ID: 902770069

View in Genome Browser
Species Human (GRCh38)
Location 1:18640789-18640811
Sequence CAGTGCGACCAGAGGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 240}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902770063_902770069 9 Left 902770063 1:18640757-18640779 CCGGCTTTAGGCAGCGCTCGGCG 0: 1
1: 0
2: 1
3: 3
4: 27
Right 902770069 1:18640789-18640811 CAGTGCGACCAGAGGGAGAGAGG 0: 1
1: 0
2: 2
3: 23
4: 240
902770062_902770069 10 Left 902770062 1:18640756-18640778 CCCGGCTTTAGGCAGCGCTCGGC 0: 1
1: 0
2: 0
3: 5
4: 57
Right 902770069 1:18640789-18640811 CAGTGCGACCAGAGGGAGAGAGG 0: 1
1: 0
2: 2
3: 23
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902770069 Original CRISPR CAGTGCGACCAGAGGGAGAG AGG Intronic
900710481 1:4110096-4110118 CAGTGCGACCAAGTGGAGTGGGG + Intergenic
902511436 1:16969049-16969071 CAGTGGGAGCAGAGGTATAGAGG + Intronic
902770069 1:18640789-18640811 CAGTGCGACCAGAGGGAGAGAGG + Intronic
903101795 1:21036108-21036130 CAGGACGACCAAAGGCAGAGAGG + Intronic
904568890 1:31445733-31445755 CATTGAGACCAGAGGGAAAGAGG - Intergenic
904719933 1:32500412-32500434 CAGCGCGGGCAGAGGGCGAGAGG + Intronic
905008621 1:34731250-34731272 CAGAGGGAACAGTGGGAGAGAGG - Intronic
907861413 1:58357243-58357265 CAGTGAGAACAGAGGGAAATGGG + Intronic
907943394 1:59110258-59110280 CAGTGGGAGCAAAGGGACAGAGG - Intergenic
911613154 1:99979244-99979266 CAGAGCAACCAGATGGAGTGAGG - Intronic
911803318 1:102173494-102173516 GAGAGAGAACAGAGGGAGAGAGG - Intergenic
913594959 1:120366455-120366477 CAGTGTGACTACAGGGACAGAGG - Intergenic
914092309 1:144512531-144512553 CAGTGTGACTACAGGGACAGAGG + Intergenic
914306222 1:146421339-146421361 CAGTGTGACTACAGGGACAGAGG - Intergenic
914334392 1:146701365-146701387 CGGAGGGAGCAGAGGGAGAGTGG - Intergenic
914595828 1:149151469-149151491 CAGTGTGACTACAGGGACAGAGG + Intergenic
914845211 1:151280134-151280156 CATTGCGACCATAGGGCAAGTGG + Exonic
915561171 1:156689161-156689183 AACTGCCACCAGAGGGAGTGAGG + Intergenic
916929130 1:169556680-169556702 CTGTGGGCCCAGAGGGAAAGTGG - Exonic
917203905 1:172547899-172547921 GAGAGGGAACAGAGGGAGAGAGG + Intronic
917494907 1:175531546-175531568 CAGAGGGACCCGAGGGAGAGGGG + Intronic
917522924 1:175762953-175762975 CAGTGCCTTCAGAGGGAGCGTGG + Intergenic
918818645 1:189225027-189225049 GAGGGAGACGAGAGGGAGAGAGG - Intergenic
919972998 1:202592773-202592795 CCTTGGGACCAAAGGGAGAGGGG + Exonic
920186236 1:204161159-204161181 CAGTGGGCACAGAGGCAGAGAGG + Intronic
922022122 1:221716007-221716029 CAGGGAGAGAAGAGGGAGAGGGG - Intronic
923843321 1:237698655-237698677 CAGTGAGATGGGAGGGAGAGGGG + Intronic
923933136 1:238726510-238726532 CAGTGACACCAGAGGAAGGGAGG + Intergenic
924256474 1:242188190-242188212 CAGAGCGGCAAGAGGGAGGGCGG + Intronic
