ID: 902769326

View in Genome Browser
Species Human (GRCh38)
Location 1:18636625-18636647
Sequence CCCCGCAGCCGGGCTCTCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 408}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902769326_902769341 29 Left 902769326 1:18636625-18636647 CCCGGGAGAGCCCGGCTGCGGGG 0: 1
1: 0
2: 3
3: 30
4: 408
Right 902769341 1:18636677-18636699 GGGAGTGCGTCCTCCCGGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 113
902769326_902769339 24 Left 902769326 1:18636625-18636647 CCCGGGAGAGCCCGGCTGCGGGG 0: 1
1: 0
2: 3
3: 30
4: 408
Right 902769339 1:18636672-18636694 CTGCGGGGAGTGCGTCCTCCCGG 0: 1
1: 0
2: 0
3: 7
4: 140
902769326_902769335 9 Left 902769326 1:18636625-18636647 CCCGGGAGAGCCCGGCTGCGGGG 0: 1
1: 0
2: 3
3: 30
4: 408
Right 902769335 1:18636657-18636679 TGGTCTACCCCAATACTGCGGGG 0: 1
1: 0
2: 1
3: 1
4: 35
902769326_902769340 25 Left 902769326 1:18636625-18636647 CCCGGGAGAGCCCGGCTGCGGGG 0: 1
1: 0
2: 3
3: 30
4: 408
Right 902769340 1:18636673-18636695 TGCGGGGAGTGCGTCCTCCCGGG 0: 1
1: 0
2: 0
3: 7
4: 113
902769326_902769333 7 Left 902769326 1:18636625-18636647 CCCGGGAGAGCCCGGCTGCGGGG 0: 1
1: 0
2: 3
3: 30
4: 408
Right 902769333 1:18636655-18636677 CCTGGTCTACCCCAATACTGCGG 0: 1
1: 0
2: 0
3: 10
4: 81
902769326_902769334 8 Left 902769326 1:18636625-18636647 CCCGGGAGAGCCCGGCTGCGGGG 0: 1
1: 0
2: 3
3: 30
4: 408
Right 902769334 1:18636656-18636678 CTGGTCTACCCCAATACTGCGGG 0: 1
1: 0
2: 0
3: 5
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902769326 Original CRISPR CCCCGCAGCCGGGCTCTCCC GGG (reversed) Intronic
900091811 1:924049-924071 CCTCGCTGCCGGGCTCGGCCTGG + Intergenic
900149863 1:1173647-1173669 CCCCTCCGCCCGGCCCTCCCAGG - Intergenic
900296666 1:1955366-1955388 CCCCGCAGCCCGGCCCCTCCAGG + Intronic
900310954 1:2032870-2032892 CCACGCAGCCAGGCCCGCCCGGG + Intergenic
900349460 1:2227869-2227891 CTCCCCAGCCGGGCTCTTCCAGG - Intergenic
900523784 1:3118746-3118768 GCCAGCAGCTGGGGTCTCCCTGG - Intronic
900867063 1:5276157-5276179 CCAGGCAGCAGGGCTCTCCCTGG + Intergenic
901013917 1:6216943-6216965 CACTGCAGCCGCGATCTCCCAGG + Intronic
901845689 1:11980623-11980645 CCTCGCCGCCGGGCCCTCCCCGG + Intronic
902769326 1:18636625-18636647 CCCCGCAGCCGGGCTCTCCCGGG - Intronic
903153340 1:21428424-21428446 CGCCGCCGCCGGGCGCGCCCAGG - Intergenic
903542265 1:24103180-24103202 CCCCGCAGCCAAGCTCTGCGCGG - Intronic
904063156 1:27726479-27726501 CCCCGCCGCCGCGGTCTCCCTGG + Intronic
905308499 1:37034427-37034449 CCCGGCTGCCGGGCTCTGGCGGG + Intergenic
905432638 1:37935614-37935636 CCCATCACCAGGGCTCTCCCAGG + Intronic
905553160 1:38859781-38859803 CCCCGGAGCCCGGCTCTCATAGG + Exonic
906657775 1:47561247-47561269 CCCAGGAGCTGGGCTCTCCAGGG - Intergenic
907725837 1:57019548-57019570 CCCTGCAGGCTGGCTCTCCTCGG + Intronic
907905553 1:58781844-58781866 GCCCGCAGGCGGCCGCTCCCTGG + Exonic
910196260 1:84642544-84642566 CACTGCAGCCTTGCTCTCCCGGG - Intergenic
910431983 1:87167922-87167944 CCCCTCAGCCGCTCTTTCCCTGG + Intronic
912473882 1:109923811-109923833 CCCCGGAGCCAGGCTCTCCCAGG + Exonic
912685197 1:111756334-111756356 CCCCGGAGCAGGGCCCTGCCGGG + Intronic
913115514 1:115692729-115692751 CCCTGCAGCAGGGCTCCGCCAGG - Exonic
913184131 1:116352801-116352823 CACTGCAGCCTGGATCTCCCAGG - Intergenic
914803992 1:150979386-150979408 CTCCGCAGCCGGGGTCCCCCTGG - Intergenic
914824834 1:151133000-151133022 CACCGCCGCCCGGCTGTCCCGGG - Exonic
914908155 1:151763433-151763455 GCCCGCAGCAGAGCTCTGCCCGG + Exonic
919518913 1:198562763-198562785 CACTGCAGCCTGGATCTCCCAGG + Intergenic
920033113 1:203049009-203049031 CCCTGCAACCCGGCCCTCCCAGG - Intronic
920905175 1:210157364-210157386 CCCTGCAGCCTTGATCTCCCTGG - Intronic
921253366 1:213317922-213317944 CCCCTGAGCAGGGCTGTCCCAGG + Intergenic
922472070 1:225882768-225882790 CCCCGCAACCCCACTCTCCCGGG - Intergenic
923545601 1:234920964-234920986 CCCCGCACCTGTGCTCACCCAGG + Intergenic
924052343 1:240092000-240092022 CGCCGCCGCCTGACTCTCCCGGG + Exonic
1063606359 10:7526288-7526310 CCCCGCTGCTGGGCCCTTCCAGG + Intergenic
