ID: 902733201

View in Genome Browser
Species Human (GRCh38)
Location 1:18383501-18383523
Sequence TGGGGGAATCTGCAGATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902733201_902733214 9 Left 902733201 1:18383501-18383523 CCCACCATCTGCAGATTCCCCCA No data
Right 902733214 1:18383533-18383555 TGGCTGTGCAGAGGCCCCCTGGG No data
902733201_902733220 28 Left 902733201 1:18383501-18383523 CCCACCATCTGCAGATTCCCCCA No data
Right 902733220 1:18383552-18383574 TGGGCTGGTCAGCTGCCTCTTGG No data
902733201_902733221 29 Left 902733201 1:18383501-18383523 CCCACCATCTGCAGATTCCCCCA No data
Right 902733221 1:18383553-18383575 GGGCTGGTCAGCTGCCTCTTGGG No data
902733201_902733215 13 Left 902733201 1:18383501-18383523 CCCACCATCTGCAGATTCCCCCA No data
Right 902733215 1:18383537-18383559 TGTGCAGAGGCCCCCTGGGCTGG No data
902733201_902733213 8 Left 902733201 1:18383501-18383523 CCCACCATCTGCAGATTCCCCCA No data
Right 902733213 1:18383532-18383554 CTGGCTGTGCAGAGGCCCCCTGG No data
902733201_902733212 0 Left 902733201 1:18383501-18383523 CCCACCATCTGCAGATTCCCCCA No data
Right 902733212 1:18383524-18383546 GGGGTACTCTGGCTGTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902733201 Original CRISPR TGGGGGAATCTGCAGATGGT GGG (reversed) Intergenic
No off target data available for this crispr