924821764 1:247498899-247498921 CAGTCCCACCAGAGGGTGATGGG + Intergenic
1062794822 10:336762-336784 CAGTGGGACAAGAGGTGGAGGGG + Intronic
1064125866 10:12659349-12659371 GAGTGAGACCAGAGGGAGTTGGG + Intronic
1066550710 10:36553263-36553285 CAGTGTGATCAGAGGCAGGGTGG + Intergenic
1067337934 10:45379432-45379454 CTGTGAGGACAGAGGGAGAGTGG - Intronic
1069620548 10:69834836-69834858 CAGTTCGTCCAGAGGGAGAGGGG + Intronic
1069639230 10:69944156-69944178 CAGCGGGACCAAAGGGCGAGAGG + Exonic
1070786538 10:79165413-79165435 CAGAGCTTCCAGAGGGAGGGAGG + Intronic
1073388737 10:103153189-103153211 CAGTGCTACCAGTCCGAGAGTGG - Intronic
1075388984 10:122078571-122078593 CAGTGCCCCCAGAGGGTGAAAGG + Intronic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1077474851 11:2781515-2781537 CAGTGGGGCCAGAGGGGGAGTGG - Intronic
1077485001 11:2834597-2834619 CTGTGCGAGCAGAGGCAGGGAGG + Intronic
1079082970 11:17427090-17427112 CAGTGCGGCTAGAAGGAGCGAGG + Exonic
1080459380 11:32439650-32439672 CACTGCGAACTGGGGGAGAGGGG - Intergenic
1081380380 11:42407510-42407532 CAGCGCCACCAGCAGGAGAGTGG + Intergenic
1083831874 11:65238628-65238650 GAGGGAGACCAGAGGGGGAGGGG - Intergenic
1083857282 11:65399528-65399550 GTGTGCGACCGGAGGGAGAAGGG - Intronic
1084747651 11:71183596-71183618 CCATGGGAGCAGAGGGAGAGTGG - Intronic
1087214575 11:95481794-95481816 GAGGGAGACAAGAGGGAGAGGGG - Intergenic
1090309359 11:125721155-125721177 CTGTGGGAGCACAGGGAGAGAGG - Intergenic
1090857551 11:130623529-130623551 CAGTCCTTCCAGGGGGAGAGAGG + Intergenic
1090873207 11:130766307-130766329 CAGGGCGAACAAAGGAAGAGAGG - Intergenic
1092524247 12:9299717-9299739 TAGTGAAACCACAGGGAGAGGGG + Intergenic
1092543016 12:9432095-9432117 TAGTGAAACCACAGGGAGAGGGG - Intergenic
1092899431 12:13044600-13044622 CTGTGCCACCAGAGGGCGAGAGG + Intronic
1093081806 12:14821360-14821382 CAGAGCCCCCAGAGGGAGAGAGG - Intronic
1094161875 12:27399237-27399259 CAGTGAGAACTGAGAGAGAGCGG - Intronic
1094510001 12:31090343-31090365 TAGTGAAACCACAGGGAGAGGGG + Intronic
1096815934 12:54201726-54201748 CAGGGTCACCAGATGGAGAGCGG - Intergenic
1098389710 12:69956605-69956627 CTGGGCAAGCAGAGGGAGAGAGG - Intronic
1101525307 12:105523211-105523233 AAGTGGGAACAGAGGGAGGGAGG + Intergenic
1103370332 12:120414446-120414468 GAGAGAGACCAGAGGGAGAGGGG + Intergenic
1104757661 12:131279154-131279176 CAGTGTGGGGAGAGGGAGAGGGG + Intergenic
1104984091 12:132586987-132587009 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984115 12:132587074-132587096 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984154 12:132587231-132587253 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1109851846 13:68075750-68075772 CAGTGCCAGTAGAGGGTGAGAGG - Intergenic