1063968248 10:11363389-11363411 GCCAGCATCCGCGCTCTCCCTGG - Intergenic
1065435617 10:25701671-25701693 CTCAGCAGCCCGGCCCTCCCTGG - Intergenic
1065828945 10:29597074-29597096 CTCAGGAGCCGGTCTCTCCCTGG - Intronic
1066095557 10:32068828-32068850 CCTCGCAGGCTGGCTGTCCCTGG + Intergenic
1067060656 10:43076570-43076592 CCCCGCCTCCAGGCTCTCCGCGG - Intergenic
1067065388 10:43101437-43101459 CCCTGCACCCTGGCTGTCCCTGG - Intronic
1067449859 10:46375664-46375686 CCTCGCCCCCGGGCTCTGCCTGG - Exonic
1067587391 10:47484099-47484121 CCTCGCCCCCGGGCTCTGCCTGG + Exonic
1067634446 10:47991866-47991888 CCTCGCCCCCGGGCTCTGCCTGG + Intergenic
1067712027 10:48657123-48657145 CCCCACACCCGGGGTCTCCAGGG - Intergenic
1068560892 10:58513152-58513174 CCAGGTAGCCGGGCTCTCCCTGG - Exonic
1069867815 10:71514517-71514539 CCCCGCTGCCTGCCTCTCCTTGG + Intronic
1070329710 10:75408603-75408625 CCCCTCCCCCGCGCTCTCCCCGG - Intergenic
1070639709 10:78158869-78158891 CCCTGCAGCCTTGATCTCCCAGG + Intergenic
1070768479 10:79069464-79069486 CCGCGCAGCCGGGAGCTCGCCGG - Intronic
1071981538 10:91008802-91008824 CACTGCAGCCTTGCTCTCCCAGG + Intergenic
1072646884 10:97263035-97263057 CACTGCAGCCTTGCTCTCCCGGG - Intronic
1073208300 10:101780135-101780157 CCCCTCCGCCGGGCTCCCCAGGG + Intronic
1074535147 10:114323584-114323606 CCCAACAGCCGGGCACTCTCTGG - Intronic
1076381477 10:130027193-130027215 CCCCACTTCAGGGCTCTCCCCGG + Intergenic
1076404898 10:130205148-130205170 CCCCTCAGCCGGGCCCAGCCAGG + Intergenic
1076413495 10:130268090-130268112 CCCTCCATCTGGGCTCTCCCAGG + Intergenic
1076413508 10:130268142-130268164 CCCTCCATCTGGGCTCTCCCAGG + Intergenic
1076704274 10:132292873-132292895 ACCCGCTGCCGGTCCCTCCCTGG + Intronic
1077065706 11:640137-640159 CCCCGCGCCCGGCCTCCCCCCGG + Exonic
1077244157 11:1527906-1527928 CCCCGGCCCCCGGCTCTCCCTGG + Intergenic
1077379029 11:2219599-2219621 CCCTGCAGCAGGGTTCTGCCTGG + Intergenic
1077464905 11:2729116-2729138 CCCATGAGCTGGGCTCTCCCGGG + Intronic
1078180013 11:9003733-9003755 CCCCGCCGCCGTTCTCGCCCCGG - Intronic
1079283523 11:19108889-19108911 CCCACCAGCCAAGCTCTCCCAGG - Intergenic
1080887157 11:36377321-36377343 GTCCGCAGCCGGGCCGTCCCAGG - Intronic
1081899731 11:46617598-46617620 CCCAGCAGCCGGTCGCTTCCCGG - Exonic
1082128108 11:48455846-48455868 CCCTGCAGCAGGGTTCTGCCTGG + Intergenic
1083180283 11:60980908-60980930 CCCCTCAGCCGGGCCCTCGTAGG - Intronic
1083323921 11:61863784-61863806 CCCCGCAGCCCCGCGCTCACTGG - Exonic
1083894438 11:65613137-65613159 CCCCTCAGCCGAGCTCTGGCCGG - Exonic
1083917552 11:65758587-65758609 CACTGCAGCCTGGATCTCCCTGG - Intergenic
1083945112 11:65919198-65919220 CCCCGCGGCCCGCCCCTCCCGGG - Intergenic
1084174353 11:67415786-67415808 CCCCCCTCCCTGGCTCTCCCCGG - Intronic
1084307726 11:68297875-68297897 CCGCCCGGCCGGGCTCTCTCCGG - Intergenic
1084310366 11:68312991-68313013 CTCCCCACCCGGGCCCTCCCCGG + Intronic
1085413613 11:76306242-76306264 CCCCGCTGCCGTGCTCAGCCTGG + Intergenic
1086590400 11:88508790-88508812 ACCGGCCGCGGGGCTCTCCCGGG + Exonic
1088735482 11:112724653-112724675 CCCCACAGCTGGGCAATCCCAGG - Intergenic
1089365431 11:117918401-117918423 CCCCTTACCTGGGCTCTCCCTGG + Exonic
1089557047 11:119320593-119320615 TCCCACAGCCTGGCTTTCCCAGG + Intronic
1090434667 11:126676858-126676880 CACCGCAGCCTCGATCTCCCAGG + Intronic
1090665285 11:128911170-128911192 CCCCACCCCGGGGCTCTCCCAGG - Intronic
1091436258 12:475399-475421 CCCAGCAGCAGGGTTCTTCCTGG - Intronic
1092122910 12:6057058-6057080 CCCCACAGCCAGGTTCTCCGAGG - Exonic
1092144598 12:6205790-6205812 CCTCACAGCCAGGCTCACCCAGG - Intronic
1095957991 12:47817577-47817599 CTCCACAGCTTGGCTCTCCCTGG - Intronic
1096241126 12:49961099-49961121 CCCCGGAGGCGCCCTCTCCCAGG - Intergenic
1097248783 12:57621117-57621139 CCCCTCAGCAGGGATCCCCCCGG - Intronic
1098900604 12:76108560-76108582 CACTGCAGCCGGGACCTCCCGGG + Intergenic
1100391730 12:94150055-94150077 CCCGGCAGCAGCGCTCTCCGCGG - Intronic
1102507539 12:113393114-113393136 CCCCGCAGGCGGGCTCCACCAGG + Exonic
1102518627 12:113465826-113465848 CCCACCATCCGGGCTCTCCAGGG + Intronic
