ID: 902732539

View in Genome Browser
Species Human (GRCh38)
Location 1:18378756-18378778
Sequence GTTGCATGCCACTGAGGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1242
Summary {0: 1, 1: 3, 2: 40, 3: 184, 4: 1014}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902732539_902732543 18 Left 902732539 1:18378756-18378778 CCCAAACCTCAGTGGCATGCAAC 0: 1
1: 3
2: 40
3: 184
4: 1014
Right 902732543 1:18378797-18378819 TGTTCATGTTCAGGCTGAAGTGG 0: 1
1: 0
2: 0
3: 20
4: 246
902732539_902732542 9 Left 902732539 1:18378756-18378778 CCCAAACCTCAGTGGCATGCAAC 0: 1
1: 3
2: 40
3: 184
4: 1014
Right 902732542 1:18378788-18378810 TTGTAACTATGTTCATGTTCAGG 0: 1
1: 0
2: 0
3: 8
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902732539 Original CRISPR GTTGCATGCCACTGAGGTTT GGG (reversed) Intergenic
900948060 1:5842338-5842360 GTTGTAAGCCACTGAGTTTGGGG + Intergenic
901780624 1:11592125-11592147 GTTTTAAGCCACTGAGATTTGGG + Intergenic
901820045 1:11823100-11823122 ATTGCATGATGCTGAGGTTTGGG - Intronic
901925982 1:12566403-12566425 GTTGGAAGCCACTGAGATTTGGG + Intergenic
902151507 1:14446967-14446989 GTTACATGATGCTGAGGTTTGGG + Intergenic
902248105 1:15135106-15135128 ATTGCGTGACGCTGAGGTTTGGG - Intergenic
902539552 1:17144172-17144194 TGTGCATGCCACTGAGGTGCAGG - Intergenic
902635270 1:17730847-17730869 GTTTCAAGCCACTGAGTTTTGGG + Intergenic
902638681 1:17751906-17751928 GTTGCAAGCAACTGAGATGTGGG - Intergenic
902732539 1:18378756-18378778 GTTGCATGCCACTGAGGTTTGGG - Intergenic
903759846 1:25690208-25690230 GTTGGTGGCCACTGGGGTTTGGG - Intronic
903947075 1:26970756-26970778 GTTTTATGCCACTAAGTTTTGGG - Intergenic
904093621 1:27961291-27961313 GTCGCATGCCTCTGAGCCTTGGG - Intronic
904107103 1:28094505-28094527 GTTTTAAGCCACTGAGTTTTGGG - Intergenic
904956417 1:34287747-34287769 GTTTTAAGCCACTAAGGTTTGGG + Intergenic
905235043 1:36540414-36540436 GTGTTATGCCACTGAGATTTTGG + Intergenic
905822387 1:41003765-41003787 GTTGGGAGCCACTGAGCTTTAGG - Intronic
905842882 1:41199808-41199830 ATTGCATGATGCTGAGGTTTGGG - Intronic
906131572 1:43461895-43461917 GTTTTAAGCCACTGAGTTTTGGG + Intergenic
906523790 1:46482479-46482501 GTTGCAAGCCACTAAGTTTGGGG + Intergenic
907060890 1:51423534-51423556 GTGGAATGCCTCTGAGGATTTGG - Intronic
907446402 1:54510768-54510790 GTTTTATGCCACTAAGTTTTGGG - Intergenic
907506967 1:54926200-54926222 ATTCCATCCCACTGAGGATTAGG - Intergenic
907615069 1:55915593-55915615 GTTTTAAGCCACTGAGTTTTGGG - Intergenic
907838679 1:58135599-58135621 GTTGTGTGGTACTGAGGTTTGGG + Intronic
907885815 1:58591557-58591579 GTTGTAAGCCATTAAGGTTTAGG + Intergenic
907924863 1:58945927-58945949 GTTGCATGACGCTGAGGTTTGGG + Intergenic
908008847 1:59754966-59754988 GCTGCATGTCCCTGAGGTTGTGG - Intronic
908166554 1:61464639-61464661 GTTGCGAGCCACTGAGATTTTGG - Intergenic
908376508 1:63547592-63547614 GTTTTAAGCCACTGAGTTTTGGG - Intronic
908425989 1:64008033-64008055 ATTGCATGATCCTGAGGTTTGGG + Intronic
908729012 1:67207262-67207284 ATTGCATGGTATTGAGGTTTGGG + Intronic
908846032 1:68325184-68325206 GTTGCATGATGCTGAGGTTTGGG + Intergenic
909166526 1:72233353-72233375 ATTGCATAACACTGAGGTTTTGG + Intronic
909704015 1:78559383-78559405 GTTGCATGATGCTGAGGTTTGGG - Intergenic
910112651 1:83699241-83699263 CTTTTATGCCACTGAGTTTTGGG + Intergenic
910137317 1:83987939-83987961 ATTGCATGATGCTGAGGTTTGGG + Intronic
910611173 1:89143933-89143955 ATTGCGTGATACTGAGGTTTGGG + Intronic
911457101 1:98139138-98139160 ATTGCATGACACTGAGGTTTGGG + Intergenic
911531656 1:99050863-99050885 GTTGCATGATGCTGAGGTTTAGG + Intergenic
911622012 1:100075504-100075526 GTTGGAGGCCACAGAGCTTTGGG + Intronic
911957824 1:104260656-104260678 ATTGCATAACGCTGAGGTTTGGG - Intergenic
912231698 1:107800590-107800612 ATTGCATGATGCTGAGGTTTGGG + Intronic
912259950 1:108100479-108100501 ATTGCATGATGCTGAGGTTTGGG - Intergenic
912268770 1:108188309-108188331 ATTGCATGATGCTGAGGTTTGGG - Intronic
912926755 1:113919825-113919847 ATTGCATAATACTGAGGTTTTGG - Intergenic
912948544 1:114104894-114104916 ATTGCATGATGCTGAGGTTTGGG + Intronic
913096615 1:115523460-115523482 GTTTTAAGCCACTGAGTTTTAGG - Intergenic
913294522 1:117305794-117305816 CTTGCAAGCCACTAAGTTTTGGG + Intergenic
913498070 1:119446585-119446607 GTTGCATGAAACTGGGGTTGGGG + Intergenic
913572884 1:120139080-120139102 ATGGCATAACACTGAGGTTTGGG + Intergenic
913708386 1:121452400-121452422 ATTACATGACACTGAGTTTTGGG + Intergenic
913711931 1:121493527-121493549 GTTGTAAGCCACTAAGCTTTGGG - Intergenic
914294144 1:146303868-146303890 ATGGCATAACACTGAGGTTTGGG + Intergenic
914555188 1:148754651-148754673 ATGGCATAACACTGAGGTTTGGG + Intergenic
914954594 1:152149590-152149612 ATTGCGTGACAGTGAGGTTTGGG + Intergenic
915066394 1:153228612-153228634 GCTGAATGCCACTGAGGATCAGG + Intergenic
916184559 1:162118157-162118179 ATTGCATGACATTGAGGCTTGGG + Intronic
916361481 1:163975100-163975122 ATTGCATGATGCTGAGGTTTGGG + Intergenic
916701481 1:167300352-167300374 ATTGCATGATACTGAAGTTTTGG - Intronic
916777392 1:167981435-167981457 ATTGCATGAGGCTGAGGTTTGGG + Intronic
917382721 1:174432020-174432042 ATTGCATGATGCTGAGGTTTGGG + Intronic
917438062 1:175041032-175041054 CTACCATGCCACTGTGGTTTTGG - Intergenic
917496497 1:175545089-175545111 GTCGTAAGCCACTGAGATTTGGG + Intronic
917555270 1:176079570-176079592 ATTGCACGACACTGAGGCTTGGG - Intronic
917726291 1:177830458-177830480 GTTGTAAGCCACTAAGATTTGGG + Intergenic
918188465 1:182148473-182148495 GGTGCCTGCCACTGAGGGGTAGG - Intergenic
918219148 1:182419838-182419860 ATTGTGTGACACTGAGGTTTAGG + Intergenic
918645370 1:186897867-186897889 GTTGCATGATACTAAGGTTTGGG + Intronic
918753273 1:188301100-188301122 GTTGCACATCACTGTGGTTTGGG - Intergenic
918838812 1:189506424-189506446 GTTGCATGATGCTGAGGTTTGGG + Intergenic
918865783 1:189897603-189897625 GTTTTAAGCCACTGAGTTTTAGG + Intergenic
919326878 1:196119255-196119277 ATTGCATGATGCTGAGGTTTGGG - Intergenic
919409898 1:197229512-197229534 ATTGCGTGACACTGAGGTTTGGG + Intergenic
919435649 1:197556289-197556311 GTTGCATGATGCTGAGGTTTGGG - Intronic
920419702 1:205824291-205824313 TTTGGAGGCCACTGTGGTTTTGG + Intergenic
920864584 1:209741260-209741282 GTTTTAAGCCACTGAGTTTTGGG - Intergenic
921334765 1:214075245-214075267 GATGCATGTCTCTGAGGTTCTGG + Intergenic
921366414 1:214378835-214378857 ACTGCATGCCACTGAGCTATGGG + Intronic
921987236 1:221325656-221325678 ATTGCATGACGCTGAGATTTGGG + Intergenic
922059798 1:222077450-222077472 GTTGGAAGCCACTGAGATTTGGG + Intergenic
922596445 1:226817213-226817235 GTTTTAAGCCACTGAGTTTTGGG - Intergenic
922875185 1:228934944-228934966 ATTGCATGATGCTGAGGTTTGGG - Intergenic
923244040 1:232113658-232113680 ATTGCATGACACTGAGGTTTGGG - Intergenic
924021067 1:239783766-239783788 GTTGCATGATGCTGAGGTTTGGG + Intronic
924132404 1:240925181-240925203 ATTGCATGATACTGAGCTTTGGG + Intronic
924143056 1:241046216-241046238 ATTGCATAACACTGAGGTTTGGG + Intronic
924315538 1:242791646-242791668 GCTTTAAGCCACTGAGGTTTGGG - Intergenic
924689729 1:246334649-246334671 ATTGCATGATGCTGAGGTTTGGG - Intronic
924806074 1:247363018-247363040 ATTGCATGATGCTGAGGTTTGGG + Intergenic
924871502 1:248051668-248051690 GTTGCATGATGCTGAGGTTTGGG - Intronic
924889798 1:248262647-248262669 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1063076241 10:2719491-2719513 GTTGAATGCCACCAAGATTTAGG + Intergenic
1063086507 10:2822993-2823015 GTTGTAAGCCACTGAGATTTGGG - Intergenic
1063146157 10:3296958-3296980 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1063350768 10:5352670-5352692 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1063501090 10:6555210-6555232 ATTACATGATACTGAGGTTTAGG - Intronic
1063520278 10:6734930-6734952 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1063701000 10:8385452-8385474 GCTGCAAGCCACCGTGGTTTTGG - Intergenic
1063716787 10:8535562-8535584 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1064172156 10:13043127-13043149 TTTGTGTGACACTGAGGTTTGGG + Intronic
1064621586 10:17222864-17222886 GTTGTGTGATACTGAGGTTTGGG + Intergenic
1064684379 10:17844630-17844652 ATTGCATGTTGCTGAGGTTTGGG + Intronic
1064937872 10:20699020-20699042 GTTGACTGCCAATGATGTTTTGG - Intergenic
1065363766 10:24915024-24915046 ATTGCATGAGGCTGAGGTTTAGG - Intronic
1065434536 10:25693441-25693463 ATTGCATGTTGCTGAGGTTTGGG + Intergenic
1065524481 10:26605475-26605497 ATTGCATAACCCTGAGGTTTGGG - Intergenic
1065532247 10:26683753-26683775 ATTGCATAACCCTGAGGTTTGGG - Intergenic
1065623488 10:27607579-27607601 TTTGTATGCCACTGAGTTTGGGG - Intergenic
1065762983 10:29000453-29000475 ATTGTGTGACACTGAGGTTTGGG + Intergenic
1066171568 10:32853941-32853963 ACTGCATGACATTGAGGTTTGGG + Intronic
1066184803 10:32998675-32998697 GTTGCATGATGCTGAAGTTTGGG + Intronic
1066359042 10:34712852-34712874 ATTGCATGATGCTGAGGTTTGGG - Intronic
1066499485 10:35976083-35976105 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1066627330 10:37420114-37420136 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1067169158 10:43891882-43891904 ATTGCATGATACTGAGATTTGGG - Intergenic
1067189154 10:44055136-44055158 GCTTCATGACGCTGAGGTTTGGG - Intergenic
1067381932 10:45782387-45782409 GTGGTATGTCACTGTGGTTTTGG - Intronic
1067493714 10:46741580-46741602 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1067600947 10:47598825-47598847 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1067889632 10:50123027-50123049 GTGGTATGTCACTGTGGTTTTGG - Intronic
1068189146 10:53627494-53627516 GTTTCAGGCCACTAAGTTTTGGG + Intergenic
1068218891 10:54017726-54017748 ATTGCATGATGCTGAGGTTTGGG - Intronic
1068366823 10:56062078-56062100 ATTGCAGGTCACTGAGATTTGGG + Intergenic
1069023400 10:63514707-63514729 GTTGCATGATGCTGAGGTTTGGG - Intergenic
1069130730 10:64698718-64698740 ATTGCATGACGCTGAGGCTTAGG - Intergenic
1070791660 10:79193056-79193078 GGTGCAGGCTACCGAGGTTTGGG + Intronic
1071025383 10:81107007-81107029 ATTGCATGTTGCTGAGGTTTGGG - Intergenic
1071049859 10:81433699-81433721 GTTGCTAGCTACTGTGGTTTTGG + Intergenic
1071306542 10:84304020-84304042 GTTGCATGATGCTGAGGTTTGGG + Intergenic
1071490053 10:86130177-86130199 GTTGCATGACACTGAGTTTTAGG + Intronic
1071652492 10:87406692-87406714 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1071731114 10:88249433-88249455 GTTTTAAGCCACTGAGTTTTGGG - Intergenic
1072049487 10:91689279-91689301 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1072483829 10:95834998-95835020 ATTGCATGATGCTGAGGTTTGGG + Intronic
1072708996 10:97703422-97703444 GTTTTATGCCACTAAGTTTTGGG - Intergenic
1073658605 10:105446820-105446842 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1074369956 10:112892434-112892456 GTTGTATGCAACTGAGACTTAGG + Intergenic
1074437790 10:113449038-113449060 ATTGCATGCCAGTGTGTTTTTGG - Intergenic
1074641933 10:115394924-115394946 ATTGCATGATGCTGAGGTTTGGG + Intronic
1075179586 10:120197842-120197864 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1075312084 10:121422816-121422838 GTAGCTTGGCACTGAGCTTTGGG + Intergenic
1075363047 10:121857172-121857194 GTTGTATGATACTAAGGTTTGGG + Intronic
1075538291 10:123289960-123289982 GTTGGAAGCCACAGAGATTTTGG - Intergenic
1076179370 10:128394862-128394884 ATTCCATGCTGCTGAGGTTTTGG + Intergenic
1076379684 10:130016465-130016487 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1077574573 11:3372517-3372539 TTTGCATAACACTAAGGTTTCGG - Intronic