1110980399 13:81890016-81890038 CAGTGCCAGCAGAGGGCAAGAGG - Intergenic
1113126107 13:106981481-106981503 CAGTGGGCTCAGGGGGAGAGGGG - Intergenic
1114693582 14:24607105-24607127 CAGAAAGACCACAGGGAGAGAGG - Intronic
1120489464 14:85158367-85158389 CCATGTGACCAGAGGGGGAGAGG + Intergenic
1125436765 15:39654023-39654045 CAGTGGGACAAGATGTAGAGTGG - Intronic
1126872304 15:53002611-53002633 AAGTGGTACCAGAAGGAGAGTGG - Intergenic
1128314740 15:66653499-66653521 CAGGGTGATCAGAGGGGGAGGGG + Intronic
1132028238 15:98420728-98420750 CATAGGGACCAGATGGAGAGGGG - Intergenic
1133917188 16:10119778-10119800 CAGTGCGAACACAGGGACATAGG - Intronic
1134008631 16:10834992-10835014 CAGTGAGAGCTGAGGAAGAGGGG - Intergenic
1136096744 16:27962431-27962453 CAGTGGGACAACAGAGAGAGTGG + Intronic
1137599040 16:49743777-49743799 CACTGCGACTGGAGGGAGAGGGG - Intronic
1139492064 16:67291521-67291543 CAGTGTGAGGAGGGGGAGAGGGG + Intronic
1139999225 16:71009867-71009889 CGGAGGGAGCAGAGGGAGAGTGG + Intronic
1140808175 16:78552783-78552805 CAGAGAGAACAGAGGGAGAAAGG - Intronic
1141883730 16:86877717-86877739 CAGAGAGACCAGAGAGAGAGAGG - Intergenic
1142220782 16:88853940-88853962 CAGTGTGACCAGTTGGAGAGTGG + Intronic
1142615947 17:1135181-1135203 CAGAGTGAGCAGAGGGGGAGAGG + Intronic
1143272037 17:5683049-5683071 CAGAGGGACAGGAGGGAGAGGGG - Intergenic
1145999927 17:29124979-29125001 GACTGCGGCCAGAGGCAGAGTGG - Intronic
1146052931 17:29567189-29567211 AAGTGGGAGCAGAGGGTGAGAGG + Intronic
1146430991 17:32794729-32794751 CAGAGAGAGCATAGGGAGAGAGG + Intronic
1147127107 17:38378670-38378692 CAGTGCTCCCAAATGGAGAGAGG - Intronic
1148743886 17:49907871-49907893 CACTGTGCCCAGAAGGAGAGAGG - Intergenic
1152497320 17:80682630-80682652 CAGGGCCTCCAGAGGGAGCGTGG + Intronic
1154484787 18:14865063-14865085 AAGTGTGGCCAGAGGGAGTGGGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155909537 18:31492541-31492563 AGATGCTACCAGAGGGAGAGGGG + Intergenic
1156513086 18:37657827-37657849 CACTGGGAACACAGGGAGAGTGG + Intergenic
1156914961 18:42454702-42454724 CATTGCTGCCTGAGGGAGAGAGG - Intergenic
1157311458 18:46556482-46556504 CAATGAGAGAAGAGGGAGAGAGG + Intronic
1160297880 18:77654580-77654602 CTGTGTGATGAGAGGGAGAGCGG - Intergenic
1160940515 19:1618519-1618541 CAGAGTGAGGAGAGGGAGAGAGG - Intronic
1160969700 19:1762145-1762167 CACTGCGTCCAGGGGGAGATGGG - Intronic
1162071960 19:8158204-8158226 GGATGAGACCAGAGGGAGAGAGG - Intronic
1163116440 19:15191717-15191739 CACTGCGGCCAGAGGGAGCGGGG - Intronic
1163411019 19:17154536-17154558 CAGTGCCGCCATAGGGAGTGTGG + Intronic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1165757232 19:38300999-38301021 CAGAGAGAGCAGAAGGAGAGAGG - Intronic
1167574856 19:50313036-50313058 CCGTGGGAGCAGAGGGAGGGAGG + Intronic