1102956212 12:117060768-117060790 CCCTGCTGCCCGACTCTCCCTGG + Intronic
1102959145 12:117080771-117080793 CCCCACACCCGGGCTGACCCTGG + Intronic
1103400516 12:120640514-120640536 CCCGGAAGCGGGGCTCCCCCAGG + Intergenic
1103415168 12:120738446-120738468 CCCCACTGCCGGGCTCACCATGG - Exonic
1103488013 12:121296185-121296207 CCCCGCAGCCTGCCTGTCTCGGG - Intronic
1103764331 12:123270692-123270714 GGCCGCAGCCGGGCGCTCCCAGG - Intronic
1103814714 12:123645144-123645166 CACTGCAGCCTGGCTCTCCAGGG + Intronic
1103913372 12:124363830-124363852 GCCCACAGCCGGACTCTCCCAGG + Intronic
1103985850 12:124767095-124767117 CCCAGCAGCCCGGGTCTCTCTGG - Intergenic
1104429486 12:128705208-128705230 TCCCCCAGCCCCGCTCTCCCAGG + Exonic
1104554876 12:129790468-129790490 CCCCGGAGTAGGGCTGTCCCCGG + Intronic
1112283247 13:98081100-98081122 CACTGCAGCCTGGATCTCCCAGG - Intergenic
1113820233 13:113208565-113208587 CCACGCCGCCGCGCGCTCCCCGG + Intronic
1115651132 14:35403852-35403874 CCCCGCAGCCCGCGCCTCCCTGG - Intronic
1115787951 14:36847545-36847567 CTCCTCTGCCTGGCTCTCCCAGG - Intronic
1118709905 14:68510484-68510506 CTCTGGAGCCCGGCTCTCCCTGG + Intronic
1119479983 14:74953114-74953136 CCTGGCAGCCCGCCTCTCCCGGG - Intronic
1122227132 14:100286454-100286476 CCCCCCAGCCATGCTCTGCCAGG - Intergenic
1122324862 14:100875913-100875935 CCCCGCAGCAGGGCTCTGAGCGG + Intergenic
1122406103 14:101502023-101502045 CCCCCCATCAGGCCTCTCCCTGG - Intergenic
1122597539 14:102903702-102903724 CCCTGCGGCCAGTCTCTCCCAGG - Intronic
1122719901 14:103716101-103716123 CCCCGCCCCCGCTCTCTCCCAGG + Intronic
1122799825 14:104223946-104223968 GCAGGCAGCCGGGCCCTCCCAGG - Intergenic
1122914538 14:104852049-104852071 CCCCGCAGCAGGCCTCACTCAGG + Intergenic
1123112529 14:105880034-105880056 CCCAGCTGCCCTGCTCTCCCTGG - Intergenic
1124202025 15:27686863-27686885 CCACCCAGCCCCGCTCTCCCTGG + Intergenic
1124212095 15:27771467-27771489 CCCCCCAGCTGGGCGCTGCCTGG - Intronic
1124328120 15:28784250-28784272 CCCCGCAGCCTCGGCCTCCCAGG + Intergenic
1124554481 15:30711893-30711915 CCCATCAGCCGGGCTTCCCCAGG - Intronic
1124635292 15:31361138-31361160 CCCCACAGCCAGGCTCTACGAGG - Intronic
1124676768 15:31693784-31693806 CCCATCAGCCGGGCTTCCCCAGG + Intronic
1125407658 15:39370117-39370139 CCCTGCAGCAGGGTTCTGCCTGG + Intergenic
1126949696 15:53867904-53867926 CACTGCAGCCTGGATCTCCCAGG + Intergenic
1129238386 15:74237296-74237318 CCCAGCAGCAGGGCTCTGTCAGG + Intronic
1129871574 15:78944918-78944940 CACCGCAGACGGGGACTCCCAGG + Exonic
1130390053 15:83447418-83447440 CCCCGCGGCTGGGCTCCGCCGGG - Exonic
1130551790 15:84894081-84894103 CACCGCGCCCGGCCTCTCCCTGG - Intronic
1132591392 16:727843-727865 CCCCGCTCCCCGGCGCTCCCCGG + Intronic
1132859520 16:2063132-2063154 CCGCAGAGCCGGGCTCTGCCTGG + Intronic
1133011093 16:2912208-2912230 GCCCGCAGCCCGGCTCTCCCGGG + Intronic
1133172940 16:3992928-3992950 CCCCGCCGACAGGCTCTCGCGGG + Intronic
1133998121 16:10762833-10762855 CCCCGCCTCCAGGCTCTCCACGG - Intronic
1135304575 16:21356998-21357020 CACCGCAGCCTGGGTCTCCTGGG - Intergenic
1136011610 16:27367216-27367238 TCCCGCAGCCGGCATCTCACTGG - Intergenic
1136016084 16:27402103-27402125 ACCCGCAGCTGGGCTCCTCCTGG - Intergenic
1136377405 16:29873476-29873498 CGGGGCAGACGGGCTCTCCCAGG + Intronic
1137398343 16:48133176-48133198 AACCGCTGCCAGGCTCTCCCGGG + Intronic
1137670266 16:50274474-50274496 CCCTGCAGAAGGGCTCTTCCGGG + Intronic
1139582691 16:67882741-67882763 CCCCGCAGCTGGGCTAGCACAGG - Exonic
1139754098 16:69129140-69129162 CACCGCACCCGGCCTCTGCCTGG - Intronic
1139851003 16:69951621-69951643 CACCGCCCCCGGGCTGTCCCAGG - Intronic
1139879985 16:70174533-70174555 CACCGCCCCCGGGCTGTCCCAGG - Intronic
1139890626 16:70251393-70251415 CACCGCCGCCGCGCTCGCCCTGG - Exonic
1139967742 16:70755068-70755090 CCACGCTGCCCGGCTCTCCACGG - Intronic
1140372529 16:74420994-74421016 CACCGCCCCCGGGCTGTCCCAGG + Intronic
1141660172 16:85437202-85437224 CTCCGCCGCCGGGCTCCCCAAGG + Intergenic
1141692365 16:85603454-85603476 CCCTGCATCTGGCCTCTCCCAGG + Intergenic