1077617957 11:3692272-3692294 ACTGCATGCCACTCAAGTTTTGG + Intronic
1077694540 11:4382474-4382496 ACTGCATGATACTGAGGTTTGGG + Intergenic
1077719414 11:4612543-4612565 GTTGTATGCCCCTGAGATTTTGG + Intergenic
1077830678 11:5866719-5866741 GTTGCATGATGCTAAGGTTTGGG - Intronic
1077945662 11:6895177-6895199 GTTGTATGCTATTGTGGTTTTGG - Intergenic
1078495878 11:11816440-11816462 GTTTTAAGCCACTGAGATTTGGG - Intergenic
1078709277 11:13775382-13775404 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1078825652 11:14927735-14927757 ATTGCATGATGCTGAGGTTTGGG + Intronic
1079280901 11:19086067-19086089 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1079621628 11:22562643-22562665 ATTGTGTGACACTGAGGTTTGGG + Intergenic
1079910489 11:26303631-26303653 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1079977632 11:27111429-27111451 ATTGCATGATCCTGAGGTTTGGG - Intronic
1079999307 11:27329402-27329424 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1080113756 11:28598974-28598996 CTTGTATGTCACTGAGATTTGGG + Intergenic
1080451879 11:32384666-32384688 GCTGCCTGCCAGTGAGGCTTGGG + Intergenic
1080604163 11:33850693-33850715 GTTTTAAGCCACTGAGTTTTGGG - Intergenic
1080759022 11:35229767-35229789 ATTGCTTTCCACTGAGGTTGGGG + Exonic
1080892321 11:36419780-36419802 ATTGCATGCCACGTAGTTTTGGG + Intronic
1081318033 11:41655435-41655457 GCTTCATGTCACTGAAGTTTTGG - Intergenic
1081398910 11:42619654-42619676 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1081483859 11:43512839-43512861 GTTGTAAGTCACTGAGTTTTGGG - Intergenic
1081706670 11:45186145-45186167 GTTTTAAGCCACTGTGGTTTTGG + Intronic
1082747026 11:56975109-56975131 ATTGCATGACGCTGAAGTTTGGG - Intergenic
1082751494 11:57022924-57022946 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1082919316 11:58475370-58475392 ATTGCATGTCACTGAGGTTTGGG + Intergenic
1082949903 11:58802705-58802727 ATTGCATGACGGTGAGGTTTGGG - Intergenic
1083126946 11:60578926-60578948 ATTGTATGCCACTGGGTTTTTGG - Intergenic
1084450978 11:69237986-69238008 GTTTCAAGCCACTAAGTTTTGGG - Intergenic
1084776783 11:71382261-71382283 GTTTTATGGCACTGAGATTTGGG + Intergenic
1085844395 11:80048982-80049004 GTTGCATGATGCTGAGGTTTGGG - Intergenic
1085918973 11:80928624-80928646 ATTGTGTGACACTGAGGTTTGGG + Intergenic
1086055921 11:82646277-82646299 ATTGCATGATGCTGAGGTTTAGG - Intergenic
1086124706 11:83338494-83338516 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1086331630 11:85760277-85760299 GTTGGAAGCCACTGAGGTTTGGG + Intronic
1086661715 11:89427206-89427228 GTGACATGCGAATGAGGTTTTGG - Intronic
1086843583 11:91719720-91719742 GTTTTATGCCACTGAGATTTGGG + Intergenic
1087488263 11:98787350-98787372 ATTGCATGTCGCTAAGGTTTGGG + Intergenic
1087566038 11:99859416-99859438 ATTGCATGATGCTGAGGTTTGGG + Intronic
1087934901 11:104021724-104021746 GTTTTAAGCCACTGAGTTTTGGG + Intronic
1087986817 11:104692468-104692490 GTTGTATGCTACTGAGGTTTGGG + Intergenic
1088026382 11:105189209-105189231 ATTGCATGATTCTGAGGTTTGGG - Intergenic
1088165721 11:106934027-106934049 ATTGCATGATGCTGAGGTTTGGG - Intronic
1088225203 11:107612440-107612462 GTTGCGTGATGCTGAGGTTTAGG - Intronic
1088397764 11:109387590-109387612 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1088471625 11:110193453-110193475 ATTGCATGATGCTGAGGTTTGGG - Intronic
1088531789 11:110818577-110818599 GTTTTATGCCACTAAGCTTTGGG + Intergenic
1089332304 11:117698378-117698400 GTTGCATGGCAGTGAAGTCTGGG - Intronic
1090102263 11:123811877-123811899 GTTGCACGATGCTGAGGTTTGGG + Intergenic
1090181138 11:124700829-124700851 ATTGTGTGACACTGAGGTTTGGG + Intergenic
1090536035 11:127642765-127642787 GTTGCATGATGCTGAGGTTTGGG - Intergenic
1090741991 11:129670857-129670879 ATTACATGATACTGAGGTTTGGG + Intergenic
1090864883 11:130691016-130691038 ATTGCGTGGCACTGAGGTCTGGG + Intronic
1091078414 11:132642964-132642986 ATTGCTGGCCACTGAGGGTTGGG - Intronic
1092782978 12:12004360-12004382 GTTGTAAACCACTGAGATTTGGG - Intergenic
1093198174 12:16153923-16153945 ATTGCGTGATACTGAGGTTTGGG - Intergenic
1093226971 12:16496534-16496556 GTTGCATGATGCTGAGGTTTGGG + Intronic
1093275733 12:17123051-17123073 ATTGTGTGACACTGAGGTTTTGG + Intergenic
1093288295 12:17293700-17293722 ATTGCATGAAGCTGAGGTTTGGG + Intergenic
1093305699 12:17514777-17514799 ATTGCATGATACTGAGATTTGGG - Intergenic
1093498656 12:19784628-19784650 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1093716995 12:22394013-22394035 ATTGCATGATGCTGAGGTTTGGG + Intronic
1093905855 12:24691197-24691219 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1094434262 12:30403655-30403677 ATTGCATGTTACTGAGGTTTAGG + Intergenic
1095444380 12:42269630-42269652 ATTGCATGCTGCTGAGGTTTGGG - Intronic
1095596561 12:43965806-43965828 ATTGCGTGACACTGAGGTTTCGG + Intronic
1095634327 12:44414928-44414950 ATTGCATGTCACTTTGGTTTGGG + Intergenic
1095696206 12:45147018-45147040 GTTGTAAGACACTGAGATTTTGG - Intergenic
1095936460 12:47688419-47688441 ATTGTATGATACTGAGGTTTGGG - Intronic
1096010374 12:48208787-48208809 ATTGCATGGTGCTGAGGTTTGGG - Intergenic
1096053880 12:48634647-48634669 GTTGTAAGCCACTGAGTTTTTGG + Intergenic
1096291438 12:50347091-50347113 GTTTTAAGCCACTGAGGCTTGGG - Intronic
1096936683 12:55287773-55287795 ATTGCATGTTGCTGAGGTTTGGG - Intergenic
1096963693 12:55606581-55606603 GTTGCATGATGCTGAGGTTTAGG - Intergenic
1097307449 12:58085235-58085257 GTTCTATACCACTGAGTTTTAGG + Intergenic
1097332315 12:58344776-58344798 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1097725488 12:63070971-63070993 GTTTCAAGCCACAGAGTTTTGGG + Intergenic
1098200993 12:68055477-68055499 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1098206808 12:68119347-68119369 GTTAAATGTTACTGAGGTTTTGG - Intergenic
1098512903 12:71339877-71339899 ATTGCATGATGCTGAGGTTTGGG - Intronic
1098514135 12:71354065-71354087 ATTGCATGATGCTGAGGTTTGGG - Intronic
1098976302 12:76905565-76905587 GTTGTAAGCCCCTAAGGTTTAGG + Intergenic
1099432479 12:82604441-82604463 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1099577577 12:84400885-84400907 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1099668700 12:85662535-85662557 ATTGCATGATGCTGAGGTTTAGG + Intergenic
1099836642 12:87914902-87914924 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1100265444 12:92971360-92971382 GTTGTAAGCCACTGAGACTTAGG + Intergenic
1100365254 12:93914651-93914673 GTTGCATGAATCTGAGATTTGGG - Intergenic
1100373310 12:93989592-93989614 GTTTTATGTCACTGAGATTTTGG + Intergenic
1100547494 12:95617001-95617023 CTTTCATACCTCTGAGGTTTTGG - Intergenic
1100667080 12:96766854-96766876 GTTGTAGGCCACTGAGTTTTAGG - Intronic
1100718423 12:97329713-97329735 GTTGCATCCTATTGAGGTTACGG + Intergenic
1100951000 12:99849127-99849149 ATTGCATGATTCTGAGGTTTGGG - Intronic
1101014000 12:100480720-100480742 GTTTTATGCCACTAAGCTTTGGG - Intronic
1101040721 12:100752857-100752879 CCTGTATGCCACTGAGGTTTTGG - Intronic
1101695861 12:107125809-107125831 GTTGTAAGCCATTGAGATTTGGG - Intergenic
1101845573 12:108360595-108360617 GTGGGAAGCCCCTGAGGTTTTGG + Intergenic
1102636323 12:114327418-114327440 GTGTCAAGCCACTGAGTTTTAGG + Intergenic
1102636628 12:114330271-114330293 ATTGCATGATACTGAGGTTTGGG + Intergenic
1102791091 12:115646154-115646176 ATTGCATGATGCTGAGGTTTAGG + Intergenic
1102909950 12:116705687-116705709 GTTGCACGCCACTGCGGAGTTGG - Intergenic
1103057136 12:117830435-117830457 ATTGTATGACACTGAGGTTTGGG - Intronic
1103229332 12:119315006-119315028 ATTGCATGATACTGAGGTTTGGG + Intergenic
1103469060 12:121165494-121165516 GTTTCAGGCTTCTGAGGTTTGGG - Intronic
1103891700 12:124243846-124243868 ATTGCATGTCGCTGAGGTTTAGG + Intronic
1104401101 12:128477082-128477104 GTTTTAGGCCACTGAGTTTTGGG - Intronic
1104409349 12:128545027-128545049 GTTGCCTGAGGCTGAGGTTTGGG + Intronic
1104483490 12:129129045-129129067 ATTGCATGATGCTGAGGTTTGGG + Intronic
1104484816 12:129141852-129141874 ATTGCATGATACTGAGGTTTAGG - Intronic
1105228214 13:18458240-18458262 ACTGCATGACATTGAGGTTTGGG + Intergenic
1105609802 13:21958321-21958343 ATTGCATGACACTGAGGTTTGGG + Intergenic
1105664818 13:22542108-22542130 ATTGCATGATGCTGAGGTTTAGG - Intergenic
1105694833 13:22877377-22877399 ATTGCATGGTGCTGAGGTTTTGG + Intergenic
1105929031 13:25034521-25034543 ATTGCATGACAGTGAGGTTTGGG + Intergenic
1106009625 13:25806884-25806906 GTGGTATGCCATTGTGGTTTTGG + Intronic
1106318841 13:28619547-28619569 ATTGCATGACGCCGAGGTTTAGG + Intergenic
1106497948 13:30297948-30297970 ATTGCATGATGCTGAGGTTTGGG - Intronic
1106561470 13:30850114-30850136 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1107097739 13:36554430-36554452 ATTGCATGACGTTGAGGTTTGGG + Intergenic
1107109691 13:36683508-36683530 GTTTTAAGCCACTGAGATTTGGG - Intronic
1107311135 13:39079469-39079491 ATTGCATGACACCGAGGTTTGGG - Intergenic
1107718616 13:43225348-43225370 ATTGCATGACTCTGAGGTTTGGG - Intronic
1108079981 13:46725284-46725306 GTTGTGTGATACTGAGGTTTAGG - Intronic
1108104420 13:46993248-46993270 ATTGCATGATCCTGAGGTTTGGG + Intergenic
1108162585 13:47657308-47657330 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1108496680 13:51032412-51032434 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1108644064 13:52408685-52408707 ATTGCATGTTGCTGAGGTTTGGG - Intergenic
1109090194 13:58032680-58032702 TTTCCATATCACTGAGGTTTAGG + Intergenic
1109107202 13:58268393-58268415 ATTGCATGGTACTGAGGTTTGGG - Intergenic
1109213096 13:59557490-59557512 ATTGCATGGTGCTGAGGTTTTGG - Intergenic
1109302551 13:60604269-60604291 ATTGCATGATGCTGAGGTTTAGG - Intergenic
1109399069 13:61801055-61801077 ATTACATGACACTGAGGTTTGGG + Intergenic
1109660503 13:65452691-65452713 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1110068583 13:71143113-71143135 GTTGAAAGCTACTGAGATTTTGG - Intergenic
1110131524 13:72017516-72017538 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1110393586 13:75004181-75004203 ATTGCATGACACTGAGGTTTGGG + Intergenic
1111017945 13:82405532-82405554 ATTGCATGAAACTGAGGTTTGGG - Intergenic
1111211614 13:85087082-85087104 ATTGCATGGTGCTGAGGTTTAGG - Intergenic
1111239137 13:85451805-85451827 ATTGCATGATACTGAGGTTTGGG + Intergenic
1111486971 13:88915971-88915993 AGTGCATTACACTGAGGTTTGGG - Intergenic
1111846323 13:93513823-93513845 ATTTCATGCCACTGGTGTTTGGG - Intronic
1111856330 13:93642057-93642079 ATTGCATGATATTGAGGTTTGGG + Intronic
1112292205 13:98154800-98154822 GTTTCAAGCCACTCAGCTTTGGG - Intronic
1112421048 13:99249082-99249104 ATTGCATGATGCTGAGGTTTGGG + Intronic
1112428677 13:99329888-99329910 GTTTCAAGCCACTGAGTCTTAGG + Intronic
1113164152 13:107418608-107418630 ATTGCATGTCAGTGAGGTTTGGG + Intronic
1113304687 13:109064911-109064933 GTTTTATGCCACTGAGTTTGGGG - Intronic
1114176911 14:20330422-20330444 ATTGCATGATGCTGAGGTTTGGG - Intronic
1114368541 14:22058020-22058042 ATTGCGTGACACTGAGGTATGGG - Intergenic
1114705653 14:24724150-24724172 ATTGCATGATACTGAGGTTTGGG - Intergenic
1114860809 14:26518814-26518836 TTTGCATGACTCTGATGTTTGGG + Intronic
1114868497 14:26627506-26627528 ACTGCATGACACTGAGTTTTGGG - Intergenic
1115046414 14:29000380-29000402 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1115117631 14:29901422-29901444 ATTGCATGATGCTGAGGTTTAGG - Intronic
