ID: 902728685

View in Genome Browser
Species Human (GRCh38)
Location 1:18354112-18354134
Sequence GAGCCTGTCCTCTGGGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 323}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902728685_902728689 0 Left 902728685 1:18354112-18354134 CCAGGCACCCAGAGGACAGGCTC 0: 1
1: 0
2: 0
3: 26
4: 323
Right 902728689 1:18354135-18354157 TAACCCTGTCTGGAAAAACCTGG 0: 1
1: 0
2: 0
3: 7
4: 127
902728685_902728694 13 Left 902728685 1:18354112-18354134 CCAGGCACCCAGAGGACAGGCTC 0: 1
1: 0
2: 0
3: 26
4: 323
Right 902728694 1:18354148-18354170 AAAAACCTGGGAAGGCTGCCTGG 0: 1
1: 0
2: 3
3: 60
4: 447
902728685_902728697 19 Left 902728685 1:18354112-18354134 CCAGGCACCCAGAGGACAGGCTC 0: 1
1: 0
2: 0
3: 26
4: 323
Right 902728697 1:18354154-18354176 CTGGGAAGGCTGCCTGGAGGAGG 0: 3
1: 54
2: 266
3: 887
4: 2296
902728685_902728688 -10 Left 902728685 1:18354112-18354134 CCAGGCACCCAGAGGACAGGCTC 0: 1
1: 0
2: 0
3: 26
4: 323
Right 902728688 1:18354125-18354147 GGACAGGCTCTAACCCTGTCTGG 0: 1
1: 0
2: 0
3: 13
4: 140
902728685_902728695 16 Left 902728685 1:18354112-18354134 CCAGGCACCCAGAGGACAGGCTC 0: 1
1: 0
2: 0
3: 26
4: 323
Right 902728695 1:18354151-18354173 AACCTGGGAAGGCTGCCTGGAGG 0: 2
1: 1
2: 27
3: 180
4: 938
902728685_902728693 5 Left 902728685 1:18354112-18354134 CCAGGCACCCAGAGGACAGGCTC 0: 1
1: 0
2: 0
3: 26
4: 323
Right 902728693 1:18354140-18354162 CTGTCTGGAAAAACCTGGGAAGG 0: 1
1: 0
2: 1
3: 22
4: 194
902728685_902728690 1 Left 902728685 1:18354112-18354134 CCAGGCACCCAGAGGACAGGCTC 0: 1
1: 0
2: 0
3: 26
4: 323
Right 902728690 1:18354136-18354158 AACCCTGTCTGGAAAAACCTGGG 0: 1
1: 0
2: 0
3: 17
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902728685 Original CRISPR GAGCCTGTCCTCTGGGTGCC TGG (reversed) Intronic