ID: 902747006

View in Genome Browser
Species Human (GRCh38)
Location 1:18481111-18481133
Sequence TTCCCACCCCACCGCTGGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 211}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902747006_902747017 16 Left 902747006 1:18481111-18481133 CCAGCCCAGCGGTGGGGTGGGAA 0: 1
1: 0
2: 1
3: 21
4: 211
Right 902747017 1:18481150-18481172 AAGGAGGAAGCAGAGGGCTCAGG 0: 1
1: 1
2: 7
3: 102
4: 708
902747006_902747012 0 Left 902747006 1:18481111-18481133 CCAGCCCAGCGGTGGGGTGGGAA 0: 1
1: 0
2: 1
3: 21
4: 211
Right 902747012 1:18481134-18481156 TGGCCAGGCAGAAGCCAAGGAGG 0: 1
1: 0
2: 2
3: 46
4: 409
902747006_902747018 17 Left 902747006 1:18481111-18481133 CCAGCCCAGCGGTGGGGTGGGAA 0: 1
1: 0
2: 1
3: 21
4: 211
Right 902747018 1:18481151-18481173 AGGAGGAAGCAGAGGGCTCAGGG 0: 1
1: 1
2: 9
3: 88
4: 754
902747006_902747014 9 Left 902747006 1:18481111-18481133 CCAGCCCAGCGGTGGGGTGGGAA 0: 1
1: 0
2: 1
3: 21
4: 211
Right 902747014 1:18481143-18481165 AGAAGCCAAGGAGGAAGCAGAGG 0: 1
1: 0
2: 3
3: 139
4: 1293
902747006_902747015 10 Left 902747006 1:18481111-18481133 CCAGCCCAGCGGTGGGGTGGGAA 0: 1
1: 0
2: 1
3: 21
4: 211
Right 902747015 1:18481144-18481166 GAAGCCAAGGAGGAAGCAGAGGG 0: 1
1: 2
2: 8
3: 92
4: 853
902747006_902747011 -3 Left 902747006 1:18481111-18481133 CCAGCCCAGCGGTGGGGTGGGAA 0: 1
1: 0
2: 1
3: 21
4: 211
Right 902747011 1:18481131-18481153 GAATGGCCAGGCAGAAGCCAAGG 0: 1
1: 0
2: 2
3: 35
4: 413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902747006 Original CRISPR TTCCCACCCCACCGCTGGGC TGG (reversed) Exonic
900113642 1:1019861-1019883 TTCCCGCCCCACGGCCGCGCCGG + Intergenic
900368326 1:2320487-2320509 TTCCCTGCCCAGCGCTGGGCGGG + Intergenic
900435735 1:2629689-2629711 TTTCCACACTACCCCTGGGCCGG + Intronic
900571992 1:3363154-3363176 TTACCACCCGACCCCCGGGCTGG - Intronic
901026526 1:6281319-6281341 CCTCCACCCCACGGCTGGGCGGG + Intronic
901125241 1:6924427-6924449 TGCCCACCCCACCCCTGAGCTGG + Intronic
902747006 1:18481111-18481133 TTCCCACCCCACCGCTGGGCTGG - Exonic
903165578 1:21518095-21518117 TTCCTACCCCACACCTGGGGTGG - Intronic
903165746 1:21519260-21519282 TTCCTACCCCACACCTGGGGTGG + Intronic
903376972 1:22872762-22872784 TGCCCGCCCCACAGCAGGGCAGG - Intronic
903543592 1:24110212-24110234 TTCCATCCCCACGCCTGGGCAGG - Intronic
905284743 1:36871890-36871912 TTTCCATCCCACCTCTGTGCTGG - Intronic
906699052 1:47844293-47844315 CTCCCTCCCCAACTCTGGGCAGG - Intronic
907522740 1:55035049-55035071 TTCCCACCCCACCACATGTCTGG + Intergenic