1141732254 16:85830388-85830410 ACCCCCAGCCTGCCTCTCCCAGG + Intergenic
1142300889 16:89257251-89257273 CCCCGCAGCCCGCCCGTCCCCGG - Intergenic
1142320878 16:89382119-89382141 CCCAGCAGCTGGGCACACCCAGG + Intronic
1142638171 17:1270552-1270574 CCCCGCAGCATGGCCTTCCCGGG - Exonic
1143147339 17:4785332-4785354 CGCCGCCGCCGCTCTCTCCCGGG - Exonic
1143150953 17:4807420-4807442 CCCCGTAGCCGCGCGCTCTCCGG + Intronic
1143399833 17:6637059-6637081 CCCCACAGCCTGGCTGCCCCCGG + Intronic
1143463955 17:7123235-7123257 CCCCGAAAACTGGCTCTCCCGGG - Intergenic
1144096307 17:11903620-11903642 CACCGCGCCCGGGCCCTCCCTGG - Intronic
1144185165 17:12789811-12789833 CCCCGCTGCCGCGCTAGCCCGGG - Exonic
1144394168 17:14827513-14827535 TCCCGCAGGCTGGCTCTCTCTGG - Intergenic
1144594638 17:16558370-16558392 CACTGCAGCCTTGCTCTCCCGGG + Intronic
1144828966 17:18121313-18121335 CGCCGCTGCCGGGCTCACCCAGG + Exonic
1145750859 17:27354046-27354068 ACTCCCAGCCAGGCTCTCCCCGG - Intergenic
1146182994 17:30709225-30709247 CCCCTCAGCCGGGGCCTCCTCGG - Intergenic
1146201182 17:30860097-30860119 CCCTGCAGCCTCGATCTCCCGGG + Intronic
1146677948 17:34786227-34786249 GCCTGCAGCCAGGCTCTCCTGGG - Intergenic
1147260995 17:39209830-39209852 CCCCGCAGCCCGCCTCTCCTTGG + Intergenic
1148157748 17:45433065-45433087 CCCCGCAGCCTCTTTCTCCCTGG - Intronic
1148158249 17:45435672-45435694 CCCAGCAGTCAGGCTCTTCCTGG - Intergenic
1148198641 17:45733128-45733150 CCCCACAGCCAGGCTCTCCCAGG - Intergenic
1148274093 17:46288215-46288237 CCCTGCAGCCTGGACCTCCCAGG + Intronic
1148582416 17:48752912-48752934 CCCGGCACCCCGGCTCTGCCAGG - Intergenic
1150408961 17:64926355-64926377 CCCTGCAGCCTGGACCTCCCAGG - Intergenic
1150761076 17:67962065-67962087 CCCTGCAGCCTGGACCTCCCAGG - Intronic
1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG + Intronic
1151821082 17:76497263-76497285 CCCCTCAGCTGTGCTTTCCCTGG - Intronic
1151826662 17:76527690-76527712 CCCAGCAGCCCGGATCCCCCGGG + Exonic
1152048886 17:77957994-77958016 GCTCGCAGCTGGGCGCTCCCTGG + Intergenic
1152344150 17:79741562-79741584 CCCCGCACCTGTGCCCTCCCAGG + Intronic
1152357707 17:79814823-79814845 CGCCGCCGCCGGGCTCCCCGAGG - Intergenic
1152548072 17:81012978-81013000 CCCCGCAGCAGGCATCTGCCTGG - Intergenic
1152579488 17:81159829-81159851 CCCCCCAGCCTGGCTCCCCCAGG + Intronic
1152762601 17:82116866-82116888 CCCCACAGCAGGGCCCTCTCCGG + Intronic
1153805732 18:8706750-8706772 CGCCGCAGCCAGGCCCTCCGGGG - Intronic
1156490222 18:37491686-37491708 CCACGCTGCCTGCCTCTCCCTGG - Intronic
1158648808 18:59269114-59269136 CCCCGAAGCCGGGCCCGCACGGG + Exonic
1159959425 18:74544008-74544030 CACTGCAGCCTGGATCTCCCAGG - Intronic
1160005163 18:75063858-75063880 CACGGCGGCCGGGCTCTCCTGGG - Exonic
1160333764 18:78018494-78018516 CCCCAGCGCCGGGCTCTGCCTGG - Intergenic
1160517479 18:79486578-79486600 CCACGCACCCCGGCTCGCCCGGG + Exonic
1160535481 18:79589371-79589393 CCAAGCAGCCGGTCCCTCCCAGG - Intergenic
1160619324 18:80159926-80159948 GCCCGCAGGCAGCCTCTCCCGGG - Exonic
1160759045 19:773324-773346 CCCTGGAGCTGGTCTCTCCCTGG - Intergenic
1160858766 19:1228902-1228924 CCGCCCAGCCGGGGTCTCCGCGG + Exonic
1161010864 19:1958800-1958822 CGCAGCAGCCCAGCTCTCCCAGG + Intronic
1161048653 19:2150752-2150774 CCCCGCCCCCGGACCCTCCCCGG - Intronic
1161061144 19:2215600-2215622 CCCCGGAGGCGGGCTCTCACGGG + Intronic
1161074897 19:2280815-2280837 CCCCGCAGCCCAGGGCTCCCTGG + Intronic
1161175976 19:2842136-2842158 CACCGCTCCCGGGCTGTCCCGGG - Intronic
1161374315 19:3931331-3931353 CCCAGGAGCCGGGCTTTCCTGGG + Intergenic
1161939500 19:7394161-7394183 CACCGCAGCCTGGACCTCCCAGG + Intronic
1162033187 19:7925997-7926019 CCCGGCGGCCGCGCTCTCTCAGG + Exonic
1162083292 19:8232795-8232817 CCCTGCAGCCTAGATCTCCCAGG + Intronic
1163154523 19:15432606-15432628 CCCCGCGGGCGCGCGCTCCCGGG + Intronic
1165161938 19:33821327-33821349 CCCGGCAGCTGGGCACTCCTTGG - Intergenic
1165528547 19:36377469-36377491 CCCTGCAGCCTGGACCTCCCTGG - Intronic
1165956941 19:39507031-39507053 CCCCACAGGCGGACTCTGCCTGG + Exonic
1166130652 19:40743857-40743879 CCCCTCAACCTGGGTCTCCCCGG - Intronic