1168596890 19:57684584-57684606 CAATGGGACCATAAGGAGAGAGG + Intronic
925302774 2:2828792-2828814 CAGGCAGACCAGAGGGAGACAGG + Intergenic
925423354 2:3729228-3729250 GCCTGAGACCAGAGGGAGAGTGG + Intronic
927172123 2:20379181-20379203 TAGTGGGCCCAGAGGGACAGAGG - Intergenic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
929087711 2:38184605-38184627 CAGTGTGCCCAGAGAGAGAGTGG + Intergenic
929568634 2:43006210-43006232 CAGAGAGGCCAGAGGCAGAGGGG - Intergenic
930886518 2:56332691-56332713 CAGGGAGAGAAGAGGGAGAGAGG - Intronic
932106291 2:68945752-68945774 CAGAGCAACCAGAGTGAAAGAGG - Intronic
932321357 2:70824097-70824119 CAGAGCCAGGAGAGGGAGAGAGG + Intergenic
932336075 2:70932128-70932150 CAGAGAGAACAAAGGGAGAGAGG + Intronic
932582982 2:73004628-73004650 CTGGGAGACCAGAGGGAGTGTGG + Intronic
932765269 2:74465197-74465219 CAGTGCCGGCAGAGGGAGTGCGG - Exonic
933346268 2:81089500-81089522 CACTGCCAACAGAGGAAGAGAGG - Intergenic
933759391 2:85663572-85663594 CAGTGGGACCACAGAGGGAGAGG + Intronic
937997912 2:127708928-127708950 CAGTGTGACCAGAAGTAGATGGG + Intronic
939114560 2:138045485-138045507 CAGTCTGAAAAGAGGGAGAGTGG - Intergenic
939996682 2:148926593-148926615 CACCGCGACCACAGGCAGAGGGG - Intronic
941683884 2:168428119-168428141 CAGGGAGACCTGGGGGAGAGGGG + Intergenic
943484784 2:188465539-188465561 CAGTGTGGGCTGAGGGAGAGAGG - Intronic
946391543 2:219419408-219419430 CAGTGTAGCCAGAGGGAGAAGGG + Intronic
946443223 2:219714587-219714609 CAGTGCCACCACAGGCATAGTGG - Intergenic
946609954 2:221447461-221447483 CAGTGCAACCAGAGAGGCAGCGG + Intronic
947704723 2:232264957-232264979 CAGGGAGACAAGAGGCAGAGCGG + Intronic
947712415 2:232323694-232323716 CAGTGCGCGCAGGAGGAGAGGGG + Intronic
947719802 2:232363509-232363531 CAGTGCACCCAGGAGGAGAGGGG + Intergenic
947731374 2:232433374-232433396 CAGTGTGCCCAGGAGGAGAGGGG + Intergenic
1170341135 20:15328280-15328302 CACTGTGGCCAGAGGGAGAGAGG + Intronic
1170654695 20:18275704-18275726 CAGTTCAGCCAGAGGGTGAGTGG + Intergenic
1170745752 20:19097583-19097605 CAGAGTGAGAAGAGGGAGAGGGG + Intergenic
1172184741 20:33024331-33024353 CAGTGTGACCAGAAGGGCAGAGG - Intergenic
1172222906 20:33285998-33286020 CAGAGGGACCTGAGGCAGAGGGG - Intronic
1173078831 20:39846672-39846694 CATTGGGAGCAGAGGGAGAAAGG - Intergenic
1174122957 20:48280776-48280798 AAGTGAGACCAGAGGGCTAGGGG - Intergenic
1174850060 20:53985299-53985321 CAGTTTGCCCAGAGGCAGAGAGG + Exonic
1175379980 20:58556231-58556253 CAGTGAGAGCAGAGGGCCAGAGG + Intergenic
1175760937 20:61561956-61561978 CAGGGCTCCCAGAGAGAGAGAGG + Intronic
1175761012 20:61562192-61562214 CAGGGCTCCCAGAGAGAGAGAGG + Intronic
1176653034 21:9567076-9567098 CAATGCTACTAGAGGGGGAGGGG + Intergenic
1176796538 21:13374412-13374434 AAGTGTGGCCAGAGGGAGTGGGG + Intergenic
