ID: 902728700

View in Genome Browser
Species Human (GRCh38)
Location 1:18354179-18354201
Sequence ACATCTGAGGCCAGCCTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 173}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902728698_902728700 -10 Left 902728698 1:18354166-18354188 CCTGGAGGAGGCAACATCTGAGG 0: 1
1: 3
2: 11
3: 82
4: 466
Right 902728700 1:18354179-18354201 ACATCTGAGGCCAGCCTTAAAGG 0: 1
1: 0
2: 0
3: 14
4: 173
902728692_902728700 17 Left 902728692 1:18354139-18354161 CCTGTCTGGAAAAACCTGGGAAG 0: 1
1: 0
2: 1
3: 15
4: 158
Right 902728700 1:18354179-18354201 ACATCTGAGGCCAGCCTTAAAGG 0: 1
1: 0
2: 0
3: 14
4: 173
902728691_902728700 18 Left 902728691 1:18354138-18354160 CCCTGTCTGGAAAAACCTGGGAA 0: 1
1: 0
2: 2
3: 14
4: 177
Right 902728700 1:18354179-18354201 ACATCTGAGGCCAGCCTTAAAGG 0: 1
1: 0
2: 0
3: 14
4: 173
902728696_902728700 3 Left 902728696 1:18354153-18354175 CCTGGGAAGGCTGCCTGGAGGAG 0: 2
1: 23
2: 92
3: 258
4: 920
Right 902728700 1:18354179-18354201 ACATCTGAGGCCAGCCTTAAAGG 0: 1
1: 0
2: 0
3: 14
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902728700 Original CRISPR ACATCTGAGGCCAGCCTTAA AGG Intronic
902728700 1:18354179-18354201 ACATCTGAGGCCAGCCTTAAAGG + Intronic
902793345 1:18784180-18784202 CCAGCTGGGGCCTGCCTTAAAGG - Intergenic
903182676 1:21612921-21612943 AGATGTGAGGCCAGCCTCTAAGG + Intronic
903332253 1:22602178-22602200 ACATGTGCCTCCAGCCTTAACGG - Exonic
903400914 1:23047612-23047634 ACATCTGAGGCCAGGCGCATTGG + Intronic
903800520 1:25963851-25963873 AGATTTGAGGCCAGGCTTGAAGG + Intronic
904707483 1:32402303-32402325 GCATCGGAGGCCACCCTCAAGGG - Intergenic
905998775 1:42405163-42405185 ACATCTGGAGCTGGCCTTAAAGG - Intronic
906672091 1:47663682-47663704 ACATTTGAGGAAAGCCTTGATGG + Intergenic
908101406 1:60795043-60795065 ACATCTGAACCAAGCCTTGAAGG + Intergenic
908368079 1:63447600-63447622 ACATCTGAGGCTGACCTTAAAGG + Intronic
912559204 1:110538151-110538173 GCAGCTGAGGCCAGCCTGCAGGG + Intergenic
913209182 1:116569486-116569508 ATATTTGAGCCCAGCCTTCAAGG - Intronic
915975000 1:160379594-160379616 AAGTCTGAGGGCAGCCTGAAGGG - Intergenic
918378111 1:183929258-183929280 ACGTCTGAGGCCAGCTTCACTGG + Intergenic
919686711 1:200489596-200489618 AAAACTGAGGCCAGGCTTGATGG - Intergenic
1063510965 10:6645226-6645248 AGATCTGAGAGCAGCCTCAATGG + Intergenic
1063548245 10:7002688-7002710 GCAGCTGAGGTGAGCCTTAAAGG - Intergenic
1065278809 10:24113995-24114017 ACAGCTGGGGCCAGCTTTATGGG - Intronic
1067366987 10:45641406-45641428 ACAATTTAGGACAGCCTTAATGG + Intronic
1069329306 10:67272263-67272285 ACAACCGTGCCCAGCCTTAATGG - Intronic
1071901749 10:90128068-90128090 ACACCTGAGGCCAGATTTAAGGG + Intergenic
1072854307 10:98930673-98930695 CCATCTCAGGCCAGCCAGAATGG - Intronic
1073216991 10:101841975-101841997 TCATCTGGGGCCAGCCTGAGTGG + Intronic