1166500775 19:43339572-43339594 CCCGGGAGCAGGGCTCTTCCTGG - Intergenic
1166505235 19:43367251-43367273 CCCAGGAGCAGGGCTCTTCCTGG - Intergenic
1166509322 19:43393844-43393866 CCCAGGAGCAGGGCTCTTCCTGG + Intergenic
1166675339 19:44737574-44737596 CCCCAGAGCCTGGCTCTCCCTGG + Intergenic
1166790114 19:45394205-45394227 CACTGCAGCCTGGATCTCCCAGG + Intronic
1166806835 19:45492753-45492775 CCCCATAGCAGGGCCCTCCCAGG + Intronic
1166986161 19:46661012-46661034 CCCCGCAGCCGGCCCCGCTCAGG + Exonic
1167641872 19:50686839-50686861 CCCCGCCCCCGGGGGCTCCCTGG - Intronic
1167849983 19:52194035-52194057 CACCGCAGCCTCGATCTCCCTGG - Intronic
1167972444 19:53197017-53197039 GCCCCCTGCCGGTCTCTCCCTGG + Intergenic
1168166524 19:54552110-54552132 GCCCGAGGCTGGGCTCTCCCAGG + Intergenic
1168465098 19:56595387-56595409 CCCCGAGGCCGCGCCCTCCCCGG - Exonic
925523258 2:4771705-4771727 CCCTGCAGCCTGGACCTCCCAGG + Intergenic
926753834 2:16220492-16220514 CCCTGCAGCCTTGATCTCCCAGG + Intergenic
927695798 2:25239036-25239058 CCCCTGAGCCGGGCCCTCTCTGG - Intronic
927714283 2:25342106-25342128 CCCCGCGGCCGCGCTGGCCCCGG + Intronic
927719911 2:25375994-25376016 CACGGCAGCCTGGCTCACCCAGG + Intergenic
927923906 2:26996226-26996248 CACTGCAGCCTGGATCTCCCGGG + Intronic
929188635 2:39120551-39120573 CCGCGCAGCCGGGCTAGCCCTGG + Intronic
929201654 2:39243622-39243644 CCCCGCCGCCGCCCACTCCCTGG + Intergenic
930762331 2:55050105-55050127 GCCCGCCGCCGGGCTGTCCGCGG - Exonic
937905072 2:127049159-127049181 CCCTGCAGCTGGGCTGTGCCTGG + Intronic
938138182 2:128775992-128776014 ACCCCCAGCCAGGCTCTCCAGGG + Intergenic
938393063 2:130920182-130920204 CACTGCAGCCTGGATCTCCCAGG + Intronic
938549026 2:132362306-132362328 CACTGCAGCCTTGCTCTCCCAGG + Intergenic
939249031 2:139662490-139662512 CCCTGCAGCAGGCCTCTGCCTGG + Intergenic
940284339 2:152018726-152018748 CACTGCAGCCTGGCTCTCCCGGG - Intronic
943583400 2:189710724-189710746 CACTGCAGCCTGGATCTCCCTGG - Intronic
943876176 2:193071043-193071065 CCCTGCAGCAGGGATCTGCCTGG - Intergenic
944772414 2:202927874-202927896 CCCTGCAGCCTTGATCTCCCAGG + Intronic
945106963 2:206325493-206325515 CACTGCAGCCTGGATCTCCCAGG + Intergenic
946248341 2:218399556-218399578 CGCCGCACTCGGGCACTCCCCGG + Intronic
946828182 2:223700695-223700717 CCCCTCAGCTGGGCTCTGCAGGG - Intergenic
947714951 2:232334744-232334766 GCCCGCCCCCGGGCTCTCCCAGG - Intronic
947734026 2:232445695-232445717 GCCCGCCCCCGGGCTCTCCCAGG - Intergenic
948370516 2:237486673-237486695 CCCCGCAGCAGGGCTGCCCGCGG + Intronic
948436146 2:237955853-237955875 CCCCGAAGCCGGGTCCTCCCGGG - Intergenic
948682051 2:239641871-239641893 GCCCGCAGCCTGGCACTGCCTGG + Intergenic
948753126 2:240143903-240143925 GCCCGCAGCCCGGCTCTGCCTGG - Intronic
948788032 2:240363205-240363227 GCCCGCAGCTGGGCTGTCCAGGG - Intergenic
948827069 2:240578008-240578030 CCCCTCCCCTGGGCTCTCCCAGG + Exonic
948995614 2:241576782-241576804 CCCTGCGGCCCGGCTCTCCTCGG + Intergenic
948995632 2:241576841-241576863 CCCTGCGGCCCGGCTCTCCTCGG + Intergenic
949045700 2:241871846-241871868 CCCCGCACCCGGGGACTGCCAGG + Exonic
949064563 2:241981861-241981883 CAGCCCAGCTGGGCTCTCCCTGG - Intergenic
1169074224 20:2751644-2751666 CCCCGCAGCCCCCCACTCCCAGG - Intronic
1170923059 20:20697252-20697274 CACTGCAGCCTTGCTCTCCCAGG - Intronic
1171877848 20:30594869-30594891 CACTGCAGCCTTGCTCTCCCAGG + Intergenic
1172284686 20:33732253-33732275 CCCGCCGGCCTGGCTCTCCCCGG - Intronic
1172958951 20:38783644-38783666 CACTGCAGCCTGGATCTCCCAGG - Intergenic
1173279740 20:41617985-41618007 GCCCGCGGCCGGGGTCTGCCCGG + Intronic
1175096239 20:56543678-56543700 CCCCTCAGGGTGGCTCTCCCTGG + Intergenic
1175791800 20:61744679-61744701 CCCGGCTGCCTGGCTCACCCGGG + Intronic
1175926581 20:62474325-62474347 GCCAGCAGCCGGGCTGTCCAGGG + Intronic
1176672950 21:9751413-9751435 CCTCCCAGCGGGGCTCTCCATGG + Intergenic
1178915082 21:36701485-36701507 CTCCGCTGCCGGGTGCTCCCGGG - Intronic
1179550843 21:42142411-42142433 CCCCGCAGCCTAGACCTCCCAGG + Exonic
1179615169 21:42578987-42579009 GCCCACAGGAGGGCTCTCCCTGG - Intronic
