ID: 902744098

View in Genome Browser
Species Human (GRCh38)
Location 1:18461682-18461704
Sequence CCAGAGCCTGCCTTTGTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902744094_902744098 -6 Left 902744094 1:18461665-18461687 CCTCCCAGCTGCTGGCACCAGAG No data
Right 902744098 1:18461682-18461704 CCAGAGCCTGCCTTTGTTTGTGG No data
902744093_902744098 1 Left 902744093 1:18461658-18461680 CCAGTGGCCTCCCAGCTGCTGGC No data
Right 902744098 1:18461682-18461704 CCAGAGCCTGCCTTTGTTTGTGG No data
902744095_902744098 -9 Left 902744095 1:18461668-18461690 CCCAGCTGCTGGCACCAGAGCCT No data
Right 902744098 1:18461682-18461704 CCAGAGCCTGCCTTTGTTTGTGG No data
902744096_902744098 -10 Left 902744096 1:18461669-18461691 CCAGCTGCTGGCACCAGAGCCTG No data
Right 902744098 1:18461682-18461704 CCAGAGCCTGCCTTTGTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902744098 Original CRISPR CCAGAGCCTGCCTTTGTTTG TGG Intergenic
No off target data available for this crispr