ID: 902758767

View in Genome Browser
Species Human (GRCh38)
Location 1:18567121-18567143
Sequence GACATCCTTCCTGTTCTTAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902758767_902758774 13 Left 902758767 1:18567121-18567143 CCGGTAAGAACAGGAAGGATGTC No data
Right 902758774 1:18567157-18567179 GCCTTGCCTGCCAGGACTTAGGG No data
902758767_902758780 25 Left 902758767 1:18567121-18567143 CCGGTAAGAACAGGAAGGATGTC No data
Right 902758780 1:18567169-18567191 AGGACTTAGGGATCCATGAGGGG No data
902758767_902758769 -9 Left 902758767 1:18567121-18567143 CCGGTAAGAACAGGAAGGATGTC No data
Right 902758769 1:18567135-18567157 AAGGATGTCCCAGAGACAGGAGG No data
902758767_902758778 23 Left 902758767 1:18567121-18567143 CCGGTAAGAACAGGAAGGATGTC No data
Right 902758778 1:18567167-18567189 CCAGGACTTAGGGATCCATGAGG No data
902758767_902758773 12 Left 902758767 1:18567121-18567143 CCGGTAAGAACAGGAAGGATGTC No data
Right 902758773 1:18567156-18567178 GGCCTTGCCTGCCAGGACTTAGG No data
902758767_902758779 24 Left 902758767 1:18567121-18567143 CCGGTAAGAACAGGAAGGATGTC No data
Right 902758779 1:18567168-18567190 CAGGACTTAGGGATCCATGAGGG No data
902758767_902758772 5 Left 902758767 1:18567121-18567143 CCGGTAAGAACAGGAAGGATGTC No data
Right 902758772 1:18567149-18567171 GACAGGAGGCCTTGCCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902758767 Original CRISPR GACATCCTTCCTGTTCTTAC CGG (reversed) Intergenic
No off target data available for this crispr