ID: 902755381

View in Genome Browser
Species Human (GRCh38)
Location 1:18545947-18545969
Sequence TGTCCCTCCTTTCCAGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902755378_902755381 -6 Left 902755378 1:18545930-18545952 CCTGAAAATACCTCTGTTGTCCC No data
Right 902755381 1:18545947-18545969 TGTCCCTCCTTTCCAGTTGAGGG No data
902755375_902755381 29 Left 902755375 1:18545895-18545917 CCAGGAACTTGACAGATGGCATC No data
Right 902755381 1:18545947-18545969 TGTCCCTCCTTTCCAGTTGAGGG No data
902755377_902755381 -3 Left 902755377 1:18545927-18545949 CCTCCTGAAAATACCTCTGTTGT No data
Right 902755381 1:18545947-18545969 TGTCCCTCCTTTCCAGTTGAGGG No data
902755376_902755381 -2 Left 902755376 1:18545926-18545948 CCCTCCTGAAAATACCTCTGTTG No data
Right 902755381 1:18545947-18545969 TGTCCCTCCTTTCCAGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902755381 Original CRISPR TGTCCCTCCTTTCCAGTTGA GGG Intergenic
No off target data available for this crispr