ID: 902773229

View in Genome Browser
Species Human (GRCh38)
Location 1:18658293-18658315
Sequence CCTCGAAGACACAGCCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 163}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902773229_902773243 19 Left 902773229 1:18658293-18658315 CCATCCTGGCTGTGTCTTCGAGG 0: 1
1: 0
2: 2
3: 18
4: 163
Right 902773243 1:18658335-18658357 CTGGAAGACAGCAAGAGAAGGGG 0: 1
1: 0
2: 4
3: 68
4: 618
902773229_902773236 -9 Left 902773229 1:18658293-18658315 CCATCCTGGCTGTGTCTTCGAGG 0: 1
1: 0
2: 2
3: 18
4: 163
Right 902773236 1:18658307-18658329 TCTTCGAGGGACCCCAGGGTGGG 0: 1
1: 0
2: 2
3: 13
4: 93
902773229_902773235 -10 Left 902773229 1:18658293-18658315 CCATCCTGGCTGTGTCTTCGAGG 0: 1
1: 0
2: 2
3: 18
4: 163
Right 902773235 1:18658306-18658328 GTCTTCGAGGGACCCCAGGGTGG 0: 1
1: 0
2: 0
3: 8
4: 107
902773229_902773242 18 Left 902773229 1:18658293-18658315 CCATCCTGGCTGTGTCTTCGAGG 0: 1
1: 0
2: 2
3: 18
4: 163
Right 902773242 1:18658334-18658356 TCTGGAAGACAGCAAGAGAAGGG 0: 1
1: 0
2: 5
3: 85
4: 620
902773229_902773241 17 Left 902773229 1:18658293-18658315 CCATCCTGGCTGTGTCTTCGAGG 0: 1
1: 0
2: 2
3: 18
4: 163
Right 902773241 1:18658333-18658355 TTCTGGAAGACAGCAAGAGAAGG 0: 1
1: 0
2: 5
3: 47
4: 447
902773229_902773244 20 Left 902773229 1:18658293-18658315 CCATCCTGGCTGTGTCTTCGAGG 0: 1
1: 0
2: 2
3: 18
4: 163
Right 902773244 1:18658336-18658358 TGGAAGACAGCAAGAGAAGGGGG 0: 1
1: 0
2: 4
3: 94
4: 939
902773229_902773237 0 Left 902773229 1:18658293-18658315 CCATCCTGGCTGTGTCTTCGAGG 0: 1
1: 0
2: 2
3: 18
4: 163
Right 902773237 1:18658316-18658338 GACCCCAGGGTGGGTATTTCTGG 0: 1
1: 0
2: 0
3: 11
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902773229 Original CRISPR CCTCGAAGACACAGCCAGGA TGG (reversed) Intronic
900165748 1:1243703-1243725 CCTCGAGTCCACACCCAGGAGGG + Intronic
900343806 1:2201314-2201336 GCTCGAAGGCACAGCCTGGAAGG + Intronic
900429154 1:2593751-2593773 CCGCGGAGAAGCAGCCAGGAAGG - Intronic
900653402 1:3742467-3742489 GCTGGAAGTCACAGCCAGGGTGG - Intergenic
900898592 1:5501743-5501765 CCTCGGAGACAGAGACAGTAAGG - Intergenic
901401784 1:9019625-9019647 CCGTGAAGACACAGCCAGGCTGG + Intronic
901911523 1:12462626-12462648 CCTCGCAGACCCAGGCAGCAGGG - Intronic
902326595 1:15704854-15704876 CCACGAAGGCACAGCCAGCGAGG - Intronic
902629607 1:17696890-17696912 GCTGGTAGCCACAGCCAGGAAGG - Exonic
902703198 1:18186892-18186914 GATCCCAGACACAGCCAGGAAGG - Intronic
902773229 1:18658293-18658315 CCTCGAAGACACAGCCAGGATGG - Intronic
903575750 1:24338576-24338598 CATAGATCACACAGCCAGGAAGG - Intronic
903769632 1:25755764-25755786 CCTAGAAGCTACAGCCAGGGTGG + Intronic
905194916 1:36268525-36268547 CCTGGAGGACACAGCAAGGTGGG - Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
907288247 1:53395949-53395971 CCTCCAGAACCCAGCCAGGAGGG + Intergenic
910277493 1:85464814-85464836 CCACGAAGACGCAGTCCGGAAGG + Exonic
911084066 1:93962006-93962028 CCTGGAAAACACTGCCAGCAAGG - Intergenic
917643153 1:177003152-177003174 CCTTGATGCCAAAGCCAGGAAGG + Intronic
921226962 1:213030183-213030205 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
923047072 1:230363139-230363161 CCTCGCACACACAGGCAAGAAGG + Intronic
1063869755 10:10404812-10404834 CCTAGAATTCACAGCAAGGAAGG + Intergenic
1065420233 10:25535410-25535432 CCTCCAACCCACAGCCAGCAAGG + Intronic