1177384068 21:20386112-20386134 CAGTCCCACCTAAGGGAGAGGGG - Intergenic
1178785404 21:35648842-35648864 AAGTGAGATCAGAGGGAGAATGG - Intronic
1179016669 21:37600020-37600042 CGATGCCTCCAGAGGGAGAGGGG - Intergenic
1179128244 21:38611447-38611469 CAGGGCGGCCAGATGGAGAGAGG - Intronic
1180862111 22:19089491-19089513 CTGTGGGACCAAAGGGTGAGAGG + Intronic
1181148040 22:20862645-20862667 CAGTGAGAGCTGAGGCAGAGTGG + Intronic
1183500221 22:38174442-38174464 GAGTGGGAACAGAGGGAGATTGG + Intronic
1183543032 22:38440926-38440948 CCGAGCCTCCAGAGGGAGAGTGG + Intronic
1183623139 22:38986492-38986514 CAGTGGGTCAAGAGGGAGGGCGG - Intronic
1183656666 22:39189654-39189676 CAGAGCGACCACAGACAGAGTGG + Intergenic
950458104 3:13104636-13104658 CAGGGCCACCGGAGGGGGAGAGG - Intergenic
952086501 3:29828248-29828270 AAGAGCCACCAGACGGAGAGAGG - Intronic
952682988 3:36117303-36117325 CAATGTGATCAGAGGGAAAGAGG + Intergenic
953435162 3:42872068-42872090 CAGTGCTACAAGAGGGTGAGGGG - Intronic
953878636 3:46680369-46680391 CAGTGCCCCCAGCGGGAGTGGGG + Intronic
954652088 3:52171290-52171312 CAGTGGAAGCAGAGGCAGAGAGG - Intergenic
954673837 3:52304905-52304927 CAGTGCTGCCAGGAGGAGAGAGG + Intergenic
957512157 3:81203046-81203068 GAGAGCGAGCAGAGGGAGAGAGG + Intergenic
957717422 3:83946752-83946774 TAGTGCCTCCAGAGGGAGTGTGG + Intergenic
959950545 3:112175578-112175600 CAGAGCGCCCAGAGGGAGGGTGG - Intronic
961504022 3:127358271-127358293 CAGTGCCAGCAGAGGAACAGAGG - Intergenic
963297550 3:143562385-143562407 CAGTAAGAGCAAAGGGAGAGAGG + Intronic
963399667 3:144781935-144781957 CAGAGAGACCTGAGGGAGAGTGG + Intergenic
965379760 3:167973943-167973965 CAGTGGGAGCAGAGGATGAGTGG - Intergenic
967672160 3:192249719-192249741 AAGTGCCACCAGAGGAAGAGAGG - Intronic
968472287 4:787663-787685 CAGAGCCTCCAGAGGGAGTGTGG + Intronic
968538649 4:1151022-1151044 CAGGGCAACCAGATGCAGAGAGG - Intergenic
969484844 4:7466555-7466577 CACTGCAGCCAGAGGGAGAATGG - Intronic
972551960 4:40142113-40142135 GAGGGAGACCATAGGGAGAGGGG + Intronic
972710747 4:41592074-41592096 CAGTGCTATCAGAGGGAGAAGGG - Intronic
975159470 4:71109383-71109405 CACTTCAACCAAAGGGAGAGAGG + Intergenic
975632782 4:76419519-76419541 CAGAGCCTCCAGAGGGAGGGAGG - Intronic
977570142 4:98620711-98620733 CACTGCAATCAGAGGGAGTGTGG + Intronic
977747647 4:100569468-100569490 CAGGGCAAGCAGAGGGAGATGGG - Intronic
979987585 4:127333983-127334005 CAGTGCAAACAGAGGAAGGGAGG - Intergenic
980243227 4:130203234-130203256 CAGTGCAACCAGCTGCAGAGAGG + Intergenic
980707480 4:136519154-136519176 CATGGTGACGAGAGGGAGAGGGG + Intergenic
981195904 4:141920110-141920132 CAGTGGGACCACAGGGAGTGGGG - Intergenic
982235332 4:153246874-153246896 CAAGGCCACCAGAGGCAGAGGGG - Intronic
983538050 4:168878427-168878449 CAGGGCGACCCGAGGCGGAGGGG - Intronic