1179833453 21:44012558-44012580 CCCCGCCTCCGGGCACTCACAGG - Exonic
1179979604 21:44889197-44889219 CCCAGCAGCCGGGCTCACTCGGG - Intronic
1180835177 22:18926146-18926168 CCCCAGAGCCAGGGTCTCCCAGG + Intronic
1180957461 22:19747354-19747376 CCCCCCAGCAGGGCTCACGCAGG - Intergenic
1181323405 22:22025863-22025885 CCCAGCAGCTGGGACCTCCCAGG + Intergenic
1181449787 22:23011889-23011911 CACTGCAGCCTGGATCTCCCAGG - Intergenic
1181463249 22:23097502-23097524 CCTCGCATCAGGGGTCTCCCTGG + Intronic
1181465358 22:23107923-23107945 CCCCGCAGCAGGCCTTGCCCTGG - Intronic
1181732854 22:24859989-24860011 CCCCGCAGCTGTGGCCTCCCAGG + Intronic
1182112138 22:27731389-27731411 CCCCAGAGCCTGGCTCCCCCTGG - Intergenic
1183933029 22:41246901-41246923 CCCCTCAGCCAGGCTCTCCAAGG + Intronic
1184046757 22:41976872-41976894 CCGCGCCGCCGCGCCCTCCCCGG - Exonic
1184673287 22:46027064-46027086 CCACGCAGCAGAGCTCTCCCTGG + Intergenic
1184693932 22:46129604-46129626 CCTCGCAGCCCGGCTGTTCCTGG - Intergenic
1184703092 22:46190672-46190694 CACCGCAGCCTTGATCTCCCGGG - Intronic
1184815012 22:46862586-46862608 TCCCGCAGCCCCGCTCTCGCTGG - Intronic
1203285265 22_KI270734v1_random:151445-151467 CCCCAGAGCCAGGGTCTCCCAGG + Intergenic
950675348 3:14551053-14551075 GCCCCCAGCCCTGCTCTCCCGGG - Intergenic
951554362 3:23905868-23905890 CACTGCACCCGGCCTCTCCCTGG - Intronic
954025737 3:47781814-47781836 CCCCACAGCCTGGCCCACCCCGG + Exonic
954414185 3:50384905-50384927 GCCCCCAGCCCAGCTCTCCCAGG - Intronic
955818687 3:62874422-62874444 CCCAGCGGCCGGGCTCGCCCAGG - Intronic
958137713 3:89518381-89518403 CCCTGCAGCCTTGGTCTCCCAGG + Intergenic
958865958 3:99502019-99502041 CCACACAGCCAGGCACTCCCTGG + Intergenic
959753342 3:109865128-109865150 CCCCGAATACGGGGTCTCCCTGG - Intergenic
959838877 3:110951288-110951310 CCCCGCAGCAGGCTTCTGCCTGG - Intergenic
961544810 3:127625265-127625287 CACTGCAGCCTCGCTCTCCCAGG - Intergenic
961722250 3:128904652-128904674 CCCCGCTGCCTGCCTATCCCTGG - Intronic
961756867 3:129133075-129133097 CCCCGCAGAAGAGCTCTGCCTGG + Intronic
964902655 3:161678381-161678403 CCTCTCAGCCAGGCTTTCCCCGG + Intergenic
967846238 3:194045305-194045327 CACCTCTCCCGGGCTCTCCCTGG + Intergenic
967930251 3:194685956-194685978 CTCCGCTCCCGGGCTCTCCACGG - Intergenic
968512685 4:1002542-1002564 CCCCGCAGCGGGGCCTTCGCAGG - Intronic
968809505 4:2793491-2793513 CCCCGAAGCCGCGCTCCCTCGGG - Intronic
968907981 4:3463339-3463361 CCGCGCCGCCGCGCTCGCCCCGG - Exonic
969053686 4:4388834-4388856 CCCCGCTGCCAGCCTCTTCCCGG - Intronic
969276173 4:6137259-6137281 GCCAGCAGCCGGGCTCACCAGGG + Intronic
969474371 4:7412833-7412855 CCCCACCCCTGGGCTCTCCCAGG + Intronic
972324189 4:37999590-37999612 CCCCACAGGCCTGCTCTCCCAGG - Intronic
972505552 4:39717089-39717111 CACCGCAGCCTCGATCTCCCAGG - Intronic
972671490 4:41216534-41216556 TCCCGCTGCCGCGCTCACCCAGG + Intronic
973562282 4:52149264-52149286 CACTGCAGCCTGGATCTCCCAGG + Intergenic
975800715 4:78057259-78057281 CCCCGCAGCCCTCCTCACCCAGG + Intergenic
980763749 4:137270990-137271012 CCCTGCAGCAGTTCTCTCCCTGG + Intergenic
981550209 4:145936188-145936210 CCCCGCTGCCGGGCTCTTGTCGG - Intronic
982221420 4:153128623-153128645 CCCTGCAGCCTGGAACTCCCAGG - Intergenic
983249378 4:165327453-165327475 CCCCGCCTCCGGGCGCTCCGCGG + Intergenic
985401739 4:189600215-189600237 CCTCCCAGCGGGGCTCTCCATGG - Intergenic
985549010 5:523978-524000 CCCGAGAGCCGGACTCTCCCGGG + Intronic
985894557 5:2740672-2740694 CCCCGCAGGCGCGTGCTCCCTGG - Intergenic
986735020 5:10662100-10662122 CCACGGAGCCTGCCTCTCCCAGG - Intergenic
988990163 5:36662651-36662673 CCTCGCAGCGGGGCTCGCGCCGG + Intronic
989571939 5:42953327-42953349 CTCCGTGGCGGGGCTCTCCCAGG + Intergenic
990286960 5:54310198-54310220 CCCTGCAGCCGTGCTGGCCCAGG + Intronic
991587449 5:68215449-68215471 CCCAGCAGCCGGGCGGGCCCGGG + Intergenic
992269772 5:75052989-75053011 CGCCGGCGCCGGGCTTTCCCGGG - Intergenic
992671869 5:79069549-79069571 GCCCGCTGCAGGGCTCCCCCGGG - Exonic
992693770 5:79264159-79264181 CACTGCAGCCTGGCCCTCCCGGG + Intronic