909514454 1:76491355-76491377 TGCCCATCCCACCACTGTGCTGG + Intronic
911071818 1:93837801-93837823 TACCCACCACTCTGCTGGGCTGG - Intronic
912309346 1:108604151-108604173 TTCCCACGCCACAGCCAGGCTGG - Intronic
916791575 1:168129816-168129838 TGCCCACCCCAGCCCTGGGTTGG - Intronic
918418501 1:184337501-184337523 TTCCCACCCCACAACAGGCCTGG + Intergenic
920215901 1:204361484-204361506 TTCCCACCCCAGGGCAGGCCAGG + Intronic
922765772 1:228155914-228155936 TTGCCCCCACACAGCTGGGCAGG + Intronic
924907741 1:248474154-248474176 TTCCTACCACACAGCTGAGCAGG + Exonic
924916367 1:248573932-248573954 TTCCTACCACACAGCTGAGCAGG - Exonic
1063374000 10:5541030-5541052 CTCCCAATCCACCGCTGGGCTGG - Intergenic
1064589741 10:16876966-16876988 TCCCCTCACCATCGCTGGGCCGG - Exonic
1067429291 10:46232423-46232445 TTCCCACCTCATTGCTGGACAGG - Intergenic
1067686549 10:48469283-48469305 TGCCCACCCCACCTCAGGGGTGG + Intronic
1072198744 10:93140021-93140043 TTCCCTCCCCACCCCTGCTCTGG + Intergenic
1074524030 10:114249171-114249193 TCCCCACCCCACCACTCGACAGG + Intronic
1076696152 10:132248369-132248391 TCCCCTCCCCACTGCAGGGCAGG - Intronic
1077487124 11:2844148-2844170 GTCCCACCCCACCACTCTGCGGG - Intronic
1080642119 11:34164206-34164228 GTCCCGCCACACCCCTGGGCAGG + Intronic
1083267889 11:61555331-61555353 GTCCCACCACACTTCTGGGCCGG + Intronic
1083365439 11:62139170-62139192 TTCACCTCCCACCGTTGGGCTGG + Intronic
1083717393 11:64585537-64585559 ATCCCACCCCACCTCTCAGCAGG + Intergenic
1084652071 11:70495282-70495304 TTCCCCTCCCAGGGCTGGGCTGG + Intronic
1084938328 11:72599171-72599193 TTCCCCTCCCACCCCTGGACTGG + Intronic
1089830481 11:121323180-121323202 TGCCCACCCCACCGCCAGGGTGG - Intergenic
1091710896 12:2739639-2739661 TTCCCACACCAGGGCTTGGCTGG - Intergenic
1091899737 12:4135113-4135135 TTCCACCCCCACCCCTGGCCAGG + Intergenic
1096243947 12:49974101-49974123 CTCCCACCCCACCAGTGGGTTGG - Intronic
1096693070 12:53332982-53333004 TTCCCTCCCCACAGCTGGGTGGG - Intronic
1096769906 12:53928376-53928398 TTCCCACCCCACAGCTGCGTAGG - Intergenic
1098524463 12:71470701-71470723 CTCCCACCCCATCTCTAGGCAGG + Intronic
1102050234 12:109856621-109856643 TCCCCACCCCACTGCAGGGAGGG - Intronic
1103261505 12:119593214-119593236 TTCCCACCCCACCTGGGGGAGGG + Intergenic
1103441670 12:120967614-120967636 TGCCCAGCCCAGAGCTGGGCGGG + Intergenic
1103793623 12:123488709-123488731 CTCCGACCCCAAGGCTGGGCAGG - Intronic
1107992659 13:45832008-45832030 TTGCCTTCCCACCCCTGGGCTGG - Intronic
1110575101 13:77046894-77046916 TGCCCACCCCACCAGTGGGTGGG + Intronic
1112904048 13:104395359-104395381 TTCCCACACTTCCCCTGGGCAGG + Intergenic
