ID: 902756463

View in Genome Browser
Species Human (GRCh38)
Location 1:18552497-18552519
Sequence CAGTCTCTCCACCTGGACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902756455_902756463 -2 Left 902756455 1:18552476-18552498 CCCCCCCAACTCACTGAAAGCCA No data
Right 902756463 1:18552497-18552519 CAGTCTCTCCACCTGGACCCTGG No data
902756451_902756463 22 Left 902756451 1:18552452-18552474 CCCCTCCTCTTATAGGGAGAAAG No data
Right 902756463 1:18552497-18552519 CAGTCTCTCCACCTGGACCCTGG No data
902756450_902756463 23 Left 902756450 1:18552451-18552473 CCCCCTCCTCTTATAGGGAGAAA No data
Right 902756463 1:18552497-18552519 CAGTCTCTCCACCTGGACCCTGG No data
902756459_902756463 -6 Left 902756459 1:18552480-18552502 CCCAACTCACTGAAAGCCAGTCT No data
Right 902756463 1:18552497-18552519 CAGTCTCTCCACCTGGACCCTGG No data
902756452_902756463 21 Left 902756452 1:18552453-18552475 CCCTCCTCTTATAGGGAGAAAGT No data
Right 902756463 1:18552497-18552519 CAGTCTCTCCACCTGGACCCTGG No data
902756453_902756463 20 Left 902756453 1:18552454-18552476 CCTCCTCTTATAGGGAGAAAGTC No data
Right 902756463 1:18552497-18552519 CAGTCTCTCCACCTGGACCCTGG No data
902756454_902756463 17 Left 902756454 1:18552457-18552479 CCTCTTATAGGGAGAAAGTCCCC No data
Right 902756463 1:18552497-18552519 CAGTCTCTCCACCTGGACCCTGG No data
902756457_902756463 -4 Left 902756457 1:18552478-18552500 CCCCCAACTCACTGAAAGCCAGT No data
Right 902756463 1:18552497-18552519 CAGTCTCTCCACCTGGACCCTGG No data
902756458_902756463 -5 Left 902756458 1:18552479-18552501 CCCCAACTCACTGAAAGCCAGTC No data
Right 902756463 1:18552497-18552519 CAGTCTCTCCACCTGGACCCTGG No data
902756460_902756463 -7 Left 902756460 1:18552481-18552503 CCAACTCACTGAAAGCCAGTCTC No data
Right 902756463 1:18552497-18552519 CAGTCTCTCCACCTGGACCCTGG No data
902756456_902756463 -3 Left 902756456 1:18552477-18552499 CCCCCCAACTCACTGAAAGCCAG No data
Right 902756463 1:18552497-18552519 CAGTCTCTCCACCTGGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902756463 Original CRISPR CAGTCTCTCCACCTGGACCC TGG Intergenic
No off target data available for this crispr