ID: 902746355

View in Genome Browser
Species Human (GRCh38)
Location 1:18477114-18477136
Sequence CTAACTTGGTGGCATCTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902746347_902746355 21 Left 902746347 1:18477070-18477092 CCTTTATCAGGTGGGAAGCAGCA No data
Right 902746355 1:18477114-18477136 CTAACTTGGTGGCATCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902746355 Original CRISPR CTAACTTGGTGGCATCTGAG AGG Intergenic
No off target data available for this crispr