992878824 5:81084815-81084837 CCCCGCAGACGAGAGCTCCCAGG + Intronic
994107264 5:95961497-95961519 CCCCGCACCCGGGCGCGGCCAGG + Intronic
994197401 5:96935829-96935851 CCCGGCTGCGGCGCTCTCCCCGG - Exonic
995488667 5:112666197-112666219 CACTGCAGCCTCGCTCTCCCAGG + Intergenic
997224085 5:132195720-132195742 ACCCACATCCGGGCTGTCCCTGG + Intronic
997302090 5:132813656-132813678 CACCGCCGCCTGGCTCACCCCGG - Exonic
997439528 5:133899464-133899486 CCCCACACCCCGCCTCTCCCTGG + Intergenic
997461846 5:134058269-134058291 GTCAGCAGCCGGGCTGTCCCTGG + Intergenic
997537756 5:134635768-134635790 CACTGCAGCCTGGATCTCCCAGG - Intronic
997595839 5:135106979-135107001 CTCCACAGCCTGGCTCTCTCTGG + Intronic
997704196 5:135931113-135931135 ATCCGGAGGCGGGCTCTCCCTGG + Intronic
999251224 5:150183581-150183603 CACCCCAGCCGGGCCATCCCTGG + Exonic
999328634 5:150658443-150658465 GCCTGCAGCCAGGCTCCCCCAGG - Intronic
999986215 5:157007779-157007801 CCCCGCAGCAGGCTTCTGCCTGG + Intergenic
1001511122 5:172322732-172322754 CACTGCAGCCTGGCACTCCCGGG + Intergenic
1001652874 5:173328006-173328028 CCCCGCAGCCGGGAGCTACTGGG - Intronic
1002091691 5:176810208-176810230 CTCCGGATCCGGGCTCTCGCGGG - Intergenic
1002489684 5:179566063-179566085 CCCTGCAGCCTGGAACTCCCAGG - Intronic
1002645123 5:180649175-180649197 CCTCGGAGCCGGGCCCTGCCGGG - Intronic
1002670629 5:180863365-180863387 CCCTGCAGCCTCGATCTCCCAGG + Intergenic
1003535876 6:6975029-6975051 CACCGCATCCGGCCTCTCCTAGG - Intergenic
1005826167 6:29632863-29632885 CCCGGCTCCCCGGCTCTCCCCGG + Exonic
1006044603 6:31283929-31283951 CACCGCACCCGGCCTCTCCTTGG + Intronic
1006388813 6:33746907-33746929 CACGGCAGCCCGGCCCTCCCGGG - Exonic
1008554804 6:52664421-52664443 CCACAAAGCCGGGCTGTCCCAGG + Intergenic
1011043386 6:83055620-83055642 CCCCGCAGCAACGCTCTCCCAGG - Intronic
1013306169 6:108848687-108848709 CCCCGCAGCCAGCGTCTCCATGG - Intronic
1015842217 6:137488342-137488364 CCCCGGGGCCTCGCTCTCCCTGG - Intergenic
1018649136 6:165976824-165976846 CCCTGCAGCAGGGCCCTCCTCGG + Intronic
1018810509 6:167294936-167294958 CCCCGATGCTGGCCTCTCCCTGG + Intronic
1019165210 6:170094029-170094051 CCTCCCAGCCAGGCCCTCCCAGG - Intergenic
1019279441 7:192678-192700 CCCCCCAGCCCCGGTCTCCCGGG + Intergenic
1019305679 7:333188-333210 CCCCCCCGCCGGCCCCTCCCTGG - Intergenic
1019562577 7:1665919-1665941 CGCCGCAGCCTGGCTCCCGCCGG + Intergenic
1021511059 7:21432916-21432938 CACCGCAGCCTGGATCCCCCGGG - Intronic
1021720152 7:23497049-23497071 CACTGCAGCCTGGATCTCCCAGG + Intergenic
1021926650 7:25540348-25540370 CACTGCAGCCTGGATCTCCCAGG - Intergenic
1022396977 7:29997828-29997850 CACTGCAGCCTGGGTCTCCCAGG + Intergenic
1022856636 7:34321377-34321399 CACTGCAGCCGCGCTTTCCCAGG - Intergenic
1024886216 7:54145873-54145895 AGCCTCAGCTGGGCTCTCCCAGG + Intergenic
1025639529 7:63353756-63353778 CCCCGCAGCCCGGCGCTTGCTGG + Intergenic
1025643170 7:63394336-63394358 CCCCGCAGCCCGGCGCTTGCTGG - Intergenic
1026510338 7:71022027-71022049 CCCTGCAGCCTCGATCTCCCAGG - Intergenic
1026582953 7:71633244-71633266 ACCCACAGCCGGGCTGTGCCTGG - Intronic
1027960552 7:84940149-84940171 CCCTGCAGCCTCGCTCTCCCTGG - Intergenic
1029270533 7:99374644-99374666 CCCCGCCCCCGGGCCCTACCGGG + Intronic
1030302618 7:107989698-107989720 CCTCCCAGCCAGGCTCTCACGGG - Intronic
1030940754 7:115646152-115646174 CACCGCAGCCTGGACCTCCCAGG - Intergenic
1032192652 7:129773500-129773522 TCCCCCACCCGGGCACTCCCTGG + Intergenic
1033394384 7:140959701-140959723 CACCGCAGCCTCGATCTCCCAGG - Intergenic
1034573060 7:151972807-151972829 CCCCGCAGCAGGCTTCTGCCTGG - Intronic
1034753903 7:153596451-153596473 CCCCAGAGCCGGGCTTGCCCAGG + Intergenic
1035051567 7:156001779-156001801 CCACTCAGCCGAGCTGTCCCTGG - Intergenic
1035153126 7:156892394-156892416 CCGCGCAGCCCGGCCCTTCCCGG + Intronic
1035388565 7:158490229-158490251 CCACGCAGCCGGGCTCCCCGCGG - Intronic
1035396798 7:158540209-158540231 CTCTGCAGCCGGGGGCTCCCAGG + Intronic
1035404185 7:158587566-158587588 CCCCGCGGCCGGCAGCTCCCGGG - Exonic
1039821394 8:41138438-41138460 CCCCGCTGCCTTGCTCTCCATGG - Intergenic