984097431 4:175449624-175449646 CAGCTGGACCAGAGGGAGAAAGG + Intergenic
985937195 5:3106425-3106447 GAGGGAGAGCAGAGGGAGAGGGG - Intergenic
986161869 5:5237478-5237500 CAGAACGCCCAGAGGGAAAGTGG + Intronic
988102860 5:26704736-26704758 CAGTGGGACAAGAGGGAGAGGGG + Intergenic
988935915 5:36082946-36082968 CAGAGCTCCCAGAGGGACAGTGG + Intergenic
990257410 5:53985219-53985241 GAGTGTGAGCAGAGGGAGTGAGG - Intronic
991950889 5:71945946-71945968 CAGTGTGGCCACAAGGAGAGGGG + Intergenic
992778520 5:80108143-80108165 CAGTAGGGCAAGAGGGAGAGAGG + Intergenic
995551414 5:113285499-113285521 CAGAGTGAGCAGGGGGAGAGTGG - Intronic
996009442 5:118465765-118465787 AAGTTCTACAAGAGGGAGAGAGG + Intergenic
996813861 5:127551856-127551878 CAGTGCAGCCAGAGCGATAGCGG + Exonic
999250437 5:150179405-150179427 GAGTGAGACCAGATGGAGATAGG - Intronic
1000103598 5:158037974-158037996 CAGTGGCATCAGAGGGAGACCGG + Intergenic
1000920078 5:167127956-167127978 CAGTGGGGCCACAGGGTGAGGGG - Intergenic
1001083499 5:168683936-168683958 CAGTGGGTCAGGAGGGAGAGAGG + Intronic
1001289798 5:170448718-170448740 CACTACAACCAGAGGGAAAGAGG - Intronic
1001492206 5:172163885-172163907 CACTGTGGCCAGAGGGAGCGCGG - Intronic
1001572908 5:172742231-172742253 CAGTGTTACCAGAGTGAGTGGGG - Intergenic
1001942642 5:175751450-175751472 GAATGTAACCAGAGGGAGAGTGG + Intergenic
1002546211 5:179947006-179947028 CAGTGCATCCTCAGGGAGAGAGG - Intronic
1002634085 5:180598591-180598613 CAGAGCGGCCACAGAGAGAGAGG - Intergenic
1004372844 6:15067356-15067378 CAGAGCCACCAAAGGCAGAGAGG + Intergenic
1007282068 6:40720222-40720244 CAGTGTGATCACAGAGAGAGAGG + Intergenic
1007820138 6:44555010-44555032 CACTGAGATCAGAGGAAGAGAGG + Intergenic
1011541202 6:88432125-88432147 CAGTAGGAGCAGAGGCAGAGAGG - Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015354033 6:132255899-132255921 CAGGGCGTGGAGAGGGAGAGAGG - Intergenic
1017083677 6:150693543-150693565 CAGTGTGACCAAAGAGAGGGTGG - Intronic
1018475390 6:164135263-164135285 CACAGCGTGCAGAGGGAGAGTGG - Intergenic
1019098943 6:169611769-169611791 CAGTGGGACCAGATGTGGAGGGG - Intronic
1019175224 6:170156124-170156146 CAGCGGGTCCAGAGGGCGAGGGG + Intergenic
1019193102 6:170265474-170265496 CAGTGAGACCAGATGTGGAGGGG - Intergenic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1020013129 7:4817033-4817055 CTGTGCGACCTGAGGAGGAGCGG + Intronic
1020230957 7:6318091-6318113 CAGTGGCTCTAGAGGGAGAGGGG + Intergenic
1022704243 7:32787860-32787882 CAGGGAGACCAGAGGCAGAGGGG + Intergenic
1022908425 7:34877602-34877624 CAGGGAGACCAGAGGCAGAGGGG + Intronic
1023797790 7:43808203-43808225 CACTGCTGCCACAGGGAGAGGGG - Intergenic
1024028101 7:45431463-45431485 GAGTGGGAGAAGAGGGAGAGGGG + Intergenic
1024268703 7:47626083-47626105 CAGTGAGAGCAGAGAGAGAAAGG + Intergenic