1115163392 14:30420837-30420859 GTTGCATGCCACTGAGTTTTGGG - Intergenic
1115303139 14:31906850-31906872 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1115647121 14:35376530-35376552 GTTTTAAGCCACTGAGTTTTTGG - Intergenic
1115724528 14:36198606-36198628 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1116009630 14:39335666-39335688 ATTGCATGATACTGAAGTTTGGG + Intronic
1116085015 14:40224501-40224523 ATTGTGTGACACTGAGGTTTGGG - Intergenic
1116133835 14:40894941-40894963 GTTCTGTACCACTGAGGTTTGGG - Intergenic
1116766857 14:49083108-49083130 CTTGTGTGACACTGAGGTTTGGG - Intergenic
1116851197 14:49911118-49911140 ATTGCATGATGCTGAGGTTTAGG - Intergenic
1117650960 14:57904985-57905007 GTTACATACCACTAAGTTTTGGG - Intronic
1117838981 14:59838004-59838026 AATGCATGATACTGAGGTTTGGG + Intronic
1118158403 14:63264054-63264076 CGTGAATGACACTGAGGTTTGGG + Intronic
1118190389 14:63574806-63574828 TTTGCATGGTACTGAGGTTTGGG + Intergenic
1118522720 14:66604757-66604779 ATTGCATGATGCTGAGGTTTGGG + Intronic
1118539864 14:66811228-66811250 ATTGCATGATGCTGAGGTTTGGG - Intronic
1118706211 14:68482898-68482920 TTTGCAAGTCACTGAGATTTGGG - Intronic
1120393698 14:83941727-83941749 ATTGCATAATACTGAGGTTTGGG + Intergenic
1120492430 14:85194154-85194176 GTTTTAAGCCACTGAGATTTGGG + Intergenic
1120888682 14:89472286-89472308 ATTTTATGCCACTGAGTTTTGGG + Intronic
1121187034 14:91982545-91982567 ACTGCTTGACACTGAGGTTTGGG - Intronic
1121349309 14:93160871-93160893 GTTGGAAGCCCCTGAGATTTGGG + Intergenic
1121391178 14:93576360-93576382 ATTGCATGATGCTGAGGTTTGGG - Intronic
1121827387 14:97021507-97021529 GTTATAAGCCACTGAGATTTGGG + Intergenic
1121974710 14:98392249-98392271 ATAGCATCCCACTGAGGATTAGG - Intergenic
1124390912 15:29256265-29256287 GTTGCATGGTGCTGAAGTTTAGG - Intronic
1124409757 15:29427403-29427425 GTTTTAAGCCACTGAGTTTTTGG - Intronic
1124501712 15:30233707-30233729 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1124741853 15:32304944-32304966 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1125144779 15:36454146-36454168 GTTGCTTGATGCTGAGGTTTGGG + Intergenic
1125382116 15:39097502-39097524 ATTACATGATACTGAGGTTTGGG + Intergenic
1125755156 15:42058667-42058689 ATCGCATGGTACTGAGGTTTGGG - Intergenic
1125764779 15:42127317-42127339 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1126192824 15:45896483-45896505 GTTGTAGTCCTCTGAGGTTTGGG + Intergenic
1126231917 15:46337130-46337152 ATTGCATGATGCTGAGGTTTAGG - Intergenic
1126233200 15:46351960-46351982 ATTGCATGATACTGAGGTTGGGG + Intergenic
1126865686 15:52934367-52934389 GTTGAATGCCATTGAGTTTTAGG + Intergenic
1127346138 15:58101222-58101244 ATTGCATGTTGCTGAGGTTTGGG - Intronic
1127369344 15:58322825-58322847 ATTGCATGATGCTGAGGTTTAGG + Intronic
1127700697 15:61497413-61497435 GTTGCAAGTTGCTGAGGTTTTGG - Intergenic
1127743954 15:61944705-61944727 ATTGCATGATGCTGAGGTTTGGG - Intronic
1127888106 15:63221916-63221938 GTTACAAGCAACTGAGATTTTGG - Intronic
1128029116 15:64463670-64463692 ATGGCCTGCCACTGAGGTGTTGG + Intronic
1128195470 15:65750419-65750441 ATTGCATGATGCTGAGGTTTAGG - Intronic
1128319510 15:66683232-66683254 GTTTTAAGCCACTGAGTTTTGGG + Intronic
1128525896 15:68412085-68412107 ATTGTGTGCCACTGAGATTTGGG + Intronic
1128702088 15:69812349-69812371 GCCGCATGCCAGTGAGGGTTGGG - Intergenic
1129293154 15:74584099-74584121 ACTGCAGGGCACTGAGGTTTGGG + Intronic
1129376835 15:75138826-75138848 GTTTCATGCCACTAAGCCTTGGG + Intergenic
1129944703 15:79528618-79528640 GTTTTAAGCCACTGAGTTTTAGG + Intergenic
1130397688 15:83517805-83517827 ATTGCATGACGCTGAGGTTTGGG + Intronic
1131017477 15:89070039-89070061 GTTATAAGCCACTGAGATTTTGG - Intergenic
1131231136 15:90660459-90660481 GTTTCATGCCACTAAGTTTTGGG + Intergenic
1132010729 15:98273965-98273987 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1133655938 16:7863931-7863953 ATTGTATGACACTGAGGTTTTGG + Intergenic
1133709547 16:8388093-8388115 ATTGCATGACACTGAGACTTAGG - Intergenic
1134347614 16:13405533-13405555 ATTGCATGATGCTGAGGTTTTGG + Intergenic
1134562776 16:15224967-15224989 GTTGCATGCCACAGAGTTTGGGG + Intergenic
1134815923 16:17205960-17205982 GTTGTATGCAAATGAGGCTTGGG + Intronic
1134923314 16:18136600-18136622 GTTGCATGCCACAGAGTTTGGGG + Intergenic
1135066402 16:19313918-19313940 GTTTTAAGCCACTGAGTTTTGGG - Intronic
1135472513 16:22743972-22743994 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1135638961 16:24103614-24103636 ATTGCATGATGCTGAGGTTTGGG + Intronic
1135892295 16:26368164-26368186 ATGGCATGACACTGAGGTTTGGG - Intergenic
1135923224 16:26669798-26669820 GTTGCATGATGCTAAGGTTTGGG + Intergenic
1136421625 16:30137885-30137907 GTTTCATGCCACTAAATTTTAGG - Intergenic
1136600730 16:31285700-31285722 ATTGCATGTTGCTGAGGTTTGGG + Intronic
1137069354 16:35887366-35887388 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1137459821 16:48650023-48650045 GTTCCATGCAACTGAGGTTGTGG + Intergenic
1137510842 16:49098745-49098767 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1137560920 16:49501964-49501986 ATTGCATGCTGCTGAGGTTTGGG - Intronic
1137800285 16:51256703-51256725 ATTGCATGACACTGAGGTTTGGG - Intergenic
1137919938 16:52477032-52477054 ATTGCATGATGCTGAGGTTTGGG + Intronic
1137935876 16:52635026-52635048 GTTGTATGATACTGAAGTTTGGG + Intergenic
1138006049 16:53338722-53338744 ATTGCATGATACTGAGGTTTAGG - Intergenic
1138268001 16:55674087-55674109 ATTGCATGATGCTGAGGTTTGGG + Intronic
1138639882 16:58376897-58376919 GTTTTAAGCCACTAAGGTTTTGG - Intronic
1138809631 16:60133670-60133692 ATTGCATGGTGCTGAGGTTTGGG + Intergenic
1138907697 16:61357634-61357656 ATGGCATGACGCTGAGGTTTGGG - Intergenic
1138921520 16:61535838-61535860 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1139088310 16:63615809-63615831 ATTGCATGATGCTGAGGTTTTGG + Intergenic
1140339640 16:74145036-74145058 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1140339892 16:74147169-74147191 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1140364841 16:74373333-74373355 GTTGTAAGGCACTGAGTTTTGGG + Intergenic
1140654741 16:77127989-77128011 ATTGTGTGACACTGAGGTTTGGG - Intergenic
1140697269 16:77547517-77547539 GTTGCGTGTTGCTGAGGTTTGGG - Intergenic
1141057990 16:80836388-80836410 GTTGCATGATGCTGACGTTTGGG + Intergenic
1141075329 16:81001271-81001293 ATTGGATGACACTGAGGTTTGGG - Intronic
1141321296 16:83011633-83011655 GGTGAATGCCACTGAGGGTTCGG + Intronic
1141340950 16:83203310-83203332 ATTGCATGACTCTGAGGTCTTGG - Intronic
1141711192 16:85699965-85699987 GTTGTAAGCCACTGAGTTTGGGG + Intronic
1141786855 16:86206719-86206741 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1141860913 16:86715613-86715635 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1142970150 17:3605914-3605936 GTTTGAAGCCACTGAGATTTGGG - Intergenic
1143275741 17:5708499-5708521 GTTGTATGTCATTGAGTTTTGGG + Intergenic
1143934101 17:10464068-10464090 ATTGCATGATACTGAGATTTAGG + Intronic
1144047834 17:11469492-11469514 GTTTTATGCCACTGAGTTTGGGG + Intronic
1144240690 17:13308159-13308181 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1144513630 17:15899504-15899526 ATGGCATGCTGCTGAGGTTTGGG + Intergenic
1144519011 17:15942049-15942071 GTTGCAGTCCACTGAGTTTCAGG - Intergenic
1144717464 17:17444440-17444462 GTTTCAAGCCACTAAGTTTTGGG + Intergenic
1145120275 17:20253081-20253103 GTGGCGTGTCACTGTGGTTTTGG + Intronic
1146323986 17:31869729-31869751 ATTGCGTGACACTGAGGTTTGGG + Intronic
1147455053 17:40531995-40532017 GTTTCAAGACACTGAGCTTTAGG + Intergenic
1148379180 17:47180499-47180521 ATTTCCTGCCCCTGAGGTTTAGG + Intronic
1149237971 17:54615659-54615681 GTTGCATGATGCTGAGGTTTGGG + Intergenic
1149857280 17:60093816-60093838 ATTTCAAGCCACTGAGCTTTGGG + Intergenic
1149919211 17:60640596-60640618 ATTGCATGGTGCTGAGGTTTGGG + Intronic
1150526248 17:65925927-65925949 GTTCTAAGCCACTGAGGTTTAGG + Intronic
1150849790 17:68693827-68693849 ATTGCAAGCCACTCAGTTTTAGG + Intergenic
1150936286 17:69639218-69639240 ATTGTAAGCCACTGAAGTTTGGG - Intergenic
1151271174 17:72997136-72997158 GTTGTATACCGCTGAGATTTTGG + Intronic
1151410829 17:73927310-73927332 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1152542969 17:80986047-80986069 GTTTTAAGCCACTGAGTTTTGGG - Intergenic
1152982825 18:295136-295158 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1153326497 18:3826208-3826230 ATTGCATAACACTGAGATTTGGG - Intronic
1153413993 18:4825172-4825194 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1153466255 18:5390933-5390955 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1153472245 18:5459959-5459981 ATTGCATGATGCTGAGGTTTGGG + Intronic
1153638242 18:7131785-7131807 GTTTTATGCTTCTGAGGTTTGGG - Intergenic
1153680258 18:7493769-7493791 ATTGCAGGATACTGAGGTTTGGG + Intergenic
1153746207 18:8182271-8182293 ATTGCATGATGCTGAGGTTTGGG + Intronic
1153871045 18:9320378-9320400 GTTGTAGCCCACTGAGTTTTGGG + Intergenic
1154020315 18:10659014-10659036 GTTTTAAGCCACAGAGGTTTGGG - Intergenic
1154196561 18:12271510-12271532 GTTTCATGCCACTGAGGTTCTGG + Intronic
1155102713 18:22628866-22628888 GTTTTAAGCCACTGAGGTTTGGG - Intergenic
1155111967 18:22724700-22724722 ATTGCATGTCACTGAGGTTTGGG - Intergenic
1155226565 18:23734450-23734472 ATTTGAAGCCACTGAGGTTTTGG + Intronic
1155745540 18:29352651-29352673 ATTGCATGATGCTGAGGTTTAGG + Intergenic
1155775688 18:29757573-29757595 ATTGCATGACTCTGAGGTTTGGG - Intergenic
1155952758 18:31931320-31931342 GTTACATACCACTGATGTTAAGG + Exonic
1156278257 18:35606028-35606050 GTTTTAAGCCACTGAGGTTTTGG - Intronic
1156290343 18:35743772-35743794 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1157101116 18:44730856-44730878 TTTTAATGCCACTGAGTTTTGGG - Intronic
1157158462 18:45290164-45290186 ATTGCGTGACACTGAGGTTTTGG + Intronic
1157444824 18:47736809-47736831 GTTGGAAGCCTCTGAGGCTTGGG - Intergenic
1157975839 18:52325714-52325736 ATTGTATGACACTGAGGTTTAGG - Intergenic
1158322739 18:56281359-56281381 GTTGCATGATGCTAAGGTTTGGG + Intergenic
1158709584 18:59825510-59825532 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1158895990 18:61913276-61913298 ATTGCATGTTGCTGAGGTTTGGG - Intergenic
1159087802 18:63813809-63813831 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1159407306 18:68020845-68020867 GTTGCATACCACTGAATTTTGGG + Intergenic
1160320234 18:77884394-77884416 ATTACATGATACTGAGGTTTGGG - Intergenic
1161986794 19:7659827-7659849 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1162011632 19:7819771-7819793 GTTTTATGCCACTGAGTTCTCGG + Intergenic
1163057371 19:14730720-14730742 ATTGCATGATGCTGAGGTTTGGG + Intronic
1163340755 19:16705344-16705366 ATTGCATGATGCTGAGGTTTAGG - Intergenic
1163485204 19:17581287-17581309 GTTCCATACGACTGAGGTCTCGG - Exonic
1163679859 19:18674925-18674947 GTTGCATGCCATTGAGACTTGGG - Intergenic
1164448476 19:28337914-28337936 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1164461634 19:28454093-28454115 TTTGCATGATGCTGAGGTTTGGG + Intergenic
1164494053 19:28741948-28741970 ATTGCATGTCACTGAGGTTTGGG - Intergenic
1164976356 19:32575499-32575521 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1165366470 19:35370486-35370508 ATTGCATAATACTGAGGTTTGGG - Intergenic
1165431005 19:35772835-35772857 GTTTTATGCCACTAAGTTTTGGG - Intergenic
