ID: 902749519

View in Genome Browser
Species Human (GRCh38)
Location 1:18497774-18497796
Sequence GCTAGTTGGTAGCAGAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902749519_902749526 -9 Left 902749519 1:18497774-18497796 CCTGGGCTCTGCTACCAACTAGC No data
Right 902749526 1:18497788-18497810 CCAACTAGCTGGGCAACAGGGGG No data
902749519_902749524 -10 Left 902749519 1:18497774-18497796 CCTGGGCTCTGCTACCAACTAGC No data
Right 902749524 1:18497787-18497809 ACCAACTAGCTGGGCAACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902749519 Original CRISPR GCTAGTTGGTAGCAGAGCCC AGG (reversed) Intergenic
No off target data available for this crispr