1066546024 10:36501602-36501624 CATTGAAGGCACAGCAAGGATGG - Intergenic
1067687679 10:48476917-48476939 CCAAGATGACACAGCCAGCAAGG - Intronic
1069557240 10:69406468-69406490 CCTGTCAGAGACAGCCAGGAAGG - Intronic
1070791805 10:79194039-79194061 GTTCCAAGACACAGCCAGAAGGG - Intronic
1071467241 10:85952152-85952174 CCTCTAAGAAACAAACAGGAAGG + Intronic
1074412593 10:113241368-113241390 TCTGGAAGACAGAGCCCGGAGGG + Intergenic
1075261502 10:120967272-120967294 CTTGGAAGACAGAGACAGGAGGG - Intergenic
1076103310 10:127800070-127800092 CCTCACAGACACACCCAGGATGG - Intergenic
1076806426 10:132861460-132861482 CCTAAAAGACAGGGCCAGGACGG - Intronic
1078357670 11:10644569-10644591 ACTCCAAGACACAGGCATGATGG - Intronic
1083179100 11:60972774-60972796 CCAGGAAGACCCAGTCAGGAGGG + Intronic
1083750125 11:64756208-64756230 CCCCGAGCACACAGCCAGGCTGG + Intronic
1087911898 11:103763375-103763397 GCCCAAAGACAAAGCCAGGATGG - Intergenic
1089127199 11:116184926-116184948 CCCAGCAGACACAGGCAGGATGG + Intergenic
1093450328 12:19306486-19306508 CATCAAACACACAGCAAGGAGGG - Intronic
1094040222 12:26114307-26114329 CCGCGGAGACGCAGCCGGGAAGG + Intergenic
1097758502 12:63434154-63434176 TCTCGAAGAAACTGCCAAGATGG + Intergenic
1099201050 12:79677682-79677704 CCTCGAAGATACTACCAGGAAGG + Intronic
1100780681 12:98022972-98022994 CCTGGAAGACACAGGAAGGAGGG - Intergenic
1101519526 12:105468596-105468618 CTTAGAAGACAAAGACAGGAAGG - Intergenic
1102559685 12:113753467-113753489 CCTCGAAGAGACAAACAGGGAGG - Intergenic
1104241334 12:126993128-126993150 CCTCACAGACACACCCAGAAAGG - Intergenic
1104241593 12:126994873-126994895 CCTCACAGACACACCCAGAAAGG + Intergenic
1104288651 12:127448021-127448043 CCTAGAAGTGGCAGCCAGGAAGG - Intergenic
1104932720 12:132348260-132348282 CCTTGCAGACACAGACAGGATGG - Intergenic
1106193593 13:27475030-27475052 CCTGGAACACAGACCCAGGAAGG + Intergenic
1108140511 13:47416108-47416130 CCTGGAGGACAGAGCCAGGAGGG + Intergenic
1111243940 13:85509926-85509948 CCTCTCAGACAGAGCCATGAGGG + Intergenic
1112841168 13:103579954-103579976 CCTCAAGGACACAGTCAAGAAGG + Intergenic
1113528325 13:111000283-111000305 CCTCCCTCACACAGCCAGGAAGG - Intergenic
1113740457 13:112709125-112709147 TCCTGAAGACACAGCCAGGAGGG - Intronic
1115346453 14:32348102-32348124 CCTGGAAGACACAGCTGGGTGGG + Intronic
1117711873 14:58538803-58538825 CCTGGACGACAGAGCCAGGCTGG - Intronic
1119397043 14:74334181-74334203 CCTGGAAGCCAAAGCCAAGAAGG + Intronic
1121216224 14:92250504-92250526 CCTTGAAGACTTGGCCAGGAAGG + Intergenic
1121741258 14:96253964-96253986 CCTTGAATACACATCCAGTATGG + Intronic
1123043200 14:105498988-105499010 CCTCCAAGACCCAGCCAGGCTGG - Exonic
1125417164 15:39466007-39466029 CCTCCAAGCCACAGCTAGAAAGG - Intergenic
1128327547 15:66734959-66734981 GCTGGGAGACACAGCCATGAGGG - Intronic
1128771961 15:70289573-70289595 CCTTGAAGAGGCAGCCAGCAGGG + Intergenic
1129683537 15:77671727-77671749 CCTGGAAGTCTCACCCAGGAGGG - Intronic
1131862696 15:96671060-96671082 CCTGGAATTCACAGCCAGAAAGG + Intergenic
1132012032 15:98284579-98284601 CATCTGAGACACAGCCAGGAAGG + Intergenic
1136482859 16:30553469-30553491 CCTCCTAGACCCTGCCAGGAGGG - Intronic
1136776409 16:32874125-32874147 CCTGGAAGACACAGCTTTGAGGG - Intergenic
1136894206 16:33987387-33987409 CCTGGAAGACACAGCTTTGAGGG + Intergenic
1141388465 16:83644852-83644874 CCTCTAAGGCACAGCAAGGCAGG + Intronic
1141752409 16:