ID: 902765955

View in Genome Browser
Species Human (GRCh38)
Location 1:18615395-18615417
Sequence CTGGAAATTCAGAACAGAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902765951_902765955 5 Left 902765951 1:18615367-18615389 CCATGAATCTTCTCAATAATGCC No data
Right 902765955 1:18615395-18615417 CTGGAAATTCAGAACAGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902765955 Original CRISPR CTGGAAATTCAGAACAGAAT AGG Intergenic
No off target data available for this crispr