1025279379 7:57615797-57615819 CAATGCTACTAGAGGGGGAGGGG + Intergenic
1025305352 7:57849703-57849725 CAATGCTACTAGAGGGGGAGGGG - Intergenic
1025914423 7:65854309-65854331 TAGTGCCAGCAGACGGAGAGGGG - Intergenic
1026470791 7:70693248-70693270 CAGTGCCCCCAGAGGGTGTGGGG - Intronic
1032794988 7:135269851-135269873 GAGTGGGCCCAGAGGGGGAGGGG + Intergenic
1035566594 8:645171-645193 CAGTGCCAGCCGAGGGAAAGGGG - Intronic
1036684790 8:10902499-10902521 CAGAGGGACCAGACGGAGAAAGG - Intronic
1037796295 8:21998051-21998073 CAGTGGCAACTGAGGGAGAGGGG - Intronic
1038609757 8:29049496-29049518 CAGTGGGGCCAGAGTGAGTGGGG - Intronic
1047346873 8:124037475-124037497 CAGTGGGGACAGAGGGACAGTGG + Intronic
1048899217 8:139021964-139021986 CAGGGCCAGGAGAGGGAGAGGGG + Intergenic
1051919444 9:22247688-22247710 GAGGGGGAACAGAGGGAGAGGGG - Intergenic
1052106864 9:24529391-24529413 TAGTGCCAGCAGAGTGAGAGTGG + Intergenic
1052199484 9:25761078-25761100 CAATGCAACCATAGGGACAGTGG + Intergenic
1052758720 9:32567799-32567821 CAGTCCAAGGAGAGGGAGAGAGG - Exonic
1053292593 9:36891319-36891341 AAGTGCCACCTTAGGGAGAGGGG + Intronic
1055442934 9:76354272-76354294 CAATGGGAGCAGAGGGAGGGGGG + Intronic
1056179195 9:84065131-84065153 CAGTGGGACCAGAGTGGGTGGGG - Intergenic
1057292356 9:93814717-93814739 CAGGGAAACCAGAGAGAGAGAGG - Intergenic
1057870049 9:98709887-98709909 CAGTGCGACCTGGCAGAGAGAGG - Intergenic
1059275781 9:113095867-113095889 CAGTACACCCTGAGGGAGAGAGG - Intergenic
1061091310 9:128428152-128428174 CTGTGGGACCAGAGGGAGAAAGG - Intronic
1061875679 9:133542404-133542426 CAGGGCATGCAGAGGGAGAGTGG + Intronic
1062446979 9:136599225-136599247 TACTGCAACCACAGGGAGAGAGG - Intergenic
1203630763 Un_KI270750v1:70617-70639 CAATGCTACTAGAGGGGGAGGGG + Intergenic
1186302769 X:8218554-8218576 CAGTGCACCCTGAGAGAGAGAGG - Intergenic
1187549753 X:20290377-20290399 CAGTGTGGCCAGTGGGATAGTGG + Intergenic
1188312858 X:28639169-28639191 CATTGCTCCCAGAGGGAGAATGG - Intronic
1190217592 X:48490286-48490308 TTGTGCGCCCACAGGGAGAGAGG - Intergenic
1192120244 X:68448499-68448521 CAGTGAACCCAGAGGTAGAGAGG + Intergenic
1192410736 X:70930465-70930487 CAGACCCCCCAGAGGGAGAGGGG + Intronic
1196441508 X:115723427-115723449 CAGGGCGGGCAGAGGGAGAAGGG + Intergenic
1196445039 X:115841416-115841438 CAGGGCGGGCAGAGGGAGAAGGG + Intergenic
1197770795 X:130087946-130087968 CAGTTTGATTAGAGGGAGAGAGG + Intronic
1198683232 X:139203802-139203824 CCGTGCGTCCAGAGGGGAAGTGG + Intronic
1198921511 X:141733802-141733824 CAGTTAGACCAAAAGGAGAGTGG - Intergenic
1199434827 X:147801800-147801822 CAGGGCCACCAGTGAGAGAGGGG - Intergenic
1201060298 Y:10038360-10038382 CAGTACTTCCAGAGGGAGGGAGG + Intergenic
1202110857 Y:21417902-21417924 AAGTGAGGACAGAGGGAGAGGGG + Intergenic