ID: 902727451

View in Genome Browser
Species Human (GRCh38)
Location 1:18346702-18346724
Sequence CAGGGCCTATGGACCTCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 77}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902727440_902727451 16 Left 902727440 1:18346663-18346685 CCAGCGATCGCAGAAAATGGGCC 0: 1
1: 0
2: 0
3: 0
4: 46
Right 902727451 1:18346702-18346724 CAGGGCCTATGGACCTCTACAGG 0: 1
1: 0
2: 2
3: 6
4: 77
902727447_902727451 -5 Left 902727447 1:18346684-18346706 CCGTTGGGGTGGAGAGGCCAGGG 0: 1
1: 1
2: 1
3: 39
4: 328
Right 902727451 1:18346702-18346724 CAGGGCCTATGGACCTCTACAGG 0: 1
1: 0
2: 2
3: 6
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902727451 Original CRISPR CAGGGCCTATGGACCTCTAC AGG Intronic
902727451 1:18346702-18346724 CAGGGCCTATGGACCTCTACAGG + Intronic
902881065 1:19372015-19372037 CAGGGCCCAAGGGCCTCTCCAGG - Intronic
910014806 1:82508607-82508629 CATGCCCTAGGCACCTCTACAGG - Intergenic
912367704 1:109148588-109148610 CAGGGCTTCTGTAACTCTACTGG - Intronic
916743841 1:167669343-167669365 CAAGGCCTATTGGCCTCCACAGG + Intronic
920305473 1:205015576-205015598 CAGGGCCTATGGGCCTCAGAAGG + Intronic
921712979 1:218391320-218391342 CAGGGGCTCTGGACCTGTACAGG - Intronic
923216275 1:231851032-231851054 CAGGGCATACCGACCTCTCCAGG - Intronic
1072722652 10:97790335-97790357 CAGGCCCTATGGACCTGGCCGGG - Intergenic
1076048263 10:127312412-127312434 CAGGCCCTATGCACTTCTGCAGG + Intronic
1077895275 11:6449012-6449034 CAGGGCCTCTGTACAGCTACTGG + Exonic
1084704123 11:70806123-70806145 CCGGGCCTACTGACCTCTAAGGG + Intronic
1088845527 11:113662981-113663003 CATGGCCTGTGGACCCCTAGTGG - Intergenic
1091381889 12:67146-67168 CAGGGCCCAGGAACCTCTCCAGG + Exonic
1091396172 12:155394-155416 CAGGGCCCATGGCCATCTTCAGG - Intronic
1094493933 12:30977757-30977779 CAGGGCCCATGTCCTTCTACAGG + Intronic
1094530576 12:31270777-31270799 AATGGCCTATGGACCTTTCCTGG - Intergenic
1095457256 12:42401437-42401459 CTGGGCTTGTGGACCGCTACTGG + Intronic
1101394753 12:104336736-104336758 CAGGCACTATAGAGCTCTACAGG + Intronic
1102652410 12:114451524-114451546 CAGGGCCTGTGGAACCCGACTGG + Intergenic
1103535476 12:121630773-121630795 CTGGGCTTAAGGAGCTCTACGGG - Intronic
1104025800 12:125025267-125025289 CCGGGCCCATGGGCTTCTACTGG + Exonic
1104475416 12:129066928-129066950 CAGGAATTATGGGCCTCTACTGG + Intergenic
1104624584 12:130340591-130340613 CACGCCCCATGGACCTGTACCGG - Intronic
1107151083 13:37112496-37112518 TGCTGCCTATGGACCTCTACGGG + Intergenic
1114002860 14:18279746-18279768 GAGGGCTTTTGGACCTCTAGAGG - Intergenic
1116983788 14:51198001-51198023 CAGGGTCTATGGACCGGAACTGG + Intergenic
1118914096 14:70086984-70087006 CAGGGCCTTTGGAACTTCACGGG - Intronic
1121065398 14:90959169-90959191 CAGGGCTTATGGACCTTTACTGG + Intronic
1136568992 16:31085786-31085808 CAGGCACTTTGGAACTCTACAGG - Intronic
1136687489 16:32003739-32003761 CAGGGCCTGTGGCCCTCTCATGG + Intergenic
1136744013 16:32567226-32567248 CAGAGCCTATTGATGTCTACAGG + Intergenic
1136788102 16:32947290-32947312 CAGGGCCTGTGGCCCTCTCATGG + Intergenic
1136881681 16:33906499-33906521 CAGGGCCTGTGGCCCTCTCATGG - Intergenic
1203025586 16_KI270728v1_random:508007-508029 CAGAGCCTATTGATGTCTACAGG - Intergenic
1203046135 16_KI270728v1_random:826424-826446 CAGAGCCTATTGATGTCTACAGG + Intergenic
1203090329 16_KI270728v1_random:1208947-1208969 CAGGGCCTTTGGCCCTCTCATGG + Intergenic
