ID: 902753039

View in Genome Browser
Species Human (GRCh38)
Location 1:18530743-18530765
Sequence CTTTGAACACAGATGGGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902753035_902753039 -1 Left 902753035 1:18530721-18530743 CCCTGATGGCACAGTTGCTTATC No data
Right 902753039 1:18530743-18530765 CTTTGAACACAGATGGGCAATGG No data
902753029_902753039 15 Left 902753029 1:18530705-18530727 CCTGCCATTCACCCACCCCTGAT No data
Right 902753039 1:18530743-18530765 CTTTGAACACAGATGGGCAATGG No data
902753028_902753039 30 Left 902753028 1:18530690-18530712 CCATCAGTGGGGGGGCCTGCCAT No data
Right 902753039 1:18530743-18530765 CTTTGAACACAGATGGGCAATGG No data
902753033_902753039 3 Left 902753033 1:18530717-18530739 CCACCCCTGATGGCACAGTTGCT No data
Right 902753039 1:18530743-18530765 CTTTGAACACAGATGGGCAATGG No data
902753032_902753039 4 Left 902753032 1:18530716-18530738 CCCACCCCTGATGGCACAGTTGC No data
Right 902753039 1:18530743-18530765 CTTTGAACACAGATGGGCAATGG No data
902753034_902753039 0 Left 902753034 1:18530720-18530742 CCCCTGATGGCACAGTTGCTTAT No data
Right 902753039 1:18530743-18530765 CTTTGAACACAGATGGGCAATGG No data
902753031_902753039 11 Left 902753031 1:18530709-18530731 CCATTCACCCACCCCTGATGGCA No data
Right 902753039 1:18530743-18530765 CTTTGAACACAGATGGGCAATGG No data
902753036_902753039 -2 Left 902753036 1:18530722-18530744 CCTGATGGCACAGTTGCTTATCT No data
Right 902753039 1:18530743-18530765 CTTTGAACACAGATGGGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902753039 Original CRISPR CTTTGAACACAGATGGGCAA TGG Intergenic
No off target data available for this crispr