1165581031 19:36863931-36863953 GTTCCATGCCAATGGGATTTGGG - Intronic
1165609708 19:37140660-37140682 GTTGCGTGATGCTGAGGTTTGGG - Intronic
1165643181 19:37407757-37407779 ATTGCATGATACTGAGGTTTGGG + Intergenic
1166681589 19:44770964-44770986 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1167295930 19:48649614-48649636 GTTTTAAGCCACTGAGTTTTAGG - Intergenic
1167553280 19:50175880-50175902 GTTTCATGTCTCTGAGATTTGGG - Intergenic
925803653 2:7627336-7627358 GTTTTATGCCAGTGAGTTTTTGG + Intergenic
926160073 2:10481681-10481703 GTCGGAAGCCACTGAGTTTTGGG + Intergenic
926382751 2:12306750-12306772 ATTGCATGATATTGAGGTTTGGG - Intergenic
926420372 2:12690592-12690614 GTTGTATCTCACTGTGGTTTTGG - Intergenic
927174085 2:20393119-20393141 GTTGCAAGCCACTGAGAGTTGGG - Intergenic
927467116 2:23345668-23345690 GTTGGAAGCCACTGAGATTTGGG - Intergenic
928011751 2:27615355-27615377 GTTTTAAGCCACTGAGGTTCAGG - Intronic
928087338 2:28353986-28354008 ATTGCATGACACTGAGGCTTGGG - Intergenic
928228138 2:29472367-29472389 GTTCTTTGCCACTGAGTTTTGGG + Intronic
928485388 2:31725857-31725879 ATTGCATGATACTGAGGTTTGGG - Intergenic
929727684 2:44447502-44447524 GTTGTAAGCCACTGAGGTTGGGG - Intronic
929730822 2:44489911-44489933 ATTGCATAATACTGAGGTTTGGG - Intronic
930210115 2:48627780-48627802 ATTGCATGATTCTGAGGTTTGGG + Intronic
930312428 2:49757963-49757985 ATTGCATGATGCTGAGGTTTGGG - Intergenic
930568709 2:53056800-53056822 ATTGTGTGACACTGAGGTTTGGG - Intergenic
930628455 2:53725371-53725393 ATTGCATGATGCTGAGGTTTGGG - Intronic
930836441 2:55798835-55798857 ATTGCATGAAAATGAGGTTTAGG - Intergenic
931425685 2:62169070-62169092 ATTGCATGTCACTGGAGTTTGGG + Intergenic
931580820 2:63771607-63771629 ATTGCATGATGCTGAGGTTTGGG + Intronic
931629576 2:64286758-64286780 ATTGCATGACACTGAAGTTTGGG + Intergenic
932557190 2:72834836-72834858 GTTGTATGCCACTGCCTTTTGGG + Intergenic
932661735 2:73660442-73660464 ATTGCTTGACACTGAGGTTTGGG + Intergenic
932806283 2:74786146-74786168 ATTGCATGATGCTGAGGTTTGGG + Intergenic
932890743 2:75595375-75595397 GTTTGAAGCCACTGAGATTTGGG - Intergenic
932947842 2:76258199-76258221 GTTGCATGGCACTGTGGACTTGG - Intergenic
933181011 2:79227816-79227838 ATTACATGATACTGAGGTTTGGG + Intronic
933463488 2:82620021-82620043 GTTGCATGCATCCGAGCTTTTGG + Intergenic
933521856 2:83383858-83383880 GTTGCATGATTCTGAGGTTTGGG - Intergenic
933576171 2:84070967-84070989 ATTGCATGTTGCTGAGGTTTGGG - Intergenic
933644902 2:84803385-84803407 ATTGCATGGTGCTGAGGTTTGGG - Intronic
933787321 2:85853778-85853800 GTTGCCTATCACTGAGGATTTGG - Intronic
933918205 2:87018004-87018026 ATTGCGTGACACTGAGCTTTGGG - Intronic
934004789 2:87751909-87751931 ATTGCGTGACACTGAGCTTTGGG + Intronic
934144676 2:89080027-89080049 TTTGCATGATGCTGAGGTTTGGG + Intergenic
934224579 2:90120524-90120546 TTTGCATGATGCTGAGGTTTGGG - Intergenic
934700836 2:96438907-96438929 CTTGGAAGCTACTGAGGTTTGGG - Intergenic
934744518 2:96750352-96750374 GTTTTAAGCCACTGAGTTTTGGG + Intergenic
935068337 2:99672120-99672142 GTTGCATGCTGATGAGGTTAAGG + Intronic
935083662 2:99824021-99824043 ATTGCATGATGCTGAGGTTTGGG - Intronic
935197574 2:100827444-100827466 ATTGCATGATACTGAGGTGTGGG + Intronic
935767747 2:106385942-106385964 ATTGCGTGACACTGAGCTTTGGG + Intergenic
936509091 2:113131187-113131209 GTTTCAAGCCACTGGGTTTTGGG - Intronic
936669440 2:114639582-114639604 ATTGCATGATGCTGAGGTTTGGG - Intronic
936745468 2:115571289-115571311 ATTGCATGATGCTGAGGTTTGGG + Intronic
937134396 2:119540467-119540489 GTTTCATGCCTTTGAGTTTTGGG - Intergenic
937145067 2:119637390-119637412 GCTGCATGTCACTTAAGTTTGGG + Intronic
937508737 2:122569081-122569103 ATTGCATGATGCTGAGGTTTGGG - Intergenic
937609751 2:123846510-123846532 ATTGCATGATGCTGAGGTTTAGG - Intergenic
937794814 2:126004576-126004598 GTTGTAAGCCATTGAGATTTGGG - Intergenic
938088037 2:128414359-128414381 TTTTTATGCCACTGAGTTTTGGG - Intergenic
938390789 2:130903604-130903626 GTTGCATGACGCTGAGGTTTGGG + Intronic
938641146 2:133281743-133281765 GTTTCAAGCCACTGAGATCTAGG - Intronic
938725719 2:134107428-134107450 GTTGAATGCCATTGACTTTTAGG - Intergenic
938729107 2:134132040-134132062 GTTGTAAGCCACTGAGTTTGGGG + Intronic
938974630 2:136464191-136464213 ATTGCATGATGCTGAGGTTTTGG + Intergenic
939062353 2:137437897-137437919 TCTGCATGCCACAGAGGTTTTGG + Intronic
939269864 2:139924377-139924399 GTTTAAAGCCACTGAGTTTTGGG + Intergenic
940292763 2:152093850-152093872 GTTTCAAGCCACAGAGTTTTGGG + Intronic
940720077 2:157272434-157272456 ATTGCATGCTGCTGAGGTTTAGG + Intronic
940779098 2:157914438-157914460 ATTGCATGATGCTGAGGTTTGGG - Intronic
940867075 2:158827772-158827794 ATTGCATGATGCTGAGGTTTGGG - Intronic
941097583 2:161257435-161257457 GTTGTACGCCACTGAGATTTGGG - Intergenic
941121454 2:161535223-161535245 ATTGTGTGACACTGAGGTTTGGG - Intronic
941132570 2:161671619-161671641 TTTGCATGACGCTGAGGTTTGGG - Intronic
941143300 2:161812425-161812447 GTTGTATGATGCTGAGGTTTGGG + Intronic
941304582 2:163846707-163846729 ATTGTGTGACACTGAGGTTTGGG - Intergenic
942048513 2:172116168-172116190 GTTTCAAGCTACTGAGTTTTGGG - Intergenic
942485401 2:176434264-176434286 GTTGTAAGTCACTGAGATTTGGG + Intergenic
942865609 2:180670768-180670790 ATTGCATGATGCTGAGGTTTAGG + Intergenic
942914420 2:181285920-181285942 ATTGCATGACACTGAGGTTTGGG - Intergenic
943133215 2:183882459-183882481 GTTGCATGATGCTGAGGTTTGGG + Intergenic
943433356 2:187831828-187831850 ATTGCATGACACTGAGGCTTGGG - Intergenic
943446251 2:187991794-187991816 ATTGCATGACACTGAGGTTTGGG - Intergenic
944055102 2:195515398-195515420 GTTTCATGCCACTAAGTTTGTGG - Intergenic
944951608 2:204756819-204756841 ACTGCATGACTCTGAGGTTTGGG + Intronic
945030893 2:205662829-205662851 GCTGTAAGTCACTGAGGTTTGGG - Intergenic
945058812 2:205890799-205890821 GTTGCGTGATGCTGAGGTTTGGG - Intergenic
945200161 2:207273189-207273211 ATTGCATGATGCTGAGGTTTGGG + Intergenic
945397370 2:209336551-209336573 GTTGTAAGCCACTGAGATTTTGG + Intergenic
945522307 2:210844022-210844044 ATTGCATGATGCTGAGGTTTGGG + Intergenic
945605065 2:211918896-211918918 GTTTTAAGCCACTGAGATTTTGG + Intronic
945629616 2:212256975-212256997 ATTGCATGATGCTGAGGTTTAGG + Intronic
945809169 2:214527328-214527350 ATTGCATGATACTGAGGTTTAGG - Intronic
946160391 2:217832188-217832210 CTTCCAGGACACTGAGGTTTGGG - Intronic
946708083 2:222478623-222478645 GTTGCCTTCCAGTGAGTTTTGGG - Intronic
946781994 2:223201431-223201453 GTTTTAAGCCACTGAGTTTTGGG - Intergenic
947024280 2:225719121-225719143 GTTTTAAGCCACTGAGATTTTGG - Intergenic
947246029 2:228049559-228049581 ACTGCATGACACTAAGGTTTGGG + Intronic
947349077 2:229223837-229223859 GTTGCATAATGCTGAGGTTTGGG + Intronic
947443932 2:230148690-230148712 GTTTTAAGCCACTGAGATTTGGG + Intergenic
948557113 2:238820677-238820699 GTTGCTTGATGCTGAGGTTTGGG - Intergenic
1168733784 20:111953-111975 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1169248162 20:4040368-4040390 GTTGAAAGCCACTGAGCTTAGGG - Intergenic
1169941480 20:10942509-10942531 ATTGCATGACCCTGAGGTTTGGG + Intergenic
1169944172 20:10971255-10971277 GTTGTATGCCACTGAGTTTTAGG - Intergenic
1170019989 20:11826681-11826703 ATTGTGTGACACTGAGGTTTGGG - Intergenic
1170034453 20:11975482-11975504 GTTGTAAGCCACTGAGGCATGGG - Intergenic
1170635266 20:18098944-18098966 GTTTTAAGCCACTGAGTTTTGGG - Intergenic
1170712776 20:18807402-18807424 GTTGCCTGGGACTGAGGGTTGGG - Intergenic
1170902474 20:20478791-20478813 ATTGCATGATGCTGAGGTTTGGG - Intronic
1171082646 20:22203340-22203362 ATTGCATGATACTGAGGTGTGGG - Intergenic
1171392123 20:24808474-24808496 GTTTCAAGCCCCTAAGGTTTAGG - Intergenic
1172070783 20:32255301-32255323 GTTTCATGCCACTAAGTTTGGGG - Intergenic
1173198501 20:40936219-40936241 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1173316811 20:41951817-41951839 GTGGTAAACCACTGAGGTTTTGG + Intergenic
1173655057 20:44694384-44694406 GTGCAAAGCCACTGAGGTTTTGG - Intergenic
1173745728 20:45435556-45435578 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1174540777 20:51287604-51287626 ATTGTATGCCACTGAGTTCTGGG + Intergenic
1174561809 20:51436178-51436200 ATTACATGACACTGAGGTTCGGG - Intronic
1174652503 20:52139584-52139606 ATTGCATGTCACTGGGGTTTGGG - Intronic
1176772190 21:13086432-13086454 ACTGCATGACATTGAGGTTTGGG + Intergenic
1177105947 21:16955751-16955773 GTTGCATAATGCTGAGGTTTGGG + Intergenic
1177149872 21:17444764-17444786 ATTGCATGATGCTGAGGTTTGGG + Intronic
1177454756 21:21322387-21322409 ATTGCATGATTCTGAGGTTTGGG - Intronic
1177479408 21:21667564-21667586 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1177890082 21:26794511-26794533 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1178503337 21:33143823-33143845 GTTTTATGCCACTGAGGTTTTGG - Intergenic
1178563049 21:33657088-33657110 ATTGCATGATGCTGAGGTTTGGG + Intronic
1179171762 21:38978467-38978489 ATTGCATGACACTGAGATTTAGG + Intergenic
1180834059 22:18921030-18921052 GTTTCAGGCCTCTGAAGTTTGGG + Intronic
1180925230 22:19549208-19549230 GTTTCAGGCCACTGAGGTTTGGG + Intergenic
1181331151 22:22092278-22092300 ATTGCATGACACGGAGGCTTGGG - Intergenic
1181331585 22:22096603-22096625 GTTGCATAATACTGAGGCTTGGG - Intergenic
1181504474 22:23342801-23342823 GTTGCACGATGCTGAGGTTTGGG + Intergenic
1181561261 22:23702703-23702725 ACTGCATGCCACTGAGACTTGGG - Intergenic
1181561761 22:23707546-23707568 ATTGCATGACACTGAGACTTGGG - Intergenic
1181655589 22:24295413-24295435 GTTGCACGATGCTGAGGTTTGGG + Intronic
1181709471 22:24673032-24673054 GTTGCACGATGCTGAGGTTTGGG + Intergenic
1182990298 22:34761143-34761165 GTTGCATGCCTCTGAAGTTTGGG - Intergenic
1183029294 22:35091268-35091290 GTTTCAGGCCACTAAGTTTTGGG - Intergenic
1183159469 22:36102256-36102278 ATTTCAAGCCACTGAGTTTTAGG + Intergenic
1184862395 22:47180450-47180472 GTTGCAAGCCACTGTGGGGTGGG - Intergenic
1203284147 22_KI270734v1_random:146328-146350 GTTTCAGGCCTCTGAAGTTTGGG + Intergenic
949146747 3:710038-710060 ATTGCATGATGCTGAGGTTTGGG + Intergenic
949492518 3:4603298-4603320 ATTGCATGATGCTGAGGTTTGGG + Intronic
949780218 3:7678152-7678174 ATTGCATGATGCTGAGGTTTGGG - Intronic
950162139 3:10768320-10768342 GTTGCAAGCCACTGATATTTGGG + Intergenic
950238916 3:11350357-11350379 ATTGTAAGCCACTGAGATTTTGG - Intronic
951047265 3:18054017-18054039 ATTGCATGATGCTGAGGTTTGGG + Intronic
951071437 3:18333369-18333391 ATTGGATGCCACTGAGTTTTGGG - Intronic
951262866 3:20532456-20532478 GTTTTAAGCCACTGAGATTTGGG - Intergenic
951347379 3:21561927-21561949 GTTTCAGGCCACTGAGTTTGTGG + Intronic
951461909 3:22960060-22960082 ATTGCATGATGCTGAGGTTTGGG - Intergenic
951571660 3:24070401-24070423 ATTGCATGTCACTGGGGTTTGGG + Intergenic
951646201 3:24894173-24894195 ATTGCATGATGCTGAGGTTTGGG + Intergenic
951683063 3:25314754-25314776 ATTGTGTGACACTGAGGTTTGGG + Intronic
952032745 3:29164069-29164091 TTTGCATGGTGCTGAGGTTTGGG + Intergenic
952403657 3:32986342-32986364 GTTGTAAGCTACTAAGGTTTGGG + Intergenic
952424152 3:33157909-33157931 GTTTCATGCCACTAAGTTTTTGG + Intronic
952693421 3:36237187-36237209 ATTGCATGATACTGAGGTTTGGG - Intergenic
952975793 3:38694744-38694766 CTTGCATGACACGGAGTTTTTGG - Intergenic
953464888 3:43110889-43110911 GTTTTATGCCACTAAGTTTTGGG - Intergenic
953477120 3:43215010-43215032 GGGGTATGCTACTGAGGTTTTGG - Intergenic
953483448 3:43272438-43272460 ATTGCATGATGCTGAGGTTTGGG + Intergenic
953541731 3:43825445-43825467 ATTGCATGATGCTGAGGTTTGGG + Intergenic