1114393140 14:22331697-22331719 CTCCCACCCCACTGCTGGGAGGG - Intergenic
1115503269 14:34068084-34068106 TATCCACCCCACTGCTGGGCCGG - Intronic
1116436759 14:44903501-44903523 TTCCCCCCCCACTGCTGAGTAGG + Intronic
1117253234 14:53955102-53955124 GTCCCGCGCCACCGCTGGGGCGG + Intronic
1117898654 14:60511395-60511417 TTCCCGCCCCACCCCGCGGCCGG + Exonic
1118808800 14:69259577-69259599 TTCCAATCCCTCCTCTGGGCGGG + Intronic
1118824086 14:69364777-69364799 TTCCCACCCCAGGAGTGGGCAGG + Intergenic
1120716284 14:87844462-87844484 TTCCCTCCCTAACCCTGGGCTGG + Intronic
1121168826 14:91836324-91836346 GTCCCACGCCCGCGCTGGGCCGG + Intronic
1121700619 14:95951307-95951329 TTCCCACCCCTCTGCTGGAGTGG + Intergenic
1122695550 14:103550534-103550556 TCCCCACCCCAGGGCTGGGCTGG + Intergenic
1123704963 15:22944739-22944761 TTCTCACCCCACAGCAGGGCGGG - Intronic
1124042534 15:26118541-26118563 TTCCCACATCACCCCAGGGCTGG - Intergenic
1125762150 15:42104057-42104079 TTCCCACACCCACGATGGGCAGG - Intergenic
1127259773 15:57319485-57319507 TTCCTACCCCTCCGCCGGGGTGG + Intergenic
1130834468 15:87635600-87635622 TTCTCACCCCTCCAATGGGCAGG + Intergenic
1131111589 15:89767922-89767944 TCCCCACCCCACTGCTGGTTGGG + Intronic
1131119514 15:89813976-89813998 TGCCCACCGCACTGCTGGGGGGG + Intronic
1132004947 15:98218464-98218486 TTCACACCCCACCCCAGGGAAGG + Intergenic
1132772631 16:1572814-1572836 CCCCCAACCCACTGCTGGGCAGG - Intronic
1132872628 16:2122542-2122564 GTCCCACCCCACGGCGGGGATGG - Intronic
1132904223 16:2273928-2273950 TTCCCAGCCCACGGGAGGGCAGG - Intergenic
1132997893 16:2832798-2832820 CTCTCACCTCACCTCTGGGCAGG - Intronic
1133297462 16:4761930-4761952 TTCCTCCCACACCGCTGGGCTGG - Intronic
1133406845 16:5531251-5531273 TTCCCACCCCATCCCTTTGCTGG - Intergenic
1134090890 16:11391164-11391186 TGCCCACCCTGGCGCTGGGCAGG + Intronic
1134551725 16:15141742-15141764 GTCCCACCCCACGGCGGGGATGG - Intergenic
1136414814 16:30096438-30096460 TTCCGACCCCGCCCCTGCGCGGG - Intronic
1136485953 16:30571725-30571747 TTCGGACGCCACGGCTGGGCGGG - Exonic
1137608194 16:49800934-49800956 TTCCTACCCCATGGCTGGGCTGG - Intronic
1137677519 16:50311098-50311120 TTCCCTCCCCACCACTAGACTGG - Intronic
1141651594 16:85395850-85395872 TTCTCTCCCCATCTCTGGGCTGG - Intergenic
1141784792 16:86191866-86191888 TTCCGAGCACGCCGCTGGGCTGG + Intergenic
1142264401 16:89057169-89057191 TTCCCACCTCTCTGCAGGGCTGG + Intergenic
1142298539 16:89242913-89242935 TCCCCAGCCCAGCTCTGGGCTGG + Intergenic
1142677292 17:1521711-1521733 GCCCCACCCCACCTATGGGCAGG - Intronic
