ID: 902725792

View in Genome Browser
Species Human (GRCh38)
Location 1:18335144-18335166
Sequence TGCCCCTCCACAACAAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 337}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902725792_902725799 28 Left 902725792 1:18335144-18335166 CCTGCTCTTGTTGTGGAGGGGCA 0: 1
1: 0
2: 1
3: 11
4: 337
Right 902725799 1:18335195-18335217 CCGTGAAGTCTTGCCCCCCATGG 0: 1
1: 0
2: 0
3: 1
4: 54
902725792_902725793 -1 Left 902725792 1:18335144-18335166 CCTGCTCTTGTTGTGGAGGGGCA 0: 1
1: 0
2: 1
3: 11
4: 337
Right 902725793 1:18335166-18335188 AACCAGACCAAGCTGAGCCAAGG 0: 1
1: 0
2: 0
3: 30
4: 201
902725792_902725800 29 Left 902725792 1:18335144-18335166 CCTGCTCTTGTTGTGGAGGGGCA 0: 1
1: 0
2: 1
3: 11
4: 337
Right 902725800 1:18335196-18335218 CGTGAAGTCTTGCCCCCCATGGG 0: 1
1: 0
2: 0
3: 1
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902725792 Original CRISPR TGCCCCTCCACAACAAGAGC AGG (reversed) Intronic
900121603 1:1050710-1050732 TGCCCCTCCTCACCAGGAGCAGG + Exonic
900308225 1:2021280-2021302 TGCCCCTAGACGCCAAGAGCAGG - Intronic
902725792 1:18335144-18335166 TGCCCCTCCACAACAAGAGCAGG - Intronic
904711411 1:32433210-32433232 TGCCCCTCCCCCAGAAAAGCGGG - Intergenic
904996664 1:34636637-34636659 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
905345220 1:37306726-37306748 TTCCCCTCCTCAACACAAGCTGG + Intergenic
906716742 1:47975693-47975715 TGCCGCTCTAGGACAAGAGCTGG - Intronic
906744770 1:48213931-48213953 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
907292407 1:53425216-53425238 TGCCCCTCCCCCAGAAAAGCGGG - Intergenic
907503770 1:54902594-54902616 TGCCCCTCCCCTAGAAAAGCAGG + Intergenic
907503804 1:54902715-54902737 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
908461901 1:64354657-64354679 TGCCCCTCCTCTAGAAAAGCAGG + Intergenic
908592179 1:65646682-65646704 TGCCCCTCCTCTAGAAAAGCGGG + Intergenic
908592193 1:65646746-65646768 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
908689181 1:66758227-66758249 TTCCCGTCCACAGTAAGAGCAGG + Intronic
909551215 1:76899495-76899517 TGCCCCTCCCCCAGAAAAGCGGG + Intronic
909710575 1:78645049-78645071 TGCCCCTCCACAACCATAGCTGG + Exonic
909793205 1:79701151-79701173 TGCCCCTCCCCTAGAAAAGCGGG + Intergenic
911091768 1:94022871-94022893 TGCACCTCCAGAACAGGTGCGGG - Intronic
914913864 1:151806356-151806378 TCCTTCTCCACAACAAGAGCAGG + Intronic
918567892 1:185953086-185953108 TGCCCCTCCCCCAGAAAAGCGGG + Intronic
921733184 1:218598536-218598558 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
922048217 1:221966940-221966962 TGCCCCTCCCCCAGAAAAGCGGG - Intergenic
922934583 1:229413265-229413287 TGCCCCTCCCCCAGAAAAGCGGG - Intergenic
923244547 1:232119139-232119161 TGCCCCTCCTCTAGAAAAGCAGG - Intergenic
923408868 1:233688388-233688410 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
923408902 1:233688513-233688535 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
924180399 1:241434750-241434772 TGCCCCTCCTCCAGAAAAGCGGG - Intergenic
1063509813 10:6634360-6634382 TGCCCCTCCTCTAGAAAAGCGGG + Intergenic
1063509825 10:6634424-6634446 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
1065078551 10:22104983-22105005 CGCCCCTCCCCACAAAGAGCTGG - Intergenic
