGGACTTGG + Intergenic
997030551 5:130122624-130122646 GGTTTTGTGCTGTTAGGATAAGG + Intronic
998038270 5:138934818-138934840 GTTTTTCTGCTGCAAGCCCAAGG - Exonic
999124750 5:149238926-149238948 GCTTCTGTGCTGCATGCTCAGGG - Intronic
1000433893 5:161184615-161184637 GCTTTTGTGCTACAATGGCAGGG + Intergenic
1006315923 6:33291628-33291650 TCATATGTACTGCAAGGACAGGG + Intronic
1006917870 6:37607307-37607329 GCTTTTATACTGCAATGGCAGGG - Intergenic
1007679856 6:43626477-43626499 CCTGTTCTGCTGCAAGGACCAGG + Intronic
1009028692 6:58031099-58031121 GATTTTAAGCAGCAAGGACAAGG + Intergenic
1019519319 7:1453563-1453585 ATTTTTGTCCGGCAAGGACAGGG - Intronic
1019544627 7:1567752-1567774 GCTTTTGTCCTTCACGGCCACGG + Exonic
1023734667 7:43224369-43224391 GATTTTGAGCTACAAGTACACGG - Intronic
1027404242 7:77842858-77842880 GCTTTTGTGCTACAATGGCAAGG - Intronic
1027861018 7:83581380-83581402 ACTTCTGTGTTGCAAGAACAAGG + Intronic
1028255436 7:88590926-88590948 TCTCTTGTGTTGCATGGACATGG + Intergenic
1029306689 7:99624840-99624862 GCTTTGGGGCTGCCAGGGCAAGG + Intronic
1029513461 7:101011181-101011203 TCTTCCCTGCTGCAAGGACACGG - Intronic
1030014581 7:105205994-105206016 GCTCTTGTGCTGCCAGTGCACGG + Intronic
1031375137 7:121015229-121015251 GGTTTTGTACTGAAAGGACATGG - Intronic
1031762020 7:125725121-125725143 GCTTTTGTAAAGCAAGGACTTGG - Intergenic
1033084313 7:138328285-138328307 GGATTTGTGATACAAGGACAAGG - Intergenic
1033880483 7:145876117-145876139 GCTTTTGTGCTGCATTGTGATGG - Intergenic
1034060628 7:148084275-148084297 GCTTTGGTGGTGCTAGGAGAGGG + Intronic
1034569194 7:151941515-151941537 TCTTTTGGGGTGCAAGGAAAAGG - Intergenic
1035122300 7:156578870-156578892 GCTTCTGTGCTGAAGGGGCACGG + Intergenic
1037577510 8:20221802-20221824 GCCCTTGTGTTGCAGGGACATGG + Intronic
1038395938 8:27245489-27245511 CCCATTGTGCTGCAATGACAGGG - Intronic
1038489234 8:27957948-27957970 GCTTTCGTGCTGCAATAGCAGGG - Intronic
1042909448 8:73810473-73810495 GCTTTCCAGCTGCAAGGAAAAGG - Exonic
1045271104 8:100662373-100662395 GCTTGGGTGCTGCAAATACATGG - Intronic
1050835786 9:10076990-10077012 GATTTTGTTTTGCAAGGAAAAGG - Intronic
1052725334 9:32221986-32222008 GCTTTTCTGCCCCCAGGACAGGG - Intergenic
1052864683 9:33457759-33457781 GCTTTTGAGCTCCCAGGCCAGGG + Intergenic
1053365655 9:37520834-37520856 GATTTGGTACTGCAGGGACAGGG + Intronic
1054877462 9:70111882-70111904 TCTTTTGGTCTGAAAGGACAAGG + Intronic
1057261125 9:93585381-93585403 CCTTTTGTGGAGCAAGGCCAGGG + Intronic
1059004461 9:110385954-110385976 GGTTTTCTGCTGCAGGGCCACGG - Exonic
1062693201 9:137856379-137856401 GCTTTTGTGGAGAGAGGACATGG + Intronic
1186843589 X:13509193-13509215 GCTTTTGTGCTACGATGAGAAGG + Intergenic
1189235668 X:39485029-39485051 GCTTTTGTGCAGAGAGGAAAAGG - Intergenic
1195470209 X:105221150-105221172 GCTTTTGTGCTACAAGTAGTTGG - Intronic
1202135868 Y:21660630-21660652 GCTTTACTGTTGCAAAGACATGG + Intergenic