1143107388 17:4536495-4536517 TCCCCGCCCCACCCCAGGGCAGG - Intronic
1144775365 17:17782400-17782422 TTCCCCCTCCTCCGCCGGGCGGG + Intronic
1146722052 17:35130558-35130580 TGGGCACCCCACCCCTGGGCTGG + Exonic
1147317048 17:39626078-39626100 AACCCACCCCAACTCTGGGCCGG + Intergenic
1147537393 17:41329462-41329484 TTCACACCCAACCCCTGGGATGG + Intergenic
1148332393 17:46820293-46820315 TTCCCAGCCCATTGCTGGACTGG + Intronic
1151391048 17:73786789-73786811 TTCCCACCCCACCCCTACCCTGG - Intergenic
1151459934 17:74248439-74248461 TTCCCACCCCATGTCTTGGCAGG + Intronic
1151999806 17:77638071-77638093 TTCCCACCCCAAGGCTGTGTCGG - Intergenic
1155169855 18:23259364-23259386 TTCTCTCCCCACGTCTGGGCTGG - Exonic
1156157379 18:34319226-34319248 TTCCCTCACTACCCCTGGGCAGG + Intergenic
1159296326 18:66494177-66494199 TTCCCACCACACAGCTCCGCTGG + Intergenic
1160682520 19:418247-418269 TGCCCACCCCTCCTCTGGGAAGG + Intronic
1160908039 19:1460913-1460935 AGCCCACCACACCGCTGGGGAGG - Intronic
1161081554 19:2312979-2313001 CTCCCACCCCACCGCCTGGGAGG + Intronic
1161305330 19:3564210-3564232 TCCCCACCCCACCCCGAGGCTGG - Intronic
1161313477 19:3607324-3607346 CTCCCACCCCACCCCTGGAAGGG - Intergenic
1161683354 19:5691468-5691490 ATCCCACCCCGCCCCTCGGCCGG - Intronic
1163639911 19:18456313-18456335 TTCCCACCCCAACCCTGTGCTGG - Intronic
1163698941 19:18777588-18777610 ATCCCAGCCCAGCCCTGGGCGGG - Exonic
1163721610 19:18900545-18900567 GTCCCACCCCACCTCTGAGGAGG - Intronic
1164476258 19:28578083-28578105 CTCCCACCCCACCGCTAATCTGG - Intergenic
1164616453 19:29669432-29669454 TTCTCAGCACACAGCTGGGCTGG + Intronic
1164732849 19:30519210-30519232 GCCCCACCCCAGAGCTGGGCTGG - Intronic
1165485537 19:36093242-36093264 TACCCACCCCTCCCCTTGGCTGG - Intronic
1165994284 19:39833393-39833415 TGCCCTCCCCGCCGCGGGGCCGG - Exonic
1166894718 19:46016233-46016255 TCCCCTCCCTACCGCAGGGCAGG - Intronic
1167605522 19:50479842-50479864 GACCCACTCCATCGCTGGGCTGG + Intronic
925283518 2:2701365-2701387 TTCCCACCCCACAGCTGACAGGG + Intergenic
926445434 2:12935985-12936007 TTCCCACTGCACCGCTGGGTGGG - Intergenic
930032959 2:47069513-47069535 ATCCCACCCCAGCACTGGGTGGG + Intronic
930136334 2:47906504-47906526 GTCCCTCCCCGCCGCGGGGCTGG + Intergenic
932702793 2:74002667-74002689 TCCCCTCCCCGCCGCGGGGCTGG - Intronic
932903269 2:75724195-75724217 CCCCCACCCCACCCCTGGACAGG - Intergenic
933637074 2:84720178-84720200 TTCCCACACCACCCATGGCCAGG - Intronic
934941508 2:98506416-98506438 CTCACACCACACCGCTGGGCTGG - Intronic
935137534 2:100321351-100321373 TCCCCACCCCGCTGCTGGGCCGG + Intronic