953726690 3:45405726-45405748 GTTTTAAGCCACTGAGATTTGGG - Intronic
953760449 3:45682873-45682895 GTTTTAAGCCACTGAGGTTGTGG - Exonic
954294633 3:49667429-49667451 GTGCCATGCCACTCAGGCTTGGG - Intronic
955268354 3:57469917-57469939 ATTGCATGACACTGATATTTGGG - Intronic
955357379 3:58242251-58242273 GTTGAAGGCCACTTAGGATTTGG - Intronic
955425429 3:58784452-58784474 ATTGCATGATGCTGAGGTTTGGG - Intronic
955509920 3:59669348-59669370 GTTTCAAGCCACTGAGTTTTGGG - Intergenic
955821990 3:62906223-62906245 GTTGTATACCATTGAGGTTTGGG + Intergenic
955836238 3:63058533-63058555 ATTGCAAGCCACTGAGTTGTGGG - Intergenic
955970173 3:64431129-64431151 ATTGCATGATGCTGAGGTTTGGG - Intronic
956554537 3:70503932-70503954 ATTGCATGATGCTGAGGTTTGGG - Intergenic
956726541 3:72161168-72161190 ATTGCATGATGCTGAGGTTTGGG + Intergenic
956860383 3:73317516-73317538 GCTGCAAGCCATTGAGATTTGGG + Intergenic
956949914 3:74270499-74270521 GTTTTAGGCCACTGAGGTTTGGG + Intronic
957170950 3:76735869-76735891 ATTGCATGATGCTGAGGTTTGGG - Intronic
957366767 3:79234907-79234929 ATTGCATGATTCTGAGGTTTAGG - Intronic
957370136 3:79283305-79283327 ATTGCATGATGCTGAGGTTTGGG - Intronic
957530177 3:81430893-81430915 TTTACATGCCACTGAAGTTTTGG - Intergenic
957538913 3:81542782-81542804 ATTGCATGACACTGAGGTTTGGG - Intronic
957628663 3:82688940-82688962 ATTGCATGAGGCTGAGGTTTGGG - Intergenic
958254104 3:91304892-91304914 ATTGCATGATGCTGAGGTTTGGG + Intergenic
958473924 3:94556329-94556351 ATTGCATGACACCGAGTTTTGGG - Intergenic
958476974 3:94596558-94596580 ATTGCATGATGCTGAGGTTTGGG - Intergenic
958517194 3:95132121-95132143 ATTGCATGACGGTGAGGTTTGGG - Intergenic
958950840 3:100414094-100414116 GTTTCAAGACACTGAGTTTTGGG - Intronic
959291732 3:104483858-104483880 ATAGCATGATACTGAGGTTTGGG - Intergenic
959298634 3:104571607-104571629 ATTGAATGACACTGAGGTTTGGG + Intergenic
959317859 3:104831950-104831972 ATTGCCTGACACTGAGGTTTGGG + Intergenic
959390384 3:105765263-105765285 ATTGCATGATGCTGAGGTTTGGG - Intronic
959434965 3:106303422-106303444 ATTGCATGATACTGAGGTTTGGG + Intergenic
959471713 3:106760486-106760508 ATTGCATGATGCTGAGGTTTGGG - Intergenic
959557708 3:107740908-107740930 GTTGCAAGCAACTAAGGCTTAGG + Intronic
959600288 3:108174901-108174923 ATTGCAAGCCACTGTGATTTGGG + Intronic
959634743 3:108552997-108553019 ATTGCATGACACGGATGTTTGGG - Intronic
959864282 3:111248404-111248426 GTTTCATGTCACTGAGTTTAAGG - Intronic
959956775 3:112248393-112248415 GTTTCAAGCCACTGAATTTTGGG + Intronic
959993656 3:112656756-112656778 ATTGCATGATGCTGAGGTTTGGG + Intergenic
960468937 3:118036193-118036215 GTTGTAAGCAAGTGAGGTTTGGG + Intergenic
960755952 3:121012744-121012766 GTTGTTTGATACTGAGGTTTGGG + Intronic
960933101 3:122874660-122874682 ATTGCATGACAATGAGGTTTGGG + Intronic
961223413 3:125218007-125218029 GTTGTAAGCCACTAAGGTTTGGG + Intergenic
961667966 3:128505365-128505387 GTTTTAGGCCACTGAGTTTTGGG + Intergenic
961792645 3:129387298-129387320 TTTGAATTCCACTGAGCTTTTGG - Intergenic
961845030 3:129755280-129755302 ATTGCATGATGCTGAGGTTTGGG - Intronic
961902338 3:130225203-130225225 ATTGCATGGTACTGAGGTTTGGG + Intergenic
962140402 3:132784313-132784335 GTTGCGTGGTGCTGAGGTTTGGG + Intergenic
962321497 3:134394351-134394373 GTTTTAAGCCACTAAGGTTTGGG - Intergenic
962383855 3:134916970-134916992 GTTTTAAGCCACTGAGGTTGTGG + Intronic
962672702 3:137725590-137725612 GTTGTAAGCCACTGACTTTTGGG + Intergenic
962904904 3:139792804-139792826 GTTTCAAGCCACTGAGCTTAGGG - Intergenic
963616618 3:147547228-147547250 ATTGCGTGACGCTGAGGTTTGGG - Intergenic
963934101 3:151034755-151034777 GTGGCAAGCCATTGAGATTTTGG + Intergenic
964242334 3:154611179-154611201 ATTGCATGATGCTGAGGTTTGGG + Intergenic
964511264 3:157454662-157454684 ATTGCATGATGCTGAGGTTTGGG + Intronic
964513575 3:157480359-157480381 ATTTTATGACACTGAGGTTTGGG + Intronic
964517688 3:157530651-157530673 TTTGCATGCCACAGTGGGTTAGG - Intronic
964535796 3:157719651-157719673 ATTGCATGACCCAGAGGTTTGGG + Intergenic
964641957 3:158918020-158918042 GTTGCAAGCCACTGAGATTTGGG + Intergenic
964919594 3:161880277-161880299 GTTACATGATGCTGAGGTTTGGG - Intergenic
965048329 3:163609997-163610019 ATTGTATGTCAGTGAGGTTTGGG + Intergenic
965138672 3:164807404-164807426 ATTGAGTGCCTCTGAGGTTTGGG - Intergenic
965199839 3:165643502-165643524 ATTGCAAGCCATTGAGATTTTGG - Intergenic
965229507 3:166032395-166032417 ATTGCATGACACGGAGGCTTGGG + Intergenic
965476879 3:169167106-169167128 GTAGCATGCACCTGTGGTTTCGG - Intronic
965618882 3:170622627-170622649 ATTCCAAGCCACTGAGATTTGGG + Intronic
965850270 3:173014520-173014542 ATTACATGACACTGAGGTTTGGG - Intronic
965854890 3:173075083-173075105 ATTGCATGATGCTGAGGTTTAGG - Intronic
966143226 3:176780372-176780394 GTTTTAAGCCACTGAGATTTTGG + Intergenic
966215188 3:177494668-177494690 GTTTCATGCCACTGAGTTGTGGG + Intergenic
966825102 3:183958240-183958262 ATTGCATGACGCTGAGGTCTGGG + Intronic
967321436 3:188198917-188198939 GTTGTATACCACTGAGTTTGGGG - Intronic
967488858 3:190065473-190065495 GTTTTAAGCCACTGAGATTTAGG + Intronic
967495610 3:190141968-190141990 ATTGCATGATGCTGAGGTTTGGG + Intergenic
969075983 4:4578055-4578077 GTTTCATGCAACTGAGCATTAGG + Intergenic
969090456 4:4690191-4690213 GTTTCAAGCCACTAAGTTTTGGG + Intergenic
969092724 4:4707342-4707364 ATTGCATGATGCTGAGGTTTGGG - Intergenic
969164195 4:5291913-5291935 ATTGCATGATGCTGAGGTTTGGG + Intronic
969358414 4:6645517-6645539 GTTTTAAGCCACTGAGATTTGGG + Intergenic
969367492 4:6706502-6706524 GTTGCAAGCCACTAAGGTTTTGG + Intergenic
969383082 4:6820185-6820207 GTTGCATGATGCTGAGGTTTGGG - Intronic
969386428 4:6852651-6852673 GTTTCAAGCCACTAAGTTTTGGG - Intronic
969589967 4:8116182-8116204 GTCTTATGCCACTGAGGCTTGGG + Intronic
970266077 4:14287745-14287767 ATTGCATGATACTAAGGTTTAGG + Intergenic
970370455 4:15400745-15400767 GTTTGAAGCCACTGAGATTTGGG - Intronic
970653776 4:18207743-18207765 ATTGCATGTCACAGGGGTTTGGG + Intergenic
971043118 4:22777079-22777101 GTTGCATGATGCTGAGGTTTGGG - Intergenic
971373105 4:26034040-26034062 TTTGCATCCCACTGAGCTTAGGG - Intergenic
971587669 4:28425033-28425055 ATTACATGATACTGAGGTTTGGG - Intergenic
971650464 4:29265391-29265413 ATTGCATGATGCTGAGGTTTGGG + Intergenic
971893021 4:32550157-32550179 GTTGAAAACCACTGAGATTTGGG - Intergenic
972061953 4:34886401-34886423 ATTGCATGATGCTGAGGTTTGGG + Intergenic
972246684 4:37252496-37252518 GTTTTAAGCCACTCAGGTTTGGG - Intronic
972256697 4:37363743-37363765 ATTGCATGATGCTGAGGTTTGGG - Intronic
972316870 4:37934828-37934850 GTTATAAGCCACTGAGATTTGGG - Intronic
972826084 4:42760743-42760765 ATTGCATGATGCTGAGGTTTGGG - Intergenic
972920947 4:43941014-43941036 ATTGTGTGCTACTGAGGTTTGGG + Intergenic
973582082 4:52354126-52354148 GTTGTAAGTCACTGAGATTTGGG - Intergenic
973585400 4:52385184-52385206 ATTGTGTGACACTGAGGTTTGGG + Intergenic
973657481 4:53064181-53064203 GTTGCATGATGCTGAGGTTTGGG + Intronic
973767454 4:54176146-54176168 ATTGCATGACACTGAGGTTTGGG - Intronic
973910229 4:55572593-55572615 ATTGCATGATGCTGAGGTTTGGG - Intronic
973942454 4:55924398-55924420 GTTGCCTGACCCTGAGGTCTTGG - Intergenic
974121092 4:57640138-57640160 GTGGCAGGCCACAGTGGTTTGGG - Intergenic
974247893 4:59345193-59345215 ATTGCATGATGCTGAGGTTTGGG + Intergenic
974296428 4:60005096-60005118 ATTGCATGATGCTGAGGTTTTGG - Intergenic
974675594 4:65084610-65084632 ATTGCATGACACTCAGGTTTGGG + Intergenic
974703092 4:65476667-65476689 ATTGCATGAGGCTGAGGTTTGGG - Intronic
974731998 4:65878890-65878912 TTTGGAAGCCACTGAGATTTGGG + Intergenic
974879163 4:67732936-67732958 GTTACATGCCAGTGAGAATTTGG + Intergenic
975072005 4:70153300-70153322 ATTGCATGATGCTGAGGTTTGGG + Intronic
975074288 4:70185596-70185618 GTTTCAAGCCACTGATATTTTGG - Intergenic
975267326 4:72385785-72385807 ATTGCATGATGCTGAGGTTTAGG - Intronic
975428231 4:74255549-74255571 ATTGTATGCTGCTGAGGTTTGGG + Intronic
975971223 4:80040202-80040224 ATTGCATGATACTGAGGTTTTGG - Intronic
976079563 4:81340239-81340261 ATTGCATGATGCTGAGGTTTCGG + Intergenic
976131345 4:81887673-81887695 ATTGGATGGCATTGAGGTTTGGG - Intronic
976197593 4:82548265-82548287 ATTGCATGATACTGAAGTTTGGG - Intronic
976373813 4:84321339-84321361 ATTGCATGACATTGAGGTTTGGG + Intergenic
976670098 4:87642484-87642506 ATTGCATGACGCTGAGGTTTGGG - Intergenic
976962697 4:90998788-90998810 ATTGCATGATGCTGAGGTTTGGG + Intronic
977264134 4:94834229-94834251 GTAGGAAGCCACTGAGATTTAGG + Intronic
977357394 4:95964553-95964575 GTTGTAAGCCACTGAGGTTTTGG + Intergenic
977538430 4:98284287-98284309 ATTGCATGATGCTGAGGTTTAGG + Intronic
978298346 4:107235655-107235677 GTTCCATGCTTTTGAGGTTTTGG + Intronic
978408313 4:108402503-108402525 ATTGCATGATGCTGAGGTTTGGG + Intergenic
978910861 4:114062092-114062114 ATTGCATGATACTGAGGATTGGG + Intergenic
978969692 4:114788000-114788022 ATTGCATGATGCTGAGGTTTGGG - Intergenic
979211580 4:118111250-118111272 ATTGCATGATGCTGAGGTTTGGG - Intronic
979529296 4:121751732-121751754 GATACATGCTAATGAGGTTTAGG - Intergenic
979543081 4:121908801-121908823 ATTGCATGATTCTGAGGTTTAGG - Intronic
979605816 4:122637672-122637694 ATTGCATGACACTGTGTTTTGGG + Intergenic
979737158 4:124101385-124101407 ATTGCATGATACTGAGGTTTGGG + Intergenic
979830633 4:125296827-125296849 GTTGCATGATGTTGAGGTTTAGG + Intergenic
980099186 4:128524310-128524332 ATTGCATGATGCTGAGGTTTGGG - Intergenic
980666016 4:135936480-135936502 TTTGCATGATGCTGAGGTTTGGG - Intergenic
980700657 4:136424448-136424470 GTTTTAAGCCACTGAAGTTTGGG + Intergenic
980816454 4:137952546-137952568 GTTTCAAGTCACTGAGTTTTTGG + Intergenic
980837287 4:138211328-138211350 ATTGCATGATGCTGAGGTTTGGG - Intronic
980884165 4:138743989-138744011 TTTACAAGCCACTGAGATTTGGG - Intergenic
980985692 4:139692282-139692304 GCTGGAAGCCACTGAGATTTAGG - Intronic
981574840 4:146193811-146193833 GTTTCAAACCACTGAGATTTGGG - Intronic
981961021 4:150538888-150538910 ATTGAATAACACTGAGGTTTGGG - Intronic
982098951 4:151949803-151949825 GCTTCATACCACTGAGTTTTTGG + Intergenic
982305202 4:153923382-153923404 CTTGCGTGTCGCTGAGGTTTGGG - Intergenic
982363104 4:154544461-154544483 GGTGGGTGCCACTGGGGTTTTGG + Exonic
982421320 4:155201552-155201574 GTTTTAAGCCACTGAGTTTTGGG + Intergenic
982533247 4:156574405-156574427 ACTGCATGACACTGAGGTTTGGG - Intergenic
982819579 4:159928837-159928859 ATTGCATGACATTGAGGTTTGGG + Intergenic
983097966 4:163587700-163587722 ATTGCATGCTGCTGAGGTTTGGG - Intronic
983185752 4:164698729-164698751 GTTCTAAGCCACTGAGATTTGGG - Intergenic
983715682 4:170778467-170778489 ATTGCATGATGCTGAGGTTTAGG - Intergenic
983744986 4:171186978-171187000 GTTGAAAGCTACTGAGGTATTGG + Intergenic
983886366 4:172984700-172984722 ACTGCATGATACTGAGGTTTGGG - Intronic
983956348 4:173702973-173702995 ATTGCATGATGCTGAGGTTTGGG - Intergenic
984076241 4:175184333-175184355 ATCGTATGGCACTGAGGTTTGGG + Intergenic
984083298 4:175277491-175277513 ATTGCATGATGCTGAGGTTTCGG + Intergenic
984161325 4:176255794-176255816 GTTGTATGATGCTGAGGTTTGGG - Intronic
984326635 4:178262638-178262660 ATTGCATGATGCTGAGGTTTGGG - Intergenic
984418861 4:179494419-179494441 GTTTTAAGCCACTAAGGTTTTGG - Intergenic
984507115 4:180633723-180633745 ATTGCATGATGCTGAGGTTTGGG - Intergenic
984640168 4:182156414-182156436 GTTGCATGATGCTGAGGTTTGGG + Intronic
984728360 4:183042570-183042592 ATTGCATGATGCTGAGGTTTGGG + Intergenic