1041244902 8:55880312-55880334 CCCCGCGCCCTGGCTCCCCCGGG - Intronic
1042544258 8:69936693-69936715 CACTGCAGCCTGGATCTCCCAGG - Intergenic
1042721206 8:71828419-71828441 CCCTGCAGCCCGGCTCCTCCAGG - Intronic
1043491767 8:80756031-80756053 CACTGCAGCCTTGCTCTCCCAGG - Intronic
1046616638 8:116484843-116484865 CCCAGGAGCCTGGTTCTCCCAGG + Intergenic
1047822790 8:128539868-128539890 CCCCTCAGAAGGGCTTTCCCTGG - Intergenic
1048968918 8:139633614-139633636 CCCAGAGGCCCGGCTCTCCCAGG + Intronic
1049431528 8:142567476-142567498 CTCCGCAGCCCTGCTGTCCCTGG + Intergenic
1049548891 8:143247212-143247234 CCCCGCACCCCGGCGCTCCAGGG + Exonic
1049616131 8:143576514-143576536 CCCGGTAGCCCAGCTCTCCCAGG + Exonic
1049697434 8:143990868-143990890 CGCCGCTGCCGGCGTCTCCCGGG - Intronic
1049748008 8:144271109-144271131 CCCAGCATCAGGGCTCTCCTGGG + Intronic
1051414285 9:16822186-16822208 CCCCGCAGCCTGCGCCTCCCAGG - Intronic
1054333921 9:63785793-63785815 CACTGCAGCCTTGCTCTCCCAGG + Intergenic
1054905669 9:70412505-70412527 CCCCGCTGCCAGCGTCTCCCAGG + Intronic
1055150307 9:72989985-72990007 CACCGCAGCCTTGCTCTCCCAGG - Intronic
1056605990 9:88085275-88085297 CCCAGCAGCCGGGGTGTCCAAGG + Intergenic
1056963117 9:91143883-91143905 CCCTGCTGCCTGGCTCTCCCTGG - Intergenic
1057268890 9:93636134-93636156 CCCAGAAGCTGGGGTCTCCCAGG - Intronic
1057361198 9:94374923-94374945 CCCCGCGCCCGCGCTCACCCAGG - Exonic
1057662165 9:97013241-97013263 CCCCGCGCCCGCGCTCACCCAGG + Exonic
1059095624 9:111410590-111410612 CACCGCAGCCTGGACCTCCCAGG + Intronic
1059850298 9:118330767-118330789 CACTGCAGCCTTGCTCTCCCAGG + Intergenic
1060892900 9:127199626-127199648 CCTGGCAGACAGGCTCTCCCAGG - Intronic
1060970011 9:127732496-127732518 CCCAGGGGCCAGGCTCTCCCGGG - Intronic
1061422590 9:130480307-130480329 CCACCCAGCTGGGCTGTCCCAGG - Intronic
1061623006 9:131823948-131823970 CGCCGGCGCCGGGCTCTCCGCGG - Intergenic
1061806930 9:133141936-133141958 CCCTGCAGCCGTGGGCTCCCTGG - Intronic
1061883281 9:133578577-133578599 CCCTGCAGCAAGGCCCTCCCTGG - Exonic
1061949486 9:133928370-133928392 CCCCTGCGCCGGGCTCTGCCGGG + Intronic
1061957980 9:133973476-133973498 CCCTGGAGGTGGGCTCTCCCCGG + Intronic
1062031658 9:134364686-134364708 CCCCTAAGCTGGGCTCTTCCGGG + Intronic
1062444786 9:136589032-136589054 CCCAGCAGCTGGGCTCCCTCGGG - Intergenic
1062476058 9:136728077-136728099 CCCTGCAGCCTCGCTCTCGCTGG - Intergenic
1062516099 9:136937260-136937282 CCCTGCAGCCGTGGCCTCCCAGG + Intronic
1062596661 9:137302667-137302689 CCCCGAGGGCGGCCTCTCCCGGG + Intergenic
1185477561 X:424544-424566 CACCGCACCCGGCCCCTCCCAGG - Intergenic
1185641904 X:1593004-1593026 GCCTGCAGCTGTGCTCTCCCTGG + Intronic
1185727931 X:2437526-2437548 CACTGCAGCCTTGCTCTCCCAGG - Intronic
1187318886 X:18222912-18222934 CACTGCAGCCTGGATCTCCCGGG + Intergenic
1188003696 X:25003462-25003484 ACGCGCACCTGGGCTCTCCCGGG - Intergenic
1188141744 X:26558898-26558920 CCCCGCTGCCCCGCTTTCCCTGG - Intergenic
1189317325 X:40065225-40065247 CCCAGCAGCCTGGGTCTGCCTGG - Intronic
1189471159 X:41315295-41315317 CCCCGACGCCGCTCTCTCCCAGG + Intergenic
1190193013 X:48293298-48293320 CACTGCAGCCCGGATCTCCCAGG - Intergenic
1190665753 X:52694693-52694715 CACTGCAGCCTGGATCTCCCAGG - Intronic
1190673665 X:52763717-52763739 CACTGCAGCCTGGATCTCCCAGG + Intronic
1190677207 X:52792507-52792529 CACTGCAGCCTGGATCTCCCAGG + Intergenic
1191059568 X:56280307-56280329 CACTGCAGCCTTGCTCTCCCAGG + Intronic
1193473425 X:81934402-81934424 CCCTGCAGCAGGCCTCTGCCTGG - Intergenic
1194049633 X:89053163-89053185 CCCTGCAGCTGGCTTCTCCCTGG + Intergenic
1195443367 X:104922065-104922087 GCCCACAGCCAGGCTCTCCAAGG - Intronic
1198530614 X:137547428-137547450 TCCGGCAGCCGCGCTCTCCCCGG - Intergenic
1198667909 X:139045023-139045045 CCCTGCAGCAGGCTTCTCCCTGG + Intronic
1198846906 X:140922434-140922456 CACCGCACCCGGCTTCTCCCAGG - Intergenic
1199091812 X:143701893-143701915 CCCTGCAGCAGCGCTTTCCCAGG - Intergenic
1200122201 X:153796426-153796448 CCCCGCAGCCGAGGCCTGCCTGG + Exonic
1200795038 Y:7333277-7333299 CACCGCAGCCTGGAACTCCCAGG + Intergenic