937291505 2:120784892-120784914 TCCCCACCCCACACCTGGACTGG + Intronic
938322576 2:130374884-130374906 ACCCCACCCCACCCCTTGGCAGG + Exonic
938555026 2:132416512-132416534 GTCAAACCCCGCCGCTGGGCTGG + Intergenic
940919076 2:159287251-159287273 TACCCACCCAACGGCAGGGCTGG - Intergenic
940974392 2:159927002-159927024 TTCCCAGCCCCACACTGGGCTGG + Intergenic
942004887 2:171687966-171687988 TTTCCTCCCCAAAGCTGGGCCGG - Intronic
942072718 2:172329948-172329970 TTCCAACCACTCCGCAGGGCAGG - Intergenic
943518851 2:188922293-188922315 ATCCCACCCCACAGGTTGGCAGG + Intergenic
945212188 2:207395111-207395133 TTACCACCCCACCCCGGGGGAGG - Intergenic
946401169 2:219469093-219469115 CTCCCACCCCAGGGCTGGGCTGG - Intronic
946632478 2:221685191-221685213 TTCCTACCCTATGGCTGGGCTGG + Intergenic
947605067 2:231480918-231480940 ATCCCACCCCAGCCCTGGGGAGG - Intronic
947632971 2:231665705-231665727 ATCCCACCCCACTCCTGAGCAGG + Intergenic
948686702 2:239674826-239674848 CTGCCACCCCATCGCTGGCCTGG - Intergenic
948795314 2:240399548-240399570 TGCCCTGCCCCCCGCTGGGCAGG + Intergenic
1169272598 20:4212108-4212130 TTCCTTCCCCACCTCTGGCCAGG + Intergenic
1170964253 20:21052440-21052462 AGCCCACCCCAGCACTGGGCTGG + Intergenic
1171094956 20:22323578-22323600 TACCCACCCTTCCTCTGGGCTGG - Intergenic
1174366379 20:50059077-50059099 CTCCCACCCCACCTCTGAACTGG + Intergenic
1176079552 20:63265423-63265445 TCCCCACCCCACCCCTGCCCAGG - Intronic
1177167776 21:17622271-17622293 TTCCCACCCCACCCCAGCCCAGG + Intergenic
1180764748 22:18339896-18339918 TCACCACCCGACAGCTGGGCTGG - Intergenic
1180814281 22:18779788-18779810 TCACCACCCGACAGCTGGGCTGG + Intergenic
1180916565 22:19492950-19492972 TCCACACCCCACCTCTGGGTGGG - Intronic
1181200467 22:21214123-21214145 TCACCACCCGACAGCTGGGCTGG + Intronic
1183222955 22:36528945-36528967 TTGCCGTCCCTCCGCTGGGCGGG - Intronic
1183336300 22:37248829-37248851 TTCCCAGCACACTGCTGGGTGGG - Intergenic
1183409779 22:37648050-37648072 TTCACATGCCACCTCTGGGCAGG + Intronic
1183876761 22:40789325-40789347 TTCCCACCCCGTGGCTGGTCCGG - Intronic
1184249529 22:43252312-43252334 TTCCAGCCACACAGCTGGGCAGG - Intronic
1184266841 22:43352064-43352086 GTCCCACCACACCTCTGTGCTGG - Intergenic
1185052892 22:48563000-48563022 CTCCCACACCAGAGCTGGGCTGG + Intronic
1203226371 22_KI270731v1_random:80801-80823 TCACCACCCGACAGCTGGGCTGG - Intergenic
1203264380 22_KI270734v1_random:5475-5497 TCACCACCCGACAGCTGGGCTGG + Intergenic
950894891 3:16439854-16439876 TTTCTCTCCCACCGCTGGGCAGG - Intronic
951735111 3:25854923-25854945 TGCACTCCCCACTGCTGGGCGGG + Intergenic