984831262 4:183976642-183976664 ATTGCATGCCACTGAGGTTTGGG - Intronic
984913876 4:184702628-184702650 ACTGCATGACACTGACGTTTGGG + Intronic
984975664 4:185228088-185228110 GGTCCATGCCAGTGTGGTTTGGG + Intronic
985050429 4:185985697-185985719 ATTGCATGGTGCTGAGGTTTGGG + Intergenic
985325191 4:188760077-188760099 GTTGCATGTCACAGAGGTTTGGG + Intergenic
985357158 4:189133621-189133643 GTTGCATGACACTGAGGTTTGGG - Intergenic
985908226 5:2858304-2858326 GTTTCAAGCCACTAAGTTTTGGG + Intergenic
986113232 5:4741486-4741508 ATTGCATGGTGCTGAGGTTTGGG - Intergenic
986366922 5:7041733-7041755 GTAGCATGCCTCTGTTGTTTGGG - Intergenic
986699125 5:10388485-10388507 GTTTTAAGCCACTAAGGTTTGGG - Intronic
986813239 5:11382058-11382080 ATTGCATGATGCTGAGGTTTGGG - Intronic
987188999 5:15454148-15454170 ATTGCTTGATACTGAGGTTTGGG + Intergenic
987468488 5:18301368-18301390 GCTGCATGATACTGAAGTTTGGG + Intergenic
987516245 5:18914139-18914161 ATTGAGTGTCACTGAGGTTTGGG + Intergenic
987551481 5:19387802-19387824 ATTGCATGATGCTGAGGTTTGGG - Intergenic
987866754 5:23550651-23550673 GTTGTAAGCCATTGCGGTTTTGG - Intergenic
988068819 5:26260679-26260701 ATTGCATGATGCTGAGGTTTGGG + Intergenic
988435287 5:31167346-31167368 ATTGCATGATGCTGAGGTTTTGG + Intergenic
988543539 5:32135248-32135270 GTTTTAAGCAACTGAGGTTTTGG + Intronic
988698808 5:33651701-33651723 ATTGCATAACACTGAGGTTTGGG + Intronic
988857172 5:35239165-35239187 ATTGCATGACACTGAGGTTTGGG - Intergenic
988872178 5:35402542-35402564 ATTGCATGATGCTGAGGTTTGGG - Intergenic
989141753 5:38208300-38208322 GGTGTATGCCACTGAAGTATTGG + Intergenic
989324217 5:40171841-40171863 ATTGCATGACGCTGAGGTTTGGG - Intergenic
989412249 5:41133585-41133607 GTTTTATGCCACTGATATTTGGG - Intergenic
989673689 5:43949644-43949666 ATTCCATGACACTGAGGATTGGG + Intergenic
989682933 5:44050848-44050870 CTTTCATGCCTCTGAGCTTTTGG - Intergenic
989965696 5:50464047-50464069 GTTGTAAGCCACTAAGTTTTGGG + Intergenic
990023007 5:51151521-51151543 ATTGCATGATACTGAGGTTTGGG - Intergenic
990088264 5:52006269-52006291 GTTTTAGGCCACTGAGATTTTGG - Intergenic
990197617 5:53336087-53336109 ATTGCATGGTATTGAGGTTTGGG + Intergenic
990534933 5:56712024-56712046 ATTGCATGATGCTGAGGTTTGGG - Intergenic
991302128 5:65139118-65139140 ATTGCATGATGCTGAGGTTTGGG + Intergenic
991355563 5:65766011-65766033 ATTTCAGGCCACTAAGGTTTGGG - Intronic
991407467 5:66315240-66315262 ATTGCATGATGCTGAGGTTTGGG + Intergenic
991465136 5:66904826-66904848 ATTGCATGACACTAAGGTTTGGG + Intronic
991987011 5:72299195-72299217 ATTGCATGGCACTGAGGTTTGGG - Intronic
992180979 5:74198086-74198108 GCTTCATGCCACTGACTTTTGGG + Intergenic
992192414 5:74306631-74306653 GTTGATTGCCAATGAGGTTTTGG - Intergenic
992275968 5:75119157-75119179 ATTGCATGATGCTGAGGTTTGGG + Intronic
992324860 5:75650763-75650785 GTTTTAAGCCACTGAGCTTTGGG - Intronic
992347267 5:75892490-75892512 ATTGCATGATGCTGAGGTTTGGG + Intergenic
992467791 5:77024339-77024361 GTTTAAAGCCACTGAGGTTTGGG - Intergenic
992519746 5:77538354-77538376 GTAGTGTGACACTGAGGTTTGGG + Intronic
992769210 5:80031488-80031510 TTTGTATACCATTGAGGTTTGGG - Intronic
992910965 5:81395456-81395478 GTTGTGTGCCACTGTGATTTTGG + Intergenic
992922729 5:81543588-81543610 ATTGCATGATGCTGAGGTTTAGG - Intronic
993084765 5:83349822-83349844 ATTGCATGATACTGAGGTTTAGG + Intronic
993114975 5:83709557-83709579 GCTGCATGATGCTGAGGTTTGGG + Intronic
993405225 5:87503356-87503378 ATTGCATGATGCTGAGGTTTGGG - Intergenic
993449882 5:88060395-88060417 ATTGCATAACGCTGAGGTTTGGG - Intergenic
993683744 5:90912441-90912463 ATTGCATGATGCTGAGGTTTGGG + Intronic
993725372 5:91360832-91360854 ATTGCATGTTACTGAGGTTTGGG + Intergenic
993731693 5:91430245-91430267 GTTTCAAGCCACTGAGGTTTCGG - Intergenic
993894348 5:93513740-93513762 ATTGCATGATGCTGAGGTTTGGG - Intergenic
994127956 5:96190787-96190809 ATTGCATGATGCTGAGGTTTGGG + Intergenic
994445944 5:99874102-99874124 ATTGCATGATGCTGAGGTTTGGG - Intergenic
994561398 5:101378299-101378321 ATTGTATGACACTGAGGTTTGGG + Intergenic
994843770 5:104958977-104958999 ATTGCATTACACTGAGGTTTGGG - Intergenic
994966313 5:106676993-106677015 ACTGCATGATACTGAGGTTTGGG + Intergenic
995117483 5:108498336-108498358 GTTGCATGATGCTGAGGTTTGGG + Intergenic
995209642 5:109522834-109522856 GTTGCATAATGCTGAGGTTTGGG + Intergenic
995244367 5:109919777-109919799 ATTGCATGTCACGGGGGTTTGGG + Intergenic
995531628 5:113096786-113096808 GTGCCATGCCACTGAGATTTGGG + Intronic
995555426 5:113323295-113323317 GTTTAAAGCCACTAAGGTTTGGG + Intronic
995752378 5:115466567-115466589 ATTGCATGATGCTGAGGTTTGGG - Intergenic
996503232 5:124239945-124239967 GTTTTAAGCCACTAAGGTTTTGG + Intergenic
996836010 5:127793073-127793095 ATTGCATGATGCTGAGGTTTGGG - Intergenic
997144254 5:131414855-131414877 GTTTCATGCCACTAAATTTTGGG + Intergenic
997407719 5:133665229-133665251 GGGTCAAGCCACTGAGGTTTAGG - Intergenic
997413896 5:133710495-133710517 GGTGCATGCATCTGAGGATTTGG - Intergenic
997455614 5:134015300-134015322 ATTGCATGGTGCTGAGGTTTGGG - Intergenic
997898324 5:137740203-137740225 CTTGCATGATGCTGAGGTTTGGG - Intergenic
999210196 5:149881676-149881698 ATTGTGTGACACTGAGGTTTGGG - Intronic
999555620 5:152739050-152739072 GCTGCACTCCACTGAGGTCTGGG + Intergenic
999860860 5:155644198-155644220 GTTTTATACCACTGAGTTTTTGG + Intergenic
999929028 5:156410454-156410476 ATTGCACGACACTGAGGTTTGGG - Intronic
1000054849 5:157596365-157596387 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1000411698 5:160940293-160940315 TTTGCATGATGCTGAGGTTTGGG + Intergenic
1000492918 5:161937667-161937689 TTTGCATGATGCTGAGGTTTGGG + Intergenic
1000530810 5:162417544-162417566 ATTTCATGACACTGAGGTTTGGG + Intergenic
1000621116 5:163488230-163488252 ATTGCATGATACTGAGGTTTAGG + Intronic
1000873804 5:166610268-166610290 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1001046655 5:168378348-168378370 ATTGCATGATGCTGAGGTTTGGG - Intronic
1001281948 5:170392354-170392376 GTTTCATGCCCCTGCGTTTTGGG + Intronic
1001644031 5:173266867-173266889 ATGGCAAGCAACTGAGGTTTAGG - Intergenic
1001715695 5:173814007-173814029 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1001900647 5:175425411-175425433 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1003055885 6:2819887-2819909 ATTGCATGATACTTAGGTTTGGG - Intergenic
1003617076 6:7664788-7664810 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1003715372 6:8640334-8640356 TTTGTATGCCACTGAGATTTTGG + Intergenic
1003831854 6:10020757-10020779 GTGGCATGCCCATGAGGCTTAGG - Intronic
1003994074 6:11520450-11520472 ATTGCATGGTACTCAGGTTTGGG + Intergenic
1004033834 6:11902173-11902195 ATTGCATGCCTCTTAAGTTTTGG + Intergenic
1004252827 6:14035815-14035837 GTACCAAGCCACTGAGATTTGGG + Intergenic
1004451471 6:15751911-15751933 GTTTTAAGCCACTGAGATTTGGG - Intergenic
1004483662 6:16045240-16045262 GTTTTAAGCCACTGAGTTTTGGG - Intergenic
1004599903 6:17138955-17138977 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1004619171 6:17318437-17318459 GTTACAGGCCCCTGAGATTTGGG - Intergenic
1004653117 6:17631412-17631434 GTTGCCTGGCAGTGAAGTTTGGG + Intronic
1004823510 6:19395765-19395787 ATTGCATGACACTGAGGTTTGGG - Intergenic
1004872319 6:19919347-19919369 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1005000863 6:21240173-21240195 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1005235317 6:23755050-23755072 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1006484039 6:34323175-34323197 ATTGCATGTTGCTGAGGTTTTGG - Intronic
1006572713 6:35018598-35018620 ATTGCATGATGCTGAGGTTTGGG + Intronic
1007083380 6:39125045-39125067 GTTGCAAGCCTGTGAGCTTTAGG - Intergenic
1007121108 6:39382223-39382245 ATTGCATGATGCTGAGGTTTGGG + Intronic
1007225958 6:40314809-40314831 GTTTAAAGCCACTGAGTTTTGGG - Intergenic
1007314239 6:40972117-40972139 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1007874853 6:45085046-45085068 GTTGAGTGACACTGAGGTTTGGG - Intronic
1008165860 6:48137461-48137483 ATTGCATAACACTGAGGTTTGGG + Intergenic
1008249154 6:49216236-49216258 GTTGCATGATGCTGAGGTTTGGG - Intergenic
1008256616 6:49309409-49309431 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1008359163 6:50594191-50594213 GTTGTATGATGCTGAGGTTTGGG - Intergenic
1008734503 6:54526502-54526524 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1008871377 6:56276302-56276324 ATTGCATGATGCTGAGGTTTGGG - Intronic
1008904873 6:56665771-56665793 ATTGCATGATGCTGAGGTTTAGG - Intronic
1008959449 6:57251342-57251364 GTGGTAGGCCACTGAGATTTGGG - Intergenic
1008993285 6:57628549-57628571 GTTGCATGATGCTGAGGCTTGGG + Intronic
1009189724 6:60615590-60615612 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1009195376 6:60678400-60678422 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1009198496 6:60715859-60715881 TTTGCATGATGCTGAGGTTTGGG - Intergenic
1009367706 6:62868656-62868678 GTTGTATGCCCCTGCGATTTGGG + Intergenic
1009482736 6:64180482-64180504 ACTGCATATCACTGAGGTTTGGG + Intronic
1009616846 6:66020137-66020159 GTGGTTTGCCACTGAGATTTGGG - Intergenic
1009763285 6:68036467-68036489 ATTGGGTGACACTGAGGTTTAGG - Intergenic
1009775592 6:68201809-68201831 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1009843580 6:69107969-69107991 ATTGCATGGTACTGAGGTTTGGG - Intronic
1009849225 6:69174158-69174180 ATTACATGCTGCTGAGGTTTGGG + Intronic
1010074246 6:71782665-71782687 GTTGTGTGACACTGAGGTTTGGG + Intergenic
1010139248 6:72594698-72594720 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1010560844 6:77347893-77347915 ATTGCATGATGCTGAGGTTTAGG + Intergenic
1010629400 6:78179548-78179570 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1010726686 6:79343149-79343171 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1010823843 6:80448870-80448892 TTTGCGTGACATTGAGGTTTGGG - Intergenic
1010835600 6:80584300-80584322 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1010875620 6:81101652-81101674 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1010907103 6:81503957-81503979 GTTGCATGATGCTGAGGTTTGGG - Intronic
1011080165 6:83481382-83481404 GTTGCATGATGCTGAGGTTTAGG - Intergenic
1011157832 6:84353368-84353390 GTATCAAGCCACTGAAGTTTAGG - Intergenic
1011316796 6:86041858-86041880 ATTGCATGATACTGAGGTTTGGG - Intergenic
1011398374 6:86934517-86934539 ATAGCAAGCCACTGAGATTTGGG + Intergenic
1011580900 6:88863238-88863260 GCAGCATGCCACTGAAGATTTGG + Intronic
1012160008 6:95872804-95872826 ATTGCATGACACTGAGGTTTGGG - Intergenic
1012249607 6:96964918-96964940 ATTGCATGATGCTGAGGTTTGGG + Intronic
1012355501 6:98309012-98309034 GTTGCGTGATACTGAGGTTTGGG + Intergenic
1012439180 6:99246553-99246575 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1012663327 6:101932798-101932820 GTTACATGTCACTAAGTTTTTGG - Intronic
1012732839 6:102903649-102903671 GTTTTATGCCACTAAGATTTGGG + Intergenic
1012812107 6:103972153-103972175 ATTGCCTGACGCTGAGGTTTGGG - Intergenic
1012832140 6:104217672-104217694 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1012842594 6:104347868-104347890 ATTGTGTGACACTGAGGTTTGGG - Intergenic
1012902049 6:105017825-105017847 ACTGCATGACGCTGAGGTTTAGG - Intronic
1013299432 6:108790005-108790027 GTGGTATCTCACTGAGGTTTTGG + Intergenic
1013532815 6:111035671-111035693 GTTGCATGATGCTGAAGTTTGGG - Intergenic
1013778067 6:113700971-113700993 ATTGTGTGACACTGAGGTTTGGG - Intergenic
1013863449 6:114663767-114663789 ATTGCTTGACACTGAGGTTTGGG - Intergenic
1013871233 6:114763796-114763818 ATTGCATGACGCTGAGGTTTGGG + Intergenic
1013881641 6:114909339-114909361 GTATCAAGTCACTGAGGTTTGGG + Intergenic
1014151335 6:118059528-118059550 ATTGTAAGCCACTGAGGTTTTGG - Intronic
1014210322 6:118701706-118701728 ATTGCATGATGCTGAGGTTTGGG - Intronic
1014288410 6:119529699-119529721 ATTGCGTGTCACTGAGGTTTGGG + Intergenic
1014452647 6:121598854-121598876 GTTGTAATTCACTGAGGTTTGGG + Intergenic
1014562587 6:122908994-122909016 GTTTGAAGCCACTGAGTTTTGGG + Intergenic
1014845935 6:126277251-126277273 ATTACGTGACACTGAGGTTTGGG + Intergenic
1015044231 6:128759789-128759811 GTTCCATGCTACTGGGGTTTTGG - Intergenic
1015326523 6:131929702-131929724 GTTACAAGCCACTGTGATTTGGG + Intergenic
1015395872 6:132734032-132734054 ATTGCATGACGCTGAGGATTGGG - Intronic
1015443923 6:133281674-133281696 ATTGTGTGACACTGAGGTTTGGG + Intronic
1015597392 6:134878725-134878747 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1015922688 6:138281377-138281399 ATTGCATGATGCTGAGGTTTGGG + Intronic
1016475203 6:144419591-144419613 GTTGTGTGACACTGAGGTTTGGG - Intronic
1016690920 6:146936761-146936783 GTTTCAAGCCACTGAGTTTGTGG - Intergenic
1017346415 6:153387308-153387330 ATTGCTTGATACTGAGGTTTGGG - Intergenic
1017567634 6:155705261-155705283 TTTGCATTACACTGAGGTTTGGG - Intergenic
1017580645 6:155860939-155860961 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1018128584 6:160706070-160706092 ATTGCGTGACACTGAGCTTTGGG + Intronic
1019812112 7:3172458-3172480 GTTTTAAGCCACTGAGTTTTGGG - Intronic
1019847014 7:3513693-3513715 GTTGCGTGATCCTGAGGTTTAGG + Intronic
1021125649 7:16848864-16848886 GTTGCATGATGCAGAGGTTTGGG + Intergenic
1021413808 7:20358770-20358792 ATTGCATGATGCTGAGGTTTAGG + Intronic
1021448523 7:20759104-20759126 ATTGCATGATGCTGAGGTTTGGG + Intronic
1021645753 7:22787956-22787978 GTTTTAAGCCACTGAGTTTTGGG - Intergenic
1021845751 7:24761067-24761089 GTTTCAAGCCACTAAGTTTTGGG - Intergenic
1021906264 7:25336872-25336894 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1021950700 7:25771956-25771978 GTTCTAAGCCACTGAGATTTAGG + Intergenic
1022142162 7:27501802-27501824 ATTGCATGACTCTGAGGTTTGGG + Intergenic
1022764177 7:33392198-33392220 GTTTTAAGCCACTAAGGTTTGGG - Intronic
1022798215 7:33749708-33749730 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1022813069 7:33887983-33888005 GTTCGATGCCACTAAGTTTTGGG + Intergenic
1023041547 7:36177327-36177349 ATTGCATGATGCTGAGGTTTGGG + Intronic
1023214211 7:37844419-37844441 ATTGCATGATGCTGAGGTTTTGG + Intronic
1023526167 7:41106183-41106205 ATTGCATGATACTGAGGTTTGGG + Intergenic
1024187277 7:46963206-46963228 ATTGCATGACACTGAGGCTTGGG - Intergenic
1024371261 7:48586662-48586684 ATTGTGTGACACTGAGGTTTGGG - Intronic
1024555918 7:50603600-50603622 GTTTTAAGCCACTAAGGTTTGGG + Intronic
1024708611 7:51989397-51989419 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1024913899 7:54476938-54476960 ATTGTGTGACACTGAGGTTTGGG + Intergenic
1025989160 7:66482374-66482396 GTTGCACGCCAGTCAGGTGTGGG + Intergenic
1025989556 7:66485909-66485931 GTTGCATGCCAGTCAGGTGCGGG + Intergenic
1026039189 7:66852702-66852724 GTTGCATGCCAGTCAGGTGCGGG - Intergenic
1026039693 7:66857298-66857320 GTTGCATGCTAGTCAGGTGTGGG - Intergenic
1026065196 7:67065313-67065335 GTTGCATTGCATTGAAGTTTAGG + Intronic
1026104220 7:67408267-67408289 GTTTTGTGCCACTGAGATTTGGG + Intergenic
1026182831 7:68057040-68057062 GTTTCATGCCACTCAGGTTTGGG + Intergenic
1026536160 7:71240334-71240356 ATTGCATGATGCTGAGGTTTGGG + Intronic
1026592449 7:71708615-71708637 ATTGCATGATGCTGAGGTTTGGG + Intronic
1026656653 7:72262408-72262430 ATTGCATGATGCTGAGGTTTGGG + Intronic
1026711669 7:72746553-72746575 ATTGCATTGCATTGAGGTTTAGG - Intronic
1027150344 7:75729011-75729033 ACTGCATGTCACTGAGTTTTGGG - Intronic
1027212121 7:76158373-76158395 GTTGCATGCCAGTCAGGTGCGGG + Intergenic
1027450992 7:78331292-78331314 ATTGCGTGACGCTGAGGTTTGGG - Intronic
1027558838 7:79701686-79701708 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1028022048 7:85789360-85789382 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1028309180 7:89309045-89309067 ATTGCCTGATACTGAGGTTTAGG + Intronic
1028335166 7:89643541-89643563 GCTGCAAACCACTGAGTTTTGGG + Intergenic
1028371106 7:90093247-90093269 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1028561578 7:92181745-92181767 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1028642741 7:93061508-93061530 ATTGCCTGACACTGAGGTTTGGG - Intergenic
1028761518 7:94502448-94502470 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1029389372 7:100264855-100264877 GTTTCAAGCCACTAAGATTTGGG - Intronic
1030290898 7:107871797-107871819 GTTGCAAGCCAGTGTGTTTTGGG + Intergenic
1030463319 7:109868151-109868173 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1030530402 7:110705637-110705659 ATTGCATGATGCTGAGGTTTGGG + Intronic
1030682093 7:112444879-112444901 ATTGCATGATGCTGAGGTTTGGG - Intronic
1030721349 7:112874577-112874599 GTTGCGTGATACTGAGGTTTGGG - Intronic
1030986527 7:116247872-116247894 ATTGCATGTTACTGAGGCTTGGG + Intronic
1031188784 7:118519291-118519313 ATTGCATGGTGCTGAGGTTTTGG - Intergenic
1031595127 7:123640824-123640846 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1032135411 7:129272401-129272423 GTTTTATGCCACTAAGCTTTAGG + Intronic
1032363407 7:131276714-131276736 GTTGTAAGCCACTGAGATTTGGG + Intronic
1032415223 7:131730322-131730344 GTTGCATGATGCTGAGGTTTGGG + Intergenic
1032465321 7:132140793-132140815 GCAGCCTGCCCCTGAGGTTTTGG - Exonic
1032689411 7:134267857-134267879 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1032706885 7:134427730-134427752 GTTTCATCCCACTAAGTTTTTGG + Intergenic
1033078707 7:138273842-138273864 GTGGTATGGCATTGAGGTTTTGG - Intergenic
1033117776 7:138640845-138640867 ATTGCATGATGCTGAGGTTTGGG - Intronic
1033396589 7:140979775-140979797 ATTGCATGACACTGAGGTTTGGG + Intergenic
1033510572 7:142056502-142056524 ATTGCATGATGCTGAGGTTTAGG - Intronic
1033926492 7:146468364-146468386 ATTGCATGATTCTGAGGTTTGGG - Intronic
1034112431 7:148550618-148550640 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1035663225 8:1362731-1362753 GTTGCTTGACACTAAGGCTTTGG - Intergenic
1035836259 8:2755851-2755873 ATTGCATGACTCTGAAGTTTGGG + Intergenic
1035855464 8:2971429-2971451 GCTGCATGCCCCTAGGGTTTTGG + Intronic
1036405585 8:8452077-8452099 ATTGCATAATACTGAGGTTTGGG - Intergenic
1036436736 8:8741833-8741855 ATTGTGTGACACTGAGGTTTGGG - Intergenic
1036517241 8:9455599-9455621 ATTGCATGATGCTGAGGTTTAGG - Intergenic
1036950681 8:13136238-13136260 ATTGCATGATGCTGAGGTTTGGG + Intronic
1036954609 8:13173919-13173941 ATTGCATGATGCTGAGGTTTGGG + Intronic
1037103726 8:15079787-15079809 ATTGTGTGACACTGAGGTTTGGG + Intronic
1037128830 8:15383632-15383654 GTGGGATGCCACTGAGATTATGG - Intergenic
1037159043 8:15744860-15744882 TTTGGATGATACTGAGGTTTAGG + Intronic
1037222134 8:16536673-16536695 ATTGCATGGTGCTGAGGTTTGGG - Intronic
1038104763 8:24420122-24420144 GTTCCCTGCCACTGAGTTTGAGG - Intergenic
1038235276 8:25746781-25746803 ATTGCATGACACCAAGGTTTGGG + Intergenic
1038453681 8:27657375-27657397 ATTGCGTGACACTGAGGTTTGGG + Intronic
1038867143 8:31451541-31451563 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1039015557 8:33144977-33144999 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1039179929 8:34855181-34855203 GGTGCATACCACTGAGTTTTGGG - Intergenic
1040776157 8:51045322-51045344 GTTGCATGATGATGAGGTTTAGG + Intergenic
1040823840 8:51595959-51595981 ATTGCATGATTCTGAGGTTTGGG + Intronic
1041096998 8:54360382-54360404 ATTGCATGATGCTGAGGTTTCGG - Intergenic
1041229593 8:55735510-55735532 ACTGCATGACTCTGAGGTTTAGG - Intronic
1041250791 8:55933046-55933068 GTTGCAAGATGCTGAGGTTTGGG - Intronic
1041343764 8:56873726-56873748 ATTTCGTGACACTGAGGTTTGGG - Intergenic
1041579272 8:59438723-59438745 TTTGCATGATGCTGAGGTTTGGG + Intergenic
1041728391 8:61039899-61039921 ATTGCATGATCCTGAGGTTTCGG + Intergenic
1041855978 8:62455604-62455626 ATTGCATAACGCTGAGGTTTGGG - Intronic
1042223926 8:66500585-66500607 ATTGCATGATGCTGAGGTTTGGG + Intronic
1042312986 8:67396948-67396970 TTTGCATGCCATTGAGATTATGG + Intergenic
1042319882 8:67463579-67463601 GTTGCATCATTCTGAGGTTTGGG + Intronic
1042414034 8:68498982-68499004 ATTGCGTGAAACTGAGGTTTGGG + Intronic
1042780707 8:72487902-72487924 GTTGCATGATGCCGAGGTTTAGG - Intergenic
1042794764 8:72649523-72649545 ATTGCATGATACTGAAGTTTGGG - Intronic
1043343097 8:79266026-79266048 TTTGCAAGCCACTGAGATTTTGG - Intergenic
1043793569 8:84505616-84505638 ATTGCACGACACTGAGGGTTAGG + Intronic
1043918694 8:85955350-85955372 ATTGCATGATACTGAGGTTTGGG - Intergenic
1043930575 8:86086201-86086223 ATTGCATGATGCTGAGGTTTGGG - Intronic
1043942341 8:86210040-86210062 ATTGCATGATGCTGAGGTTTAGG + Intergenic
1044049535 8:87483347-87483369 GTTGAAAGTTACTGAGGTTTTGG - Intronic
1044164964 8:88970235-88970257 GTTTTAAGCTACTGAGGTTTAGG + Intergenic
1044253830 8:90036564-90036586 GGGGCATGCCTCTGAGATTTGGG + Intronic
1044852155 8:96439548-96439570 GTTGCATGGTGCTGAGGTTTGGG - Intergenic
1045086400 8:98691145-98691167 ATTGCATGGTACTGAGGTTTGGG - Intronic
1045228454 8:100275460-100275482 ATTGCATGATGCTGAGGTTTGGG + Intronic
1045373680 8:101550259-101550281 TTTGTGTGACACTGAGGTTTGGG + Intronic
1045799805 8:106089090-106089112 ATTGTGTGGCACTGAGGTTTGGG - Intergenic
1046019323 8:108645434-108645456 ATTGCATGATGCTGAGGTTTAGG - Intronic
1046177616 8:110598937-110598959 ATTGTATGACACTGAGGTTTGGG + Intergenic
1046195356 8:110856797-110856819 ATTGAATGTCACAGAGGTTTGGG - Intergenic
1046219519 8:111194918-111194940 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1046229022 8:111328687-111328709 GTTGCATGATGCTGGGGTTTGGG + Intergenic
1046450226 8:114380849-114380871 GTTGCATGATGCTGAGGTTTGGG + Intergenic
1046464067 8:114579910-114579932 GTTTCATGCTACTGAATTTTAGG - Intergenic
1046597384 8:116276411-116276433 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1047066079 8:121284569-121284591 GTTGCATGATGCTGAGGTTTGGG - Intergenic
1047144684 8:122184938-122184960 GTTCTATGCCAATGAAGTTTAGG - Intergenic
1047185739 8:122631644-122631666 GTTAAAAGCCACTGAGATTTTGG - Intergenic
1047243982 8:123121977-123121999 GTGGCATCTCACTGTGGTTTTGG - Intronic
1047300167 8:123607182-123607204 GTTGTGTGACACTGAGGTTTGGG + Intergenic
1047410211 8:124618261-124618283 TTTGCCTTCCACTGAGGTCTGGG - Intronic
1047582238 8:126228915-126228937 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1047700101 8:127440964-127440986 ATTGCATGAGGCTGAGGTTTGGG - Intergenic
1048526405 8:135206846-135206868 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1048804178 8:138224113-138224135 ATTGCATGATACTGAGGTTTGGG - Intronic
1048836969 8:138529023-138529045 TTTGCACGATACTGAGGTTTGGG - Intergenic
1049786278 8:144452317-144452339 GCTGCATGCCACACAGGTGTGGG - Intronic
1049892835 9:86582-86604 ATTGCATGGTGCTGAGGTTTGGG - Intergenic
1049948002 9:616661-616683 GTTGAAAGCCACTGAGATTTGGG - Intronic
1050094804 9:2053033-2053055 GTTGCATGATGCTGAGGTTTGGG + Intronic
1050178023 9:2889622-2889644 ATTGCCTGACGCTGAGGTTTGGG - Intergenic
1050638773 9:7642662-7642684 ATTGCATGATGCTGAGGTTTTGG + Intergenic
1050836953 9:10094022-10094044 ATTGCATGATGCTGAGGTTTTGG - Intronic
1051145131 9:14019272-14019294 ATTGCATGACACTGAGGTTTGGG + Intergenic
1051795544 9:20865278-20865300 GTTGCTTCCCATTGAAGTTTGGG + Intronic
1051978986 9:22990273-22990295 GTTGTAAGCCACTGAGATTGTGG - Intergenic
1052233788 9:26186835-26186857 TTTGGAAGCCACTGAGATTTGGG - Intergenic
1052279558 9:26717322-26717344 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1052655124 9:31349226-31349248 GTTGTGTGACACTGAGGCTTGGG - Intergenic
1052826156 9:33176775-33176797 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1052892324 9:33713552-33713574 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1053196649 9:36125029-36125051 GTTGTAAGCCACTGAAGTTTTGG - Intergenic
1053264916 9:36705063-36705085 ATTGTATAACACTGAGGTTTGGG + Intergenic
1053346491 9:37382311-37382333 GTTGCAGACCACTGAGATTCTGG + Intergenic
1053703171 9:40721784-40721806 ACTGCATGACATTGAGGTTTGGG - Intergenic
1053734062 9:41086641-41086663 ATTGCATGGTGCTGAGGTTTGGG - Intergenic
1054413230 9:64845249-64845271 ACTGCATGACATTGAGGTTTGGG - Intergenic
1054572392 9:66824925-66824947 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1054694343 9:68344912-68344934 ATTGCATGGTGCTGAGGTTTGGG + Intronic
1054947713 9:70813589-70813611 ATTGCATGATGCTGAGGTTTGGG - Intronic
1055184766 9:73437741-73437763 GTTGGAGGCCACTTAGTTTTTGG - Intergenic
1055268519 9:74528099-74528121 GTTTTATGCCACTGAGGTTTAGG - Intronic
1055438679 9:76317942-76317964 GTTTTAAGCCACTGAGTTTTGGG + Intronic
1055646500 9:78366572-78366594 ATTGCATGAGACTGAGGTTTGGG - Intergenic
1055698001 9:78909126-78909148 GTTGTAAGCCACTGAGTTTGTGG + Intergenic
1055805182 9:80085163-80085185 GTTGCTTGGTGCTGAGGTTTAGG + Intergenic
1056196839 9:84237419-84237441 GTTGCATGATGCTGAGGTTTGGG + Intergenic
1056311638 9:85347168-85347190 GTTGTATTCCACTAAGTTTTGGG - Intergenic
1056555997 9:87688052-87688074 ATTGCATGATGCTGAGGTTTAGG + Intronic
1056667461 9:88592370-88592392 ATTGCATGTTGCTGAGGTTTGGG + Intergenic
1056941624 9:90961164-90961186 GTTTTATGCCACTGAGCTTGTGG + Intergenic
1057404066 9:94751817-94751839 ATTGCATGATGCTGAGGTTTGGG + Intronic
1057516234 9:95723872-95723894 ATTGCATGACACTGAGGTTTGGG - Intergenic
1057926960 9:99161189-99161211 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1058106207 9:100974951-100974973 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1058399384 9:104596175-104596197 GAAGCTTTCCACTGAGGTTTGGG - Intergenic
1058597938 9:106635860-106635882 ATTGCATGCTGCTGAGGTTTGGG + Intergenic
1059129790 9:111734880-111734902 ATTGCATGATGCTGAGGTTTGGG + Intronic
1059180047 9:112203099-112203121 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1059577419 9:115505494-115505516 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1059702884 9:116793033-116793055 ATTGCATGATCCTGAGGTTTGGG - Intronic
1059865730 9:118511948-118511970 GTTTTAAGCCACTGAGTTTTGGG + Intergenic
1060039214 9:120285303-120285325 GTTGTAAGCCATTGAGTTTTGGG - Intergenic
1060316275 9:122514200-122514222 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1060502099 9:124166353-124166375 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1060828868 9:126701590-126701612 TTTGCCTGCCCCTGAGGTTTTGG - Intergenic
1060871459 9:127044634-127044656 ATTGCATGATGCTGAGGTTTTGG + Intronic
1060885121 9:127146133-127146155 ATTGCATGATGCTGAGGTTTGGG + Intronic
1185872870 X:3679120-3679142 ATTGCATGATGCTGAGGTTTCGG + Intronic
1185884033 X:3766117-3766139 ATTGCATGGTGCTGAGGTTTGGG + Intergenic
1185887984 X:3799912-3799934 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1185915187 X:4027150-4027172 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1185934960 X:4246033-4246055 GTTACATGATGCTGAGGTTTTGG + Intergenic
1186111287 X:6259054-6259076 GTTGCATGATGCTGAGATTTGGG + Intergenic
1186529256 X:10278767-10278789 GTTTCATGCCACTAAGTTTGTGG - Intergenic
1186646532 X:11512896-11512918 GTTTGAAGCCTCTGAGGTTTGGG + Intronic
1186894448 X:13991984-13992006 GTTTCAAGCCACTGACATTTTGG - Intergenic
1186930695 X:14386159-14386181 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1187008751 X:15258077-15258099 GTATCATGTCACTGAGTTTTGGG + Intronic
1187051129 X:15696462-15696484 GTTGCATGATGGTGAGGTTTGGG + Intronic
1187179750 X:16932930-16932952 GTTGCATGAAGCTGAGGTTTGGG + Intergenic
1187211701 X:17238400-17238422 GTTTCAAGCCACTAAGTTTTAGG - Intergenic
1187299879 X:18037933-18037955 GTTTTAAGACACTGAGGTTTGGG - Intergenic
1187518725 X:19995091-19995113 TCTCCAAGCCACTGAGGTTTTGG - Intergenic
1187595165 X:20763197-20763219 GTTGTATGATGCTGAGGTTTGGG + Intergenic
1187621610 X:21062510-21062532 CTTGCATGACACTGAGGTTTGGG - Intergenic
1187736570 X:22311050-22311072 ATTGTAAGCCACTGAGGTTAGGG - Intergenic
1187772885 X:22721604-22721626 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1187778256 X:22788082-22788104 ATTGTGTGACACTGAGGTTTGGG - Intergenic
1187991831 X:24882384-24882406 ATTGCATGACACTGAGGTTTGGG + Intronic
1188025912 X:25209309-25209331 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1188043578 X:25399380-25399402 ATTGCATGCTGCTGAGATTTGGG - Intergenic
1188361134 X:29255513-29255535 ATTGCATGATACTGAAGTTTGGG + Intronic
1188447303 X:30268725-30268747 GTTGGATAGCACTGAGTTTTGGG - Intergenic
1188723921 X:33557432-33557454 GTGGTATTTCACTGAGGTTTTGG + Intergenic
1188752147 X:33917985-33918007 CTTACATTCCACTGAGTTTTGGG + Intergenic
1188830567 X:34891620-34891642 GGTGCATGCCACTGAGGGGCAGG - Intergenic
1188936229 X:36178266-36178288 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1188941830 X:36247356-36247378 ATTGCATGATGCTGAGGTTTAGG - Intronic
1189125804 X:38444991-38445013 ATTGCATGATGCTGAGGTTTGGG + Intronic
1189225932 X:39413368-39413390 ATTGTATGCCACTGAGGTTTGGG - Intergenic
1189269698 X:39742387-39742409 GTTGCAAACAACTGAGGTTTGGG + Intergenic
1189290589 X:39882719-39882741 GTTGTAAGTCACTGAGATTTTGG + Intergenic
1189311554 X:40022067-40022089 GTTTCAAGCCACTGAATTTTGGG + Intergenic
1189361204 X:40353585-40353607 ATTGCATGGGGCTGAGGTTTGGG + Intergenic
1189422719 X:40870886-40870908 ATTGTGTGACACTGAGGTTTGGG + Intergenic
1189567954 X:42263164-42263186 GTTACATGCCACTGGGTGTTGGG - Intergenic
1189578684 X:42382898-42382920 TTTGCATTCCACTGGGGCTTGGG + Intergenic
1189720374 X:43909882-43909904 ATTGTGTGGCACTGAGGTTTTGG + Intergenic
1189772364 X:44439081-44439103 GCTGCAAGCCATTGAGATTTTGG - Intergenic
1189936272 X:46072296-46072318 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1190027707 X:46940996-46941018 GTTGCATGACATCGAGGTTTAGG + Intronic
1190409118 X:50117156-50117178 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1190409660 X:50123798-50123820 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1190763329 X:53454673-53454695 ATTGCATGACACTGAGGCTTGGG + Intergenic
1191042631 X:56101025-56101047 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1191131625 X:57019123-57019145 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1191182295 X:57576527-57576549 ATTGCATGTTGCTGAGGTTTGGG - Intergenic
1191215267 X:57926982-57927004 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1191786847 X:64925347-64925369 GTTGCATAATATTGAGGTTTGGG - Intronic
1192279506 X:69669729-69669751 ATTGCATGATGCTGAGGTTTGGG + Intronic
1192469022 X:71380529-71380551 GTGGCATGCCCCTGAAGTCTTGG - Intronic
1192724386 X:73732602-73732624 ATTGCATGATGCTGAGGTTTAGG + Intergenic
1192767264 X:74153511-74153533 ATTGCATGATACTGAGGTTTGGG - Intergenic
1192836620 X:74806350-74806372 GTTGCATGATGCTGAGGTTTGGG - Intronic
1192881649 X:75290882-75290904 ATTGCATGATGCTGAGGTTTGGG - Intronic
1192989364 X:76432132-76432154 GTTGTAAGCCTCTGAGATTTGGG - Intergenic
1193227884 X:79007260-79007282 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1193254162 X:79326530-79326552 ATTGCATGACCCTGAGGTTTGGG - Intergenic
1193342164 X:80361892-80361914 ATTGCATGATGCTGAGGTTTGGG + Intronic
1193413437 X:81193541-81193563 GCTTCATGCCACTAAGCTTTAGG + Intronic
1193459170 X:81769685-81769707 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1193567859 X:83100832-83100854 TTTGCATGATGCTGAGGTTTGGG - Intergenic
1193663307 X:84283813-84283835 ATTGTGTGTCACTGAGGTTTGGG + Intergenic
1193691076 X:84643285-84643307 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1193794711 X:85859395-85859417 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1193998082 X:88391290-88391312 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1194211373 X:91072878-91072900 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1194374803 X:93119054-93119076 ATTGCATGAGGCTGAGGTTTGGG - Intergenic
1194689557 X:96967096-96967118 GTTGCATGATTCTGAGGTTTGGG + Intronic
1194780117 X:98014183-98014205 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1194789612 X:98130794-98130816 ATTATATGACACTGAGGTTTGGG + Intergenic
1194902695 X:99533319-99533341 GTGGTAAGCCACTGAGATTTGGG - Intergenic
1195015307 X:100773733-100773755 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1195033721 X:100951343-100951365 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1195274782 X:103271070-103271092 GTGTTAAGCCACTGAGGTTTTGG + Intergenic
1195453197 X:105038601-105038623 ATTGCATGTCTCGGAGGTTTTGG + Intronic
1195735381 X:108007574-108007596 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1195930735 X:110072894-110072916 GTTGCACGATGCTGAGGTTTGGG + Intronic
1195960926 X:110385727-110385749 ATTGCATGATGCTGAGGTTTGGG + Intronic
1195977092 X:110539084-110539106 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1196151916 X:112383914-112383936 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1196265581 X:113641335-113641357 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1196576994 X:117330373-117330395 ATTCCTTGGCACTGAGGTTTGGG - Intergenic
1196580032 X:117368013-117368035 ATTGCATGACACTGAGTTTTGGG - Intergenic
1196752639 X:119131485-119131507 ATTGCATGTTACTGAGGTTTTGG - Intronic
1196933737 X:120708085-120708107 GTTGCATGATGCTGAGGTTTGGG - Intergenic
1197124556 X:122929152-122929174 CTTGCATGCCTTTGAGTTTTGGG - Intergenic
1197146443 X:123177665-123177687 GTTTTAAGCCACTAAGGTTTGGG - Intergenic
1197364900 X:125551461-125551483 ATTTCATGCTGCTGAGGTTTTGG - Intergenic
1197685853 X:129438792-129438814 GTTTTAAGCCACTGAGTTTTAGG + Intergenic
1197903675 X:131400292-131400314 ATTGCGTAACACTGAGGTTTGGG - Intergenic
1197921638 X:131600893-131600915 ATTGCATGATGCTGAGGTTTGGG + Intergenic
1198232317 X:134702680-134702702 ATTGCATGATGCTGAGGTTTGGG - Intronic
1199020906 X:142877205-142877227 GGTGCATGACACTGAGGTTTGGG + Intergenic
1199133902 X:144229502-144229524 ATTGCATGATGCTGAGGTTTTGG + Intergenic
1199597781 X:149521761-149521783 ATTGCATGATGCTGAGGTTTGGG - Intronic
1200304983 X:155015751-155015773 GTTGCATGGTGCTGAAGTTTGGG - Intronic
1200682825 Y:6233117-6233139 ATTGCATGAGGCTGAGGTTTGGG - Intergenic
1200781336 Y:7218822-7218844 ATTGCATGGTGCTGAGGTTTGGG - Intergenic
1200819330 Y:7566166-7566188 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1201219166 Y:11750005-11750027 GCTTTAAGCCACTGAGGTTTGGG - Intergenic
1201484849 Y:14482464-14482486 ATTGCATGATGCTGAGGTTTGGG - Intergenic
1201576770 Y:15469388-15469410 GTTGTGTGACACTGAGATTTGGG - Intergenic