1065761914 10:28990578-28990600 ATCCCCTCCACAACCAGAACAGG + Intergenic
1067337127 10:45374737-45374759 TTCCCCTCCACTTCAAGATCTGG + Intronic
1068810999 10:61256257-61256279 TGCCCCTCCACAATGAGGGTAGG - Intergenic
1069909048 10:71748819-71748841 TGCCCCTCCCCAGCAGCAGCAGG + Exonic
1071700255 10:87924153-87924175 TGCTCCGCCAAAACAAGAGTGGG - Intronic
1071783385 10:88872386-88872408 TGCCCCTCTCCAAAAAGAGAAGG - Intergenic
1071960887 10:90808305-90808327 TGCCCCTCCTCTAGAAAAGCGGG - Intronic
1071960919 10:90808426-90808448 TGCCCCTCCCCCAGAAAAGCAGG - Intronic
1073070176 10:100788359-100788381 TGCCCCTCCAGAAGGAGAGCCGG - Intronic
1074875882 10:117613137-117613159 TGGCCCTCCAAAACCAGAGTAGG - Intergenic
1077459518 11:2701791-2701813 TGCCCCTGACCAAAAAGAGCAGG + Intronic
1077584744 11:3442622-3442644 TGCCTCTTTAAAACAAGAGCTGG + Intergenic
1080028131 11:27633886-27633908 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
1084232101 11:67760666-67760688 TGCCCCTCCCCAAGAAAAGTGGG - Intergenic
1084355354 11:68634715-68634737 TGCCCCTCCTCTAGAAAAGCGGG - Intergenic
1084613529 11:70219273-70219295 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
1084664978 11:70571526-70571548 TGCCCCACCCCAGCAATAGCTGG + Intronic
1084830691 11:71766667-71766689 TGCCTCTTTAAAACAAGAGCTGG - Intergenic
1087314420 11:96588660-96588682 TGCCCCTCTCCCACAAAAGCGGG - Intergenic
1089867256 11:121642635-121642657 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
1089987160 11:122825292-122825314 TGCCCCTCCTCCAGAAAAGCAGG - Intergenic
1092411901 12:8259934-8259956 TGCCTCTTTAAAACAAGAGCTGG + Intergenic
1092474265 12:8805852-8805874 TGCCCCTCCTCTACAAAAGCGGG - Intergenic
1092751954 12:11727334-11727356 AGCGCCTACACAACAAAAGCTGG - Intronic
1092789481 12:12059238-12059260 TGCCCCTCCCCCAGAAAAGCGGG - Intronic
1093539371 12:20263176-20263198 AGCCCCTCCACATAAAGACCAGG + Intergenic
1093584719 12:20821704-20821726 TGCCCCTCCCCCAGAAAAGCGGG + Intronic
1095919254 12:47513033-47513055 TCCCCCTCCACAACAGGCCCTGG - Intergenic
1097266504 12:57748665-57748687 TGCCCACCCACAACAATACCTGG + Intronic
1098278091 12:68833664-68833686 TGCTCCTGCATTACAAGAGCGGG - Intronic
1098947344 12:76603152-76603174 TGCCCCTCTACAAATAGACCAGG + Intergenic
1100561103 12:95749921-95749943 TGCCCCTCCCCCAGAAAAGCGGG - Intronic
1100561122 12:95749985-95750007 TGCCCCTCCCCCAGAAAAGCGGG - Intronic
1100561136 12:95750049-95750071 TGCCCCTCCTCTAGAAAAGCAGG - Intronic
1100940069 12:99716055-99716077 TGCCCCTCCCCCAGAAAAGCGGG - Intronic
1101211060 12:102535284-102535306 TGCCTCGCCACTACAAAAGCGGG + Intergenic
1102542311 12:113630265-113630287 ATCCCCTCCACCACAAAAGCAGG + Intergenic
1107075361 13:36317353-36317375 TGCCCCTCCTCTAGAAAAGCAGG - Intronic
1107220543 13:37974076-37974098 TGCCCCTCCCCCAGAAAAGCAGG + Intergenic
1107635578 13:42389056-42389078 TACCCCTCCAAAACAAAAGAAGG + Intergenic
1107990533 13:45815121-45815143 TGCCCCTCTCTAGCAAGAGCTGG - Intronic
1108292123 13:48972393-48972415 TCCCCCTCCCCGCCAAGAGCAGG - Intergenic
1108528321 13:51304511-51304533 TGCCCCAACACCAGAAGAGCAGG - Intergenic
1108913631 13:55583041-55583063 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
1108947246 13:56041338-56041360 TGCCCCTCCTCTAGAAAAGCAGG - Intergenic
1110845096 13:80184420-80184442 TGCCCCTCCCCCAGAAAAGCAGG - Intergenic
1110978232 13:81866966-81866988 TGCCCCTCCCCCAGAAAAGCGGG - Intergenic
1111126229 13:83912930-83912952 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
1112236605 13:97643174-97643196 TGCCCCTCCCCCAGAAAAGCAGG - Intergenic
1112236634 13:97643299-97643321 TGCCCCTCCTCCAGAAAAGCAGG - Intergenic
1113596530 13:111537855-111537877 AGGCCCTCCACACCAAGACCTGG + Intergenic
1115435142 14:33363335-33363357 TGCCCCTCCACAATGTCAGCAGG - Intronic
1117958111 14:61138148-61138170 TGCCCCTCCCCCAGAAAAGCAGG + Intergenic
1118937546 14:70301060-70301082 TGCCCCTCCCCCAGAAAAGCAGG + Intergenic
1119022232 14:71125315-71125337 TGCCCCTCCCCCAGAAAAGCGGG - Intergenic
1120660169 14:87239783-87239805 TGCCCCTCCCCTAGAAAAGCGGG + Intergenic
1121096860 14:91223428-91223450 TCCTCCTCCACAACAAAGGCAGG - Intronic
1121703447 14:95973931-95973953 TGCCCCTCCCCCAGAAAAGCGGG - Intergenic
1125738177 15:41943029-41943051 TGCCCCTCCCCACCAAGTGCTGG - Intronic
1126001991 15:44219390-44219412 TGCCCTTCCCCAAAAAGAGTTGG - Intergenic
1128353770 15:66909940-66909962 TGCCCTTCCTCAGCAAGGGCAGG - Intergenic
1128528085 15:68426026-68426048 TGCCCATCAGCAACAAGGGCTGG + Intronic
1130854890 15:87832191-87832213 TGCCCCTCCTCTAGAAAAGCAGG - Intergenic
1131683955 15:94751621-94751643 TGCCCCTCCCCCAGAAAAGCGGG - Intergenic
1132262765 15:100441069-100441091 TGCCCCTCCCCCAGAAAAGCGGG - Intronic
1133215958 16:4292657-4292679 TGCCCCTCCCCAGGGAGAGCTGG - Intergenic
1133632533 16:7635046-7635068 TTCCCCTCAACAAGAGGAGCAGG - Intronic
1134092016 16:11396544-11396566 TGACCCTCCAAAACCACAGCAGG - Exonic
1135102948 16:19622909-19622931 TCCTCCTCCACAACAAGTGGAGG + Intronic
1135427378 16:22350252-22350274 AGCCCCACCCCAACAAGAGTTGG - Intronic
1137426362 16:48384802-48384824 GGACCCTCCACAACAAAGGCCGG + Intronic
1139039536 16:62984191-62984213 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
1139039636 16:62984560-62984582 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
1139339589 16:66259403-66259425 TGCCCCGCCCCAGCTAGAGCAGG + Intergenic
1139802088 16:69530952-69530974 TGCCCCTCCTCGCCCAGAGCAGG + Intergenic
1139943936 16:70625532-70625554 TGCCCCTCCCCCAGAAAAGCGGG + Intronic
1140456772 16:75110214-75110236 CCCACCCCCACAACAAGAGCAGG - Exonic
1143386676 17:6535115-6535137 GGCCCCACCACAACTAGAGTTGG + Intronic
1145006845 17:19343120-19343142 AGCCCCTCCCCCACAGGAGCTGG - Intronic
1147903918 17:43810414-43810436 TCCCCCTCCCCAACCAGGGCAGG - Intronic
1147934284 17:44002493-44002515 TCCCCCTCTACAACAACAGAGGG + Intronic
1148075109 17:44931264-44931286 TGCCCCTCCACAGCAAGGAGGGG - Intronic
1150001821 17:61445128-61445150 TGTCCCTCCACACCCAGGGCTGG + Intergenic
1150210444 17:63438562-63438584 TTCCCCTCCACACCAGGGGCGGG + Intronic
1150711618 17:67535196-67535218 TGCCCCTGCAAATCAACAGCTGG - Intronic
1151622264 17:75253501-75253523 TGCCCCTCCCCCAGAAAAGCAGG - Intronic
1152610145 17:81311413-81311435 CTCCCCTCCACATCAGGAGCTGG - Exonic
1155173627 18:23285090-23285112 TGCCCCTCCCCCAGAAAAGCAGG - Intronic
1155697205 18:28697780-28697802 TGCCCCTCCCCTAGAAAAGCGGG + Intergenic
1155697239 18:28697904-28697926 TGCCCCTCCTCCAGAAAAGCGGG + Intergenic
1155697255 18:28697968-28697990 TGCCCCTCCCCCAGAAAAGCAGG + Intergenic
1155941311 18:31804632-31804654 TGCCCCTCCCCTAGAAAAGCGGG - Intergenic
1158213026 18:55071153-55071175 TGACCCTCCAGACCCAGAGCTGG + Intergenic
1158336168 18:56416531-56416553 TGCCCCTCCTCCAGAAAAGCGGG - Intergenic
1158336186 18:56416595-56416617 TGCCCCTCCCCCAGAAAAGCGGG - Intergenic
1158336199 18:56416659-56416681 TGCCCCTCCTCTAGAAAAGCGGG - Intergenic
1160255172 18:77242464-77242486 TGCCCCTCCACCCCATGAGTAGG + Intergenic
1161553796 19:4929111-4929133 TGCCCCCCCCCCACAAGGGCTGG + Intronic
1163712669 19:18856056-18856078 TGGCCCTGCACAACCAGATCAGG + Exonic
1164459491 19:28434870-28434892 TGCCCCTCCCCCAGAAAAGCAGG + Intergenic
1164965171 19:32477094-32477116 TGCCCCTCTGGAACAATAGCAGG + Intronic
1165497204 19:36160101-36160123 TGCCCCTCCCCGAGAAAAGCGGG + Intergenic
1165510547 19:36264314-36264336 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
1165835139 19:38750515-38750537 TGCCCCTCCCCCAGAAAAGCGGG - Intronic
1166291230 19:41864841-41864863 TGCAGCTCCACATCAAAAGCTGG + Intronic
1167046812 19:47054496-47054518 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
1167099211 19:47393731-47393753 TGCCCCTCCCCCAGAAAAGCGGG - Intergenic
1168716848 19:58533907-58533929 TGACCCTACACAACAAGGGCCGG + Intronic
925829074 2:7877580-7877602 TGCCCCTCCCCCAGAAAAGCAGG + Intergenic
925829109 2:7877708-7877730 TGCCCCTCCCCCAGAAAAGCAGG + Intergenic
925829127 2:7877772-7877794 TGCCCCTCCCCCAGAAAAGCAGG + Intergenic
926345004 2:11936876-11936898 AACCCCTTCACAACCAGAGCTGG + Intergenic
926407548 2:12570693-12570715 TGCCCCTCCCCCAGAAAAGCGGG - Intergenic
926464308 2:13168781-13168803 TGCCCCTCCCCCACAAAAGCGGG + Intergenic
926763864 2:16305154-16305176 TGCACCTCCACAAAGATAGCAGG - Intergenic
927590963 2:24357461-24357483 TGCCCCCCCACAACAGGTCCTGG - Intronic
929076890 2:38085524-38085546 TGCCCCTCCTCTAGAAAAGCAGG + Intronic
929793308 2:45039280-45039302 TGCCCCTCCTCCAGAAAAGCAGG + Intergenic
931042496 2:58315139-58315161 TGCCCCTCCTCTAGAAAAGCGGG - Intergenic
932295594 2:70621358-70621380 TGCCCCTCCCCCAGAAAAGCAGG - Intronic
932466721 2:71928876-71928898 TGCCCCTCCACTTAAAGAGAGGG + Intergenic
934578086 2:95415681-95415703 AGCCCTTCCACAACCAGAGCTGG - Exonic
934601353 2:95661023-95661045 AGCCCTTCCACAACCAGAGTTGG + Intergenic
935803046 2:106717631-106717653 TGGCCCTCACCAACATGAGCAGG - Intergenic
936175794 2:110218981-110219003 TGCCCCTCCCCCAGAAAAGCAGG - Intergenic
936534722 2:113303191-113303213 AGCCCTCCCACAACCAGAGCTGG + Intergenic
937368082 2:121279523-121279545 GGCCCCTCCACAATGAGAGGGGG + Intronic
939083369 2:137687774-137687796 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
939435538 2:142172589-142172611 TGCCAGCCCACAACAAGATCAGG + Intergenic
942067586 2:172286100-172286122 TGCCCCTCCAACACAACGGCTGG + Intergenic
942641604 2:178066723-178066745 TGGCCCTCCTCACCCAGAGCTGG + Intronic
943834959 2:192507061-192507083 TGCCCCTCCCCCAGAAAAGCGGG - Intergenic
944387251 2:199180396-199180418 TGCCCCTCCCCTAGAAAAGCAGG - Intergenic
945173219 2:207018077-207018099 TGCCCCTCCCCCAGAAAAGCAGG - Intergenic
945301677 2:208220937-208220959 TGCCCCTCCCCCAGAAAAGCAGG + Intergenic
945589469 2:211711912-211711934 TGCTCCTCACCAACAAAAGCAGG - Intronic
946089518 2:217208211-217208233 TTCCCCTCCACTTCCAGAGCGGG - Intergenic
946113638 2:217442811-217442833 TTGCCCTCCATAACATGAGCAGG - Intronic
946215233 2:218178725-218178747 TGCCCCTCCTCCAGAAAAGCAGG + Intergenic
946781260 2:223194635-223194657 TGCCCCTCCCCCAGAAAAGCGGG + Intronic
946964533 2:225023687-225023709 TGCACCTGCACACCAAGAGATGG + Intronic
948390409 2:237607646-237607668 TGCCCCTCCCCCAGAAAAGCGGG - Intergenic
948483147 2:238262947-238262969 TGGCCATCCACAAAAAGAGTAGG - Exonic
1172937941 20:38633944-38633966 TGCCCTTCCACAAGAGGACCTGG - Intronic
1173118679 20:40270086-40270108 TGCCCCTCCCCCAGAAAAGCGGG - Intergenic
1173529823 20:43760710-43760732 TGCCCCTCCCCAACAAGGCTGGG - Intergenic
1173781443 20:45760333-45760355 TGCCCCTCCCCTAGAAAAGCAGG - Intronic
1181382744 22:22520036-22520058 TGCTCCTCTAAAACTAGAGCTGG - Intronic
1184710733 22:46247932-46247954 TGCTCCCCCACAGCTAGAGCAGG + Intronic
949162300 3:895402-895424 TGCCCCTCCTCTAGAAAAGCGGG + Intergenic
949162328 3:895523-895545 TGCCCCTCCCCTAGAAAAGCGGG + Intergenic
949670918 3:6398499-6398521 TGCCCCTCCCCCAGAAAAGCAGG - Intergenic
949670948 3:6398620-6398642 TGCCCTTCCCCTACAAAAGCGGG - Intergenic
949688929 3:6612198-6612220 TGCCTATCAACACCAAGAGCAGG + Intergenic
949827207 3:8177882-8177904 TGCCCCTCCCCCAGAAAAGCAGG - Intergenic
952663684 3:35879184-35879206 TGCCCCTCCCCCAGAAAAGCAGG + Intergenic
952895505 3:38075889-38075911 TGCCCCTCCCCTAGAAAAGCGGG + Intronic
952896770 3:38082776-38082798 TGCCCCTCCCCCAGAAAAGCGGG + Intronic
953077352 3:39582615-39582637 TGCCCCTCCTCTAGAAAAGCGGG + Intergenic
957295002 3:78324679-78324701 TGCCCCTCCTCTAGAAAAGCAGG - Intergenic
957301824 3:78401509-78401531 TGACCCTGCCCAACAAGAGTCGG - Intergenic
957486581 3:80870418-80870440 TGCCCCTCCCCAACTGCAGCTGG - Intergenic
960158735 3:114325903-114325925 TACCCCTCCACCACAAAAGAAGG - Intergenic
961711860 3:128834026-128834048 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
963058365 3:141205769-141205791 TGCCCCTCCCCCAGAAAAGCAGG - Intergenic
963124488 3:141802646-141802668 TGCCCCTCCACTTTCAGAGCTGG + Intronic
963456873 3:145555908-145555930 TGCCCCTCCCCTAGAAAAGCAGG + Intergenic
963468398 3:145711304-145711326 TGCCCCTCCCCCAGAAAAGCAGG - Intergenic
963468428 3:145711429-145711451 TGTCCCTCCACCAGAAAAGCAGG - Intergenic
963684111 3:148415269-148415291 TGCCCCTCCCCCAGAAAAGCGGG - Intergenic
963684124 3:148415333-148415355 TGCCCCTCCTCTAGAAAAGCGGG - Intergenic
963764661 3:149322374-149322396 TTCCACTCCACAACATGTGCAGG + Exonic
964906725 3:161726646-161726668 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
964906760 3:161726767-161726789 TGCCCCTCCCCTAGAAAAGCCGG + Intergenic
965070099 3:163908397-163908419 TGCCCCTCCTCTAGAAAAGCGGG - Intergenic
965105450 3:164346959-164346981 TGCCCCTCCTCCAGAAAAGCAGG + Intergenic
965262845 3:166505472-166505494 TGCCCCTCCTCCAGAAAAGCGGG + Intergenic
965262857 3:166505536-166505558 TGCCCCTCCCCCAGAAAAGCAGG + Intergenic
965336122 3:167432147-167432169 TGCCCCTCCTCCAGAAAAGCAGG - Intergenic
965625084 3:170677258-170677280 TGCCCCTCCCCCAGAAAAGCAGG + Intronic
965626580 3:170688323-170688345 TGCCCCTCCCCCAGAAAAGCAGG + Intronic
965640258 3:170822763-170822785 TGCCTCTCCACCAGAAAAGCGGG + Intronic
965640289 3:170822884-170822906 TGCCCCTCCCCTAGAAAAGCGGG + Intronic
966066568 3:175828395-175828417 TGCCCCTCCCCCAGAAAAGCAGG - Intergenic
966066601 3:175828516-175828538 TGCCCCTCCCCTAGAAAAGCAGG - Intergenic
966105279 3:176326306-176326328 TGCCCCTCCCCCAGAAAAGCAGG + Intergenic
966806412 3:183811061-183811083 AGCCCCTCCACACCAAGGCCAGG - Exonic
966881676 3:184354361-184354383 AGACCCTCCACAACCAGGGCAGG + Intronic
967151892 3:186658632-186658654 TGCCCCTCCCCTAGAAAAGCGGG - Intergenic
967624863 3:191671256-191671278 TGCCCCTGCTCTAGAAGAGCGGG + Intergenic
967624876 3:191671320-191671342 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
967644025 3:191900098-191900120 TGCCCCTCCCCTAGAAAAGCGGG + Intergenic
967740254 3:192996517-192996539 TGCCCCTCCCCCAGAAAAGCAGG - Intergenic
968690614 4:1987946-1987968 TGCCCTTCCACGCCAAGGGCCGG - Exonic
969754078 4:9136172-9136194 TGCCTCTTTAAAACAAGAGCTGG - Intergenic
969809919 4:9639854-9639876 TGCCCCTCCCCCAGAAAAGCGGG - Intergenic
970029414 4:11658393-11658415 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
970041885 4:11807205-11807227 TGCCCCTCCTCCAGAAAAGCAGG - Intergenic
970532525 4:16998648-16998670 TGCCCATCCCCAAGAAAAGCGGG - Intergenic
970854276 4:20635085-20635107 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
973807453 4:54539866-54539888 TGCTCTTCCCCAACCAGAGCTGG + Intergenic
976696331 4:87922825-87922847 TGCCCCTCCGCCAGAAAAGCGGG - Intergenic
977010114 4:91625082-91625104 TGCCCCTCCTCTAGAAAAGCGGG - Intergenic
979850522 4:125566411-125566433 TGCCCCTCCTCTAGAAAAGCGGG + Intergenic
979895367 4:126149865-126149887 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
980284766 4:130768397-130768419 TGCCCCTCCCCTAGAAAAGCGGG - Intergenic
980527658 4:134013081-134013103 TGCCTCTCCCCAAGAAAAGCAGG - Intergenic
980611970 4:135172020-135172042 TGTCCCTCCCCCAGAAGAGCGGG + Intergenic
980903717 4:138928808-138928830 TGCCCCTCCCCCAGAAAAGCAGG - Intergenic
981040047 4:140214550-140214572 TGCCCCTCCCCAAGAAAAGCAGG - Intergenic
981524952 4:145699918-145699940 TGCCCCTCCCCCAGAAAAGCGGG - Intronic
981528518 4:145731403-145731425 TGCACCACAAAAACAAGAGCAGG - Intronic
982084140 4:151817227-151817249 TGCCCCTCCCCTAGAAAAGCGGG + Intergenic
983447842 4:167877171-167877193 TGCCCCTCCCCCAGAAAAGCGGG - Intergenic
983659358 4:170117299-170117321 TGCCCCTCCCCCAGAAAAGCAGG - Intergenic
984099228 4:175466057-175466079 TGCCCCTTCACCAGAAAAGCGGG + Intergenic
984321950 4:178207993-178208015 TGCCCCTCCCCCAGAAAAGCAGG - Intergenic
985510069 5:308417-308439 TGCCGCTGCACAACACAAGCAGG - Intronic
985582083 5:703546-703568 TGCCCCTCCCCCAGAAAAGCGGG - Intergenic
985582146 5:703793-703815 TGCCCCTCCCCCAGAAAAGCGGG - Intergenic
986196186 5:5538015-5538037 TGACCCCCCAAAACAAGAGGAGG - Intergenic
986555926 5:9009487-9009509 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
992618431 5:78568790-78568812 TGCCCATCCACAGCAAGAATGGG + Intronic
992960594 5:81954092-81954114 TGCCCCTCCCCCAGAAAAGCGGG - Intergenic
993192495 5:84699386-84699408 TGCCCCTCCCCCAGAAAAGCGGG - Intergenic
993836488 5:92824884-92824906 TGCCCCTCCCCCAGAAAAGCAGG - Intergenic
994294958 5:98080105-98080127 TGCCCCTCCCCCAGAAAAGCGGG - Intergenic
994532731 5:100988940-100988962 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
994532795 5:100989187-100989209 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
994556727 5:101315888-101315910 TGCCCCTCCTCCAGAAAAGCGGG - Intergenic
994989342 5:106979381-106979403 TGCCCCTCCTCTAGAAAAGCGGG - Intergenic
995131615 5:108636430-108636452 TGCCCCTGCAAAAGAAGTGCAGG + Intergenic
995899606 5:117051232-117051254 TGCCCCTCCTCCAGAAAAGCGGG + Intergenic
997746211 5:136302350-136302372 TGCCCCTCCCCCAGAAAAGCGGG - Intronic
998176710 5:139905673-139905695 TGCCCCCCCCCCACCAGAGCTGG - Intronic
999619090 5:153454495-153454517 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
999712329 5:154329622-154329644 TCCCCTTCCACAACGAGGGCTGG + Exonic
1000935889 5:167302787-167302809 TGCCCCTCCCCCAGAAAAGCGGG + Intronic
1002599207 5:180344780-180344802 TGCCCCTCGACAAGAGGGGCCGG + Intronic
1003430390 6:6032590-6032612 TGCCCCTCCCCCAGAATAGCGGG + Intergenic
1004768802 6:18758886-18758908 TGCCCCTCCTCTAGAAAAGCGGG + Intergenic
1007991492 6:46260653-46260675 TGCCCCACCAGAACAAGCCCTGG - Intronic
1010586923 6:77665343-77665365 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
1010586976 6:77665532-77665554 TGCCCCTTCCCCAGAAGAGCGGG + Intergenic
1012014586 6:93834765-93834787 TGCCCCTCCTCTAGAAAAGCGGG + Intergenic
1012315602 6:97780533-97780555 TGCCCCTCCTCTAGAAAAGCAGG - Intergenic
1012952176 6:105530066-105530088 AGCCCCTCCACAATAGAAGCTGG + Intergenic
1013408103 6:109860564-109860586 TGCCCCTCCTCTAGAAAAGCAGG + Intergenic
1014455087 6:121625192-121625214 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
1014555641 6:122840841-122840863 TGCCCCTCCTCTAGAAAAGCGGG - Intergenic
1014614872 6:123587013-123587035 TGCCCCTCCTCTAGAAAAGCGGG + Intronic
1014718412 6:124891424-124891446 TGCCCCTCCCCCAGAAAAGCGGG - Intergenic
1014794201 6:125706593-125706615 TGCCCCTCCTCTAGAAAAGCGGG + Intergenic
1015323625 6:131902640-131902662 TGCCCCTCCTCTAGAAAAGCGGG - Intergenic
1015801623 6:137066226-137066248 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
1016183054 6:141170852-141170874 TGCCCCCCCACCACAAGGGGTGG - Intergenic
1017441390 6:154467234-154467256 TGCCTCTCCAAAACAAGAAACGG - Intronic
1018084707 6:160291308-160291330 TGCCCCTCCCCTAGAAAAGCGGG + Intergenic
1018084741 6:160291429-160291451 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
1018495666 6:164343768-164343790 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
1020324143 7:6961429-6961451 TGCCCCTCCCCCAGAAAAGCAGG + Intergenic
1022372698 7:29785975-29785997 TGCCCCTCCCCCAGAAAAGCAGG - Intergenic
1022854935 7:34304651-34304673 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
1025117932 7:56274374-56274396 TACCCTTCCACATCCAGAGCAGG - Intergenic
1028689988 7:93640925-93640947 TGCCCCTCCCCTAGAAAAGCGGG - Intronic
1028914598 7:96244194-96244216 AGCCCCTCCCCATCAAGAGGAGG + Intronic
1031004467 7:116456523-116456545 TGCCCCTCCCCCAGAAAAGCGGG - Intronic
1031364976 7:120890500-120890522 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
1031422674 7:121568787-121568809 TGCCCCTCCTCCAGAAAAGCAGG + Intergenic
1031776114 7:125910923-125910945 TGCCCCTCCTCTAGAAAAGCGGG - Intergenic
1032558013 7:132857957-132857979 TGCTTCTCCACAAGAAGAACTGG + Intronic
1033909688 7:146248219-146248241 TGCCCCTCCTCTAGAAAAGCAGG + Intronic
1034496645 7:151427305-151427327 TGGCCCCCAACACCAAGAGCGGG - Intergenic
1035759436 8:2058695-2058717 AGCACCTCCGCATCAAGAGCAGG - Intronic
1036377293 8:8211509-8211531 TGCCTCTTTAAAACAAGAGCTGG - Intergenic
1036852255 8:12211642-12211664 TGCCTCTTTAAAACAAGAGCTGG + Intergenic
1036873623 8:12454163-12454185 TGCCTCTTTAAAACAAGAGCTGG + Intergenic
1038218163 8:25581946-25581968 TTCCCATCAACAACATGAGCTGG + Intergenic
1043485263 8:80692952-80692974 GGCCCCTTGACACCAAGAGCAGG - Intronic
1043718113 8:83509928-83509950 TGCCCCTCCGCCAGAAAAGCAGG + Intergenic
1044921727 8:97175912-97175934 TGCCCCTCCCCCAGAAAAGCGGG - Intergenic
1044921762 8:97176037-97176059 TGCCCCTCCCCCAGAAAAGCAGG - Intergenic
1045644546 8:104286800-104286822 TGCCCCTTCCCAAGAAAAGCGGG - Intergenic
1046293893 8:112196737-112196759 TGCCCCTCCCCCAGAAAAGCAGG - Intergenic
1046293927 8:112196862-112196884 TGCCCCTCCCCCAGAAAAGCGGG - Intergenic
1047055542 8:121160523-121160545 TGCCACTCCACTGCAAGAACTGG + Intergenic
1047856156 8:128915328-128915350 TGCCCCTCCCCTAGAAAAGCGGG - Intergenic
1048097401 8:131311146-131311168 TGCCCCTCCCCTAGAAAAGCGGG - Intergenic
1048135257 8:131741612-131741634 TGCCCCTCCCCCAGAAAAGCGGG - Intergenic
1048764432 8:137829558-137829580 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
1048764467 8:137829683-137829705 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
1049869017 8:144958985-144959007 TGCCCCTCCCCCAGAAAAGCAGG + Intergenic
1049869050 8:144959106-144959128 TGCCCCTCCCCTAGAAAAGCAGG + Intergenic
1055232840 9:74086606-74086628 TGCCCCTCCCCCAGAAAAGCGGG - Intergenic
1055809830 9:80138315-80138337 TGCCCCTCCTCTAGAAAAGCGGG - Intergenic
1056013252 9:82354775-82354797 TGCCCCTCAAATACAAGAGAAGG - Intergenic
1056131132 9:83587533-83587555 TGCACACCCACATCAAGAGCTGG + Intergenic
1056433227 9:86549315-86549337 TGCCCCTTCAAAAAATGAGCTGG + Intergenic
1059546379 9:115179447-115179469 TGCCCCTCCCCAAGAAAAGCAGG + Intronic
1059574349 9:115474093-115474115 TGCCCCTCCCCTAGAAAAGCGGG - Intergenic
1060318663 9:122535266-122535288 TGCCCCTCCCCCAGAAAAGCAGG + Intergenic
1062724525 9:138064219-138064241 TGCCCCTCCCCAAGGAGATCTGG - Intronic
1203792432 EBV:159040-159062 TGTCCCTCTACAACAAGACCTGG - Intergenic
1185858752 X:3558998-3559020 TGCCCCTCCCCTAGAAAAGCAGG + Intergenic
1186455179 X:9704995-9705017 TGCCAGTCCACATCAAGGGCAGG - Exonic
1187100129 X:16183545-16183567 TGCCCCTCCTCCAGAAAAGCGGG + Intergenic
1193941287 X:87682836-87682858 TGCCCCTCCCCCAGAAAAGCAGG - Intergenic
1194822977 X:98529026-98529048 TGCCCCTCCCCCAGAAAAGCGGG + Intergenic
1195841270 X:109179360-109179382 TGCCCCTCCACCAGAAAAGTGGG - Intergenic
1196072859 X:111544833-111544855 TGCCCCTCCTCTAGAAAAGCAGG - Intergenic
1196165329 X:112531553-112531575 TGCCCCTCCTCTAGAAAAGCGGG - Intergenic
1197665012 X:129214061-129214083 TATCCCTCCACATCAAGAGGTGG + Intergenic
1197932846 X:131712908-131712930 TGCCCCTCCCCTAGAAAAGCGGG - Intergenic
1199256642 X:145725472-145725494 TGCCCAACCACAACAAGAAGAGG - Intergenic
1199576259 X:149316618-149316640 TGCCCCTCCCCTAGAAAAGCGGG - Intergenic
1200675130 Y:6140207-6140229 TGCCCCTCCCCTAGAAAAGCGGG - Intergenic
1200765943 Y:7080734-7080756 TGCCAGTCCACATCAAGGGCGGG - Exonic
1201578009 Y:15480893-15480915 TGCCCCTCCAAAAAAAAAGAAGG + Intergenic
1202076774 Y:21044264-21044286 TGCCCCTCCCCCAGAAAAGCAGG + Intergenic