954327473 3:49871283-49871305 GACCCACCCCACCACTGGGTAGG + Intergenic
954664332 3:52243834-52243856 TCCCCAACCCACCCCTGGGTGGG - Intergenic
954842780 3:53526491-53526513 TTTCCACCCCACCTCTAGGAAGG - Intronic
961372628 3:126440803-126440825 TTCCCAGCCCACCTCTGCCCAGG + Intronic
961539855 3:127591891-127591913 TTGCGACAGCACCGCTGGGCTGG + Intronic
961559719 3:127720254-127720276 GTCTCACCCCAGTGCTGGGCAGG - Intronic
964284496 3:155102755-155102777 TTCCCTCCCCTTCACTGGGCAGG + Intronic
966936951 3:184717021-184717043 TTCCCCCTCCCCCGCTGGCCAGG - Intergenic
966945842 3:184776637-184776659 TCCCCGCCCAACCTCTGGGCTGG - Intergenic
967104099 3:186241664-186241686 TTCCCACCCCAACCCTAGGTAGG - Intronic
968135246 3:196216053-196216075 TAGCCACCCCCACGCTGGGCCGG - Intronic
968658224 4:1787709-1787731 TCCCCACACCCCGGCTGGGCTGG + Intergenic
968730292 4:2266221-2266243 TGCCCAGCCCACTGCTGTGCAGG - Intergenic
969417134 4:7068197-7068219 TTCCCCACCCCCCGGTGGGCGGG + Exonic
969431083 4:7154672-7154694 TAACCACCCCACCCCTGGGGAGG - Intergenic
971473242 4:27049614-27049636 TTCCCACCGCTGCGCTGAGCTGG - Intergenic
985963985 5:3325569-3325591 TTCCAAGCCCACCGCAAGGCAGG + Intergenic
987310083 5:16673681-16673703 CTCCCACACCACCGCTGGGGAGG - Exonic
988846832 5:35135860-35135882 TTCCCACACCACAGCTGCCCTGG - Intronic
991294544 5:65066571-65066593 TTCTCACCCCACACGTGGGCGGG + Intergenic
992371945 5:76152630-76152652 TTCCCACCACACCTCTGCCCTGG - Intronic
993093616 5:83457482-83457504 TTCCCTCCCCAACACTGGACTGG - Intergenic
996056539 5:118988654-118988676 GTCCCACCCTGCCGCTGGGAAGG + Intergenic
996873535 5:128217154-128217176 TTCCCACTCCCCTGCTGGGTAGG + Intergenic
999508087 5:152219077-152219099 CTCCCCTCCCACCTCTGGGCAGG - Intergenic
999546347 5:152632709-152632731 TTCCCACCCCACCACCTGGAAGG - Intergenic
1001436342 5:171702561-171702583 TTCCTTCCCCACCCCGGGGCAGG - Intergenic
1002105952 5:176879535-176879557 CACCCACCCCGCCGCCGGGCAGG - Intronic
1002811890 6:639169-639191 TTCCCACACCTCTGCTGTGCTGG - Intronic
1004427146 6:15514123-15514145 TTCTGAGCCCACCTCTGGGCTGG - Intronic
1006137084 6:31901877-31901899 TCCCCACCCCCCCCCGGGGCCGG + Exonic
1006408193 6:33857103-33857125 CTCCCACCCCAGCCCTGGCCGGG - Intergenic
1006610388 6:35291136-35291158 ATCCCACCCCTGCCCTGGGCAGG - Intronic
1007396850 6:41582879-41582901 TGCCTGCCCCACCGCAGGGCAGG - Intronic
1014143017 6:117965614-117965636 TTCCCACCCCACAGCTGGGGTGG + Intronic
1019342723 7:516167-516189 CTCCCACAGCACAGCTGGGCGGG - Intronic
1019455364 7:1123957-1123979 TTCCCAACGCTCAGCTGGGCGGG + Intronic