1146260366 17:31416651-31416673 CAGGGGCTCTGGCCCTCTCCTGG - Intronic
1147148469 17:38499408-38499430 CAGGGCCTGTGGCCCTCTCATGG + Intronic
1151481738 17:74373627-74373649 CTGGGCCCATGAACCTGTACTGG - Intergenic
1152568599 17:81111418-81111440 CAGTGCCTATGGAGCTCCCCAGG - Intronic
1153439439 18:5100578-5100600 CAGGGCCTGTTGATCTCTAAGGG + Intergenic
1164447613 19:28331350-28331372 CAGGGTCTAGGGACCTCTGCTGG + Intergenic
1164839322 19:31380656-31380678 CAGGGCCCATGGACCACCCCAGG - Intergenic
925139420 2:1539742-1539764 CAGGGCCTGTGGTCCTCTTCAGG + Intronic
926222357 2:10944618-10944640 CAGTGACTATGCACCTCTTCTGG - Intergenic
930175082 2:48293209-48293231 CAGGTCCTATGGAACTGTACTGG + Intergenic
938245068 2:129769898-129769920 CAGGGCCTGGGGAACACTACAGG + Intergenic
941601706 2:167550994-167551016 CACGGCCCACAGACCTCTACTGG + Intergenic
1168910083 20:1440538-1440560 CAGGGCCTATGGGGCTCTGCAGG + Intergenic
1169486382 20:6037209-6037231 CAGGGCCCATGGAAATGTACAGG + Exonic
1170021000 20:11836723-11836745 CAGGTCCTAAGGACCTTTACTGG + Intergenic
1173546469 20:43902004-43902026 CTAGGCCCATGGACCTCCACCGG + Intergenic
1174106504 20:48166036-48166058 CAGGGTCTTTGGTCCTCCACGGG + Intergenic
1176072061 20:63232419-63232441 CAGAGCATTTGGACCTCCACAGG + Intergenic
1176283313 20:64327687-64327709 CAGGGCCCAGGAACCTCTCCAGG - Intergenic
1180427375 22:15210541-15210563 GAGGGCTTTTGGACCTCTAGAGG - Intergenic
1181627033 22:24129193-24129215 CAGGGCCCATGGAAGGCTACAGG + Intronic
1182806075 22:33071743-33071765 AAGGGCCTATGAATCTGTACTGG + Intergenic
1183101010 22:35584063-35584085 CAGAGCCTATGGCCCTCTGGGGG - Intergenic
1184108244 22:42381105-42381127 GAGGGCCCATGGACTTCTTCTGG - Exonic
1184108815 22:42383586-42383608 CAGGGCCAAGGGACTTCTTCTGG + Exonic
949328883 3:2899164-2899186 AAGGGCCTAGAGACCTCTGCTGG + Intronic
955347923 3:58174380-58174402 CAGGGCCTGGGAATCTCTACAGG - Intergenic
959587747 3:108040865-108040887 CAGGTCCTGTGGACCTGTGCAGG + Intergenic
964814283 3:160700545-160700567 AAGGGCGTATTGACCTCTAAGGG - Intergenic
968954194 4:3709924-3709946 CAGGGCCAATGGAGCCCTCCTGG + Intergenic
969288803 4:6225552-6225574 CAGGGCCTTGGGAGCTCTCCGGG + Intergenic
972863041 4:43195311-43195333 CAGGGACTACTTACCTCTACAGG - Intergenic
976349776 4:84048259-84048281 CAGGGCCTAGGGAACCCTAAGGG - Intergenic
985851326 5:2390955-2390977 CAGGGCCTCCTGAACTCTACTGG - Intergenic
985920722 5:2970715-2970737 CATGGGCTAAGGATCTCTACAGG + Intergenic
990536414 5:56727583-56727605 CATGGCCTATGTACCTCCAAAGG + Intergenic
997586502 5:135046887-135046909 CAGGGCACATTGACCTCAACTGG + Intronic
1002408386 5:179054139-179054161 CAAGGACTATCGACCTGTACAGG - Intergenic
1013993211 6:116278536-116278558 AAGGGCCTGGGGATCTCTACAGG + Exonic
1016786762 6:148019315-148019337 CAGGGCCTGTTGACCACTAGAGG + Intergenic
1019305887 7:335592-335614 CAGGGCCTGGGGACCTCTGGAGG - Intergenic
1029623735 7:101706818-101706840 CAGGGCCAATGGACAGCTGCAGG + Intergenic
1029870036 7:103680868-103680890 CAGGGCCTATTGACCTCTGCAGG - Intronic
1040131865 8:43806414-43806436 CAGGGCCCATTGACGTCTATGGG + Intergenic
1044524715 8:93239632-93239654 CAGGGCTTGGGGAGCTCTACGGG - Intergenic
1053425390 9:38006783-38006805 CAGGGCCCGTGCTCCTCTACTGG + Intronic
1053686363 9:40529230-40529252 GAGGGCTTTTGGACCTCTAGAGG + Intergenic
1060172358 9:121472296-121472318 AAGGGATTGTGGACCTCTACTGG + Intergenic
1186730252 X:12402350-12402372 CAGGGGCTTTGGACCTCTTGTGG - Intronic