1075017925 10:118924590-118924612 CCATCTGATGCCAGCCTGCATGG + Intergenic
1076884454 10:133255384-133255406 CCAACTGAGGCCAGCCTAACTGG - Intergenic
1081750795 11:45509608-45509630 ACATCTGAGCTGAGTCTTAAAGG + Intergenic
1082186445 11:49187776-49187798 ACAGCTGAGGCAATCCTTGAAGG - Intronic
1083968763 11:66059473-66059495 ACATCTGAGTCCTGCTTAAAAGG + Intronic
1084358165 11:68652937-68652959 ACACCCAAGGCCAGCTTTAATGG - Intergenic
1084399716 11:68936599-68936621 CCATCTCAGCCCAGCCTCAACGG + Exonic
1084974459 11:72789132-72789154 ACAACTGAGGCCAGACACAATGG - Intronic
1085632449 11:78130062-78130084 ACATCAGAGGCCAGGCATGATGG + Intronic
1086679892 11:89657597-89657619 ACAGCTGAGGCAATCCTTGAAGG + Intergenic
1089186741 11:116622110-116622132 ACAGCTGACACCATCCTTAATGG + Intergenic
1089785005 11:120901427-120901449 ACATCTGAGCAGAGCCTTGAAGG - Intronic
1092523602 12:9296042-9296064 ACACCTGAGCCAGGCCTTAAAGG - Intergenic
1092543695 12:9435857-9435879 ACACCTGAGCCAGGCCTTAAAGG + Intergenic
1094286653 12:28801561-28801583 GCTTCTGAGGCCAGCTTTAATGG + Intergenic
1094509249 12:31086194-31086216 ACACCTGAGCCAGGCCTTAAAGG - Intronic
1094609691 12:31981724-31981746 ACAGCTGAGGTCTGCCTTGATGG - Exonic
1095554434 12:43483474-43483496 CCATCTGTGGACAGCCTTACTGG + Intronic
1096259973 12:50084377-50084399 AAATCTGAGGCCAGGCACAATGG + Intergenic
1096939301 12:55324915-55324937 ACAAATGAGGCCAGCTGTAATGG + Intergenic
1098526759 12:71495225-71495247 ACATCAGAGGCAAGCATTTATGG + Intronic
1102573172 12:113840025-113840047 CCCTCTGAGGCCAGCCATACGGG + Intronic
1102573185 12:113840082-113840104 TCCTCTGAGGCCAGCCATACTGG + Intronic
1102689060 12:114746323-114746345 GCATCTGGGGCTAGCCTTGATGG + Intergenic
1107915753 13:45148525-45148547 AACTCTGAGCTCAGCCTTAAAGG - Intronic
1109011744 13:56957850-56957872 ACATCTGGGGACAACTTTAAAGG + Intergenic
1109663208 13:65492927-65492949 ACATCTGACGCCAGTCAGAATGG + Intergenic
1117394032 14:55291112-55291134 CCATCTGAGGCCAGGCATGATGG - Intronic
1117454107 14:55880692-55880714 CCATCTCATGCCAGCCATAATGG + Intergenic
1119340725 14:73875282-73875304 ACCACTGTGCCCAGCCTTAATGG + Intronic
1120227927 14:81811450-81811472 AAACCTGAGGCCAGGCGTAATGG - Intergenic
1120792873 14:88601006-88601028 ACATCTGAAGTCAGCAGTAAAGG - Intronic
1123507475 15:20958776-20958798 ACATCTGAGTAAAGCCTGAAAGG + Intergenic
1123564701 15:21532517-21532539 ACATCTGAGTAAAGCCTGAAAGG + Intergenic
1123600957 15:21969808-21969830 ACATCTGAGTAAAGCCTGAAAGG + Intergenic
1123688389 15:22816894-22816916 ACATCTGAGGCCGGGCGTAGTGG + Intronic
1124832157 15:33159717-33159739 ACATTTGAGTCCAGGCTTAGGGG - Intronic
1128151640 15:65366878-65366900 ACATCTGAGGGCAGCCACAGAGG + Intronic
1130087273 15:80788017-80788039 ACTCCTGAGGCGAGCCTTTAGGG - Intronic
1130845659 15:87742429-87742451 AAAACTGAGGCCAGACTTGAAGG + Intergenic
1131247131 15:90804754-90804776 ACAACTGAGGCCAGGCTCAGTGG - Intronic
1131427426 15:92357979-92358001 ACACCTGAGGCCGGGCTTAGTGG + Intergenic
1131718494 15:95140719-95140741 ACATCTAAAGCCATGCTTAAAGG - Intergenic
1132164518 15:99572694-99572716 ACATCTGAGCTAAGACTTAAAGG - Intronic
1202973065 15_KI270727v1_random:259628-259650 ACATCTGAGTAAAGCCTGAAAGG + Intergenic
1133141065 16:3744510-3744532 ACATCTCAGTCCACCCTTAAAGG - Intronic
1133678614 16:8099321-8099343 TCCTCTGAGGTCACCCTTAAAGG - Intergenic
1133710125 16:8393297-8393319 ACATCTGAGCTCAGCCTTCATGG - Intergenic
1136341202 16:29644696-29644718 ACATCTGAGGGGAGACTTGAGGG - Intergenic
1138205226 16:55119751-55119773 GCATCTGAGGACAGGTTTAAGGG + Intergenic
1139422554 16:66857496-66857518 AACTCTGAGGCCACCCTCAAAGG + Intronic
1141902021 16:86997198-86997220 ACATCTGAGGCCAGCCCACTCGG + Intergenic
1142781915 17:2187905-2187927 ACTTCTAAGGGCAGCCTTAAAGG + Intronic
1153060105 18:986190-986212 ACACCTGGGCCCAGCCTTCAGGG - Intergenic
1153251391 18:3125855-3125877 ACATGTGAGGCCACCCTTTGTGG + Intronic
1153377995 18:4402861-4402883 ACAGGTCAAGCCAGCCTTAATGG + Intronic
1154076176 18:11203986-11204008 ATATCTAAGCCCAGACTTAAGGG + Intergenic
1161195366 19:2983447-2983469 ACATCTGAGCGGAGGCTTAAAGG + Intronic
1163391942 19:17036448-17036470 ACCTCCGAGGGCAGCCTTCAGGG - Intergenic
1165794069 19:38508564-38508586 ATATCTGAGGCAAGCCATGAAGG + Intronic
1167611143 19:50508215-50508237 ACATCTGAGGTGGGCCTTGAAGG - Intronic
929163858 2:38860915-38860937 CCATCCTAGACCAGCCTTAAAGG + Intronic
932865747 2:75340000-75340022 GCATCTTAGGCCACCCTTGAAGG + Intergenic
933782625 2:85812715-85812737 AGATCTGAGGCCAGACGTAGTGG + Intergenic
935110836 2:100092766-100092788 ACATCTGATTGCAGTCTTAAAGG - Intronic
936124138 2:109772396-109772418 ACATCTGATTGCAGTCTTAAAGG + Intergenic
936220551 2:110599068-110599090 ACATCTGATTGCAGTCTTAAAGG - Intergenic
937841750 2:126531615-126531637 ACATCTGAACCCTGACTTAAGGG - Intergenic
938278973 2:130051431-130051453 ACGTCTGAGGCCAGGCTCACTGG + Intergenic
938329956 2:130442306-130442328 ACGTCTGAGGCCAGGCTCACTGG + Intergenic
938359989 2:130679197-130679219 ACGTCTGAGGCCAGGCTCACTGG - Intergenic
938436397 2:131285918-131285940 ACGTCTGAGGCCAGGCTCACTGG - Intronic
947008955 2:225545043-225545065 ACATCTGCTGCCAGACTTATTGG + Intronic
948269905 2:236666259-236666281 CCAGCTGAGGCCAGTCTTGAAGG - Intergenic
948305168 2:236941047-236941069 AAATCTGAGCTGAGCCTTAATGG - Intergenic
1170349976 20:15428174-15428196 AACTCTGAGGCCTGCCTCAAAGG - Intronic
1173523664 20:43716578-43716600 TCCTCAGAGGCCAGCCTTATCGG + Intergenic
1173958261 20:47051574-47051596 ACATCTGAGGACAGACTTGCAGG - Intronic
1175538147 20:59729602-59729624 CCATCTGTGGGCATCCTTAAAGG - Intronic
1178612554 21:34096966-34096988 AAATCTGAAGACAGCATTAAGGG + Exonic
1178950432 21:36980991-36981013 ACCTATGAGGCAAGCCCTAAAGG - Intronic
1182878333 22:33711587-33711609 ACCTCTGAGACCAGACTAAAAGG + Intronic
1184735782 22:46397048-46397070 AACTCTGAGGCCACCCTGAATGG + Intronic
952796907 3:37247479-37247501 ACATCTGAGTAGAGCCTTGATGG + Intronic
954099131 3:48355869-48355891 ACAACTCAGGCCAGCCTGTAGGG - Intergenic
957076081 3:75604178-75604200 TTATCTGAGCCCATCCTTAAGGG + Intergenic
957958233 3:87217328-87217350 ACATCAGAGGCCAGCCTCTTGGG - Intergenic
959270703 3:104206233-104206255 ATATCTGAGGCCAGGCATGATGG - Intergenic
959385876 3:105705846-105705868 AAATCTGAGGCCAGCCCTGGTGG + Intronic
961051613 3:123751823-123751845 ACATCTGAGAACAGACTTGAAGG + Intronic
962772946 3:138630076-138630098 ACATCTGGAGCCAGCATGAAAGG - Intronic
963438459 3:145304125-145304147 ATATCAGATGCCTGCCTTAAAGG - Intergenic
970525686 4:16929499-16929521 ACTTCAGATGCCAGCCTGAAAGG - Intergenic
971156052 4:24084135-24084157 ACCTCTGAGCCAAGCCTTGAGGG - Intergenic
972711245 4:41597166-41597188 AAATCTGAGGCCAGCACCAAAGG - Intronic
976559888 4:86489086-86489108 ACATCTGAGGGAAGCCATACAGG + Intronic
979301896 4:119095941-119095963 ACATCTGAGGTTAGCCGCAAAGG - Intergenic
980752363 4:137108355-137108377 ACATCTGAGGCAATTCTGAAGGG + Intergenic
981056212 4:140364646-140364668 ACATCAGCTGCCAGTCTTAATGG + Intronic
985718143 5:1474376-1474398 ACAGCTGATGCCAGCATTAAGGG + Intronic
985851645 5:2392715-2392737 ACATCTGAGGGTAGCCCTGACGG - Intergenic
988704306 5:33709156-33709178 CCATCTCAGGCCAGTCATAATGG + Intronic
992623099 5:78612816-78612838 TCATTTGGTGCCAGCCTTAAGGG - Intronic
993126933 5:83846849-83846871 ACATCTGAGCCCAGCCTGTCTGG + Intergenic
1000301024 5:159955953-159955975 ATATTTGAGGCCAGGCATAATGG + Intronic
1000466534 5:161585454-161585476 ACATTTGAGGCAGGCCTTGAGGG - Intronic
1003307672 6:4944466-4944488 ACAGCTGAGGGCATCCCTAAAGG + Intronic
1003467040 6:6390804-6390826 AGATCTGAGGGCTGCCTGAAAGG - Intergenic
1003686513 6:8309390-8309412 ACATCTCAGGCCAGTCAGAATGG - Intergenic
1006359223 6:33578157-33578179 GCCTCTGAGGACAGCCTTCATGG - Intronic
1006423231 6:33948507-33948529 AAGCCTGAGGCCAGCCCTAAGGG + Intergenic
1006844140 6:37050982-37051004 ACATCTCAGGCCAGCCCCAAAGG + Intergenic
1008506909 6:52239509-52239531 ACATCTGAGCTGGGCCTTAATGG - Intronic
1008768864 6:54954009-54954031 ACTTCTCAGCCAAGCCTTAAAGG - Intergenic
1011237500 6:85233517-85233539 ACATATGAAGCCAGCCTGACTGG - Intergenic
1013724544 6:113077475-113077497 ACATAGGAGGCCATCCTGAATGG + Intergenic
1015300235 6:131644700-131644722 ACATATGAGGCTAGCTTTAGAGG + Intronic
1016318261 6:142813851-142813873 ACATCTGAGGCCAGGCATGGTGG - Intronic
1016893584 6:149031870-149031892 ACATTTGTGCCCGGCCTTAAAGG + Intronic
1018252313 6:161883212-161883234 ACATCTGAGGCCAGGCATGGTGG + Intronic
1020168611 7:5827364-5827386 ACAACTGGGGCCAGGCATAATGG - Intergenic
1021552147 7:21882506-21882528 AGATCTGAGGCCAGGCGTGATGG + Intronic
1021570876 7:22063957-22063979 ATATCTGAGACATGCCTTAAAGG + Intergenic
1021594525 7:22300974-22300996 ACATCTGAGGCCTGCCTTTGAGG + Intronic
1021937731 7:25647649-25647671 ACATCTGATGGCAGTTTTAAAGG + Intergenic
1022117429 7:27274464-27274486 ACATCAGAGCCCAGCCTTACAGG - Intergenic
1024337087 7:48219993-48220015 TCATCCAAGGCCAGTCTTAAAGG - Intronic
1024346880 7:48322460-48322482 CCTGCTGAGGCCAGCCTGAAAGG - Intronic
1026322649 7:69280942-69280964 ACATTTGAGGAAAGCCTAAATGG - Intergenic
1031476284 7:122226560-122226582 ATATCTGAGGCCTGCCACAAGGG + Intergenic
1033384395 7:140857751-140857773 ACATCAGAGGCCAGCTTGAAGGG + Intronic
1037088447 8:14882184-14882206 ATATCTGAGGCAATCCCTAATGG + Intronic
1037485409 8:19342390-19342412 AATGCTGAGGCCAGCCTCAAGGG + Intronic
1039228247 8:35413976-35413998 GAATCTGAGGTCAGCTTTAATGG - Intronic
1040779071 8:51084812-51084834 CCATCTGAGGCCAGCGTTGCAGG + Intergenic
1041047898 8:53904579-53904601 ATATATGAGGCCATCATTAATGG - Intronic
1045485838 8:102630442-102630464 ACATCTGGGGCCAGGCTTAGTGG + Intergenic
1047616419 8:126565923-126565945 ATATCTGAGTCAAGGCTTAAAGG - Intergenic
1047947823 8:129900076-129900098 AAATCTGAGCCCAGACTAAAGGG + Intronic
1047967168 8:130054776-130054798 ACATCGAAGGACAGCCTGAAAGG - Exonic
1048948825 8:139475982-139476004 ACATTTGAGGCAGGTCTTAAAGG + Intergenic
1048964983 8:139608738-139608760 AGATCTGAGACCAGCAGTAATGG - Intronic
1051784065 9:20722416-20722438 ACATCTGAGCACAGCCTGAAAGG - Intronic
1052797047 9:32932150-32932172 ACTTCTGAGACCATCCTTAAAGG - Intergenic
1054887472 9:70214280-70214302 ACATCTGAGCAAAGACTTAAAGG + Intronic
1055140997 9:72876973-72876995 AGATATGAGGCCGGCCTTATAGG + Intergenic
1055876531 9:80949428-80949450 ACATCTGAGCCAAGTCTTGAAGG - Intergenic
1056806952 9:89736403-89736425 ACAACCGAGGACTGCCTTAATGG + Intergenic
1057625397 9:96671829-96671851 ACATCTGAGGCCAGGCGTGGTGG - Intergenic
1058026904 9:100151047-100151069 ACATGTGAAGCAAGACTTAAAGG + Intronic
1059668421 9:116471441-116471463 ATGTGTGAGGCCAGCCTGAAGGG - Intronic
1062601301 9:137319750-137319772 ACATTTGAAGCCAGCCTTCCAGG - Intronic
1189672229 X:43423427-43423449 ACATCTGAGGCCAGGCGTGGTGG + Intergenic
1189979233 X:46492444-46492466 CCATCTCAGGCCAGCCAGAATGG + Intronic
1190431147 X:50378913-50378935 ATACCTGAGGCCAGTCTTATTGG + Intronic
1197237931 X:124089194-124089216 ACATATGAGGCCAGGCGTAGTGG - Intronic
1197633000 X:128883884-128883906 ACATTTGTGGCCAGTATTAATGG - Intergenic
1198038438 X:132824517-132824539 ACCTTTGAGGCCAGACTTAGAGG + Intronic
1198831898 X:140759677-140759699 ACCTATGAGCCCAGCATTAAGGG + Intergenic
1200973712 Y:9183848-9183870 CCATCTGAGGCCAGTCAAAATGG + Intergenic
1201576408 Y:15465988-15466010 ACATTTTAGGCCATCCTAAAAGG - Intergenic
1202137403 Y:21680948-21680970 CCATCTGAGGCCAGTCAAAATGG - Intergenic
1202346602 Y:23935069-23935091 TCATCTGAGGCCAGACAAAATGG + Intergenic
1202524169 Y:25735024-25735046 TCATCTGAGGCCAGACAAAATGG - Intergenic