1019890022 7:3939103-3939125 TTCCCTCCCTCCTGCTGGGCAGG + Intronic
1021027241 7:15685559-15685581 CTCCCTCCCCAGCGCTGGGATGG + Intronic
1024261606 7:47577819-47577841 TCTCCACCCCAGCGCTGGGCAGG - Intronic
1027045923 7:74991429-74991451 TACCCACCCCACCCCAGGCCAGG + Intronic
1029698296 7:102229109-102229131 TTCACAGCCCACAGCTGGGGCGG + Intronic
1032196596 7:129792908-129792930 TTCCCAGCCCCCCGCCGGGGAGG + Intergenic
1033511130 7:142061199-142061221 TTCCTACCTCACGGCTGGCCAGG + Intronic
1035297264 7:157874206-157874228 TTCCCCCTCCACAACTGGGCAGG + Intronic
1040578970 8:48679717-48679739 TTCCTACCACAGCGCTGGTCAGG + Intergenic
1042306433 8:67338114-67338136 TTCCCACCCCATCTAGGGGCAGG - Intronic
1047693819 8:127383611-127383633 TTCCCTGGCCAGCGCTGGGCTGG + Intergenic
1049088365 8:140495089-140495111 TTCCCACCCCTCCCCTCAGCAGG + Intergenic
1049179042 8:141211395-141211417 TGCCCAGCCCATCCCTGGGCAGG + Exonic
1049195461 8:141313268-141313290 CCCCCACCCCACCGCTGTGTAGG - Intergenic
1049305047 8:141898254-141898276 TTCTTTCCCCACCTCTGGGCAGG - Intergenic
1050472595 9:6008156-6008178 CTCCCAGCCCCCCGCTGGCCCGG - Intergenic
1052275725 9:26674288-26674310 TTCCAACCACACCCCTGAGCAGG + Intergenic
1053222099 9:36320635-36320657 TCCCCACCACACCCCTGGGGAGG - Intergenic
1055194641 9:73573872-73573894 TTCGCACCCCATCGCTATGCAGG + Intergenic
1056671997 9:88638370-88638392 TGCCCACCCCAGCTCTTGGCTGG + Intergenic
1057035814 9:91811144-91811166 TTCCCACACCTCCCCTAGGCCGG + Intronic
1057205073 9:93166935-93166957 TTCCCATCCCACAGCCGGGCTGG + Intergenic
1057438345 9:95062975-95062997 TTGCCACCCCTCTGCAGGGCGGG + Intronic
1057833694 9:98427265-98427287 TTCCCCTCCCACCTCTGGCCTGG + Intronic
1060427586 9:123519402-123519424 TTCCATCCCCAGAGCTGGGCTGG + Intronic
1061561959 9:131410356-131410378 TTCACACCCCACCGCAGGCCAGG + Intronic
1061869670 9:133513956-133513978 TGCCCACCCCACTGCTGGCCAGG - Intergenic
1061919229 9:133773072-133773094 TGCACACCCCACAGCTAGGCTGG + Intronic
1061961248 9:133990438-133990460 TTCCCAAACCACAGCTGGGGAGG + Intronic
1062275762 9:135729871-135729893 GCCCAACCCCACCACTGGGCAGG + Intronic
1062696190 9:137877602-137877624 CTCCCACCCCGGGGCTGGGCCGG - Intergenic
1187526984 X:20063323-20063345 CTCCTACCCCAGAGCTGGGCAGG + Intronic
1189409247 X:40755363-40755385 TTCCCAGACCACAGCTGGGAGGG + Intergenic
1190106903 X:47567376-47567398 GTCCCAGCCCACAGCTGAGCAGG + Exonic
1190222358 X:48520650-48520672 TCCCCACCCCACCACAAGGCAGG + Exonic
1199595000 X:149500008-149500030 TGCTCACCCCACCCTTGGGCAGG + Intronic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic