ID: 902756987

View in Genome Browser
Species Human (GRCh38)
Location 1:18555582-18555604
Sequence CTCATGACTGCTGCTTGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902756987_902756991 0 Left 902756987 1:18555582-18555604 CCAAGACAAGCAGCAGTCATGAG No data
Right 902756991 1:18555605-18555627 CGCCCGGGCCTCCTGGCGCCAGG No data
902756987_902756990 -7 Left 902756987 1:18555582-18555604 CCAAGACAAGCAGCAGTCATGAG No data
Right 902756990 1:18555598-18555620 TCATGAGCGCCCGGGCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902756987 Original CRISPR CTCATGACTGCTGCTTGTCT TGG (reversed) Intergenic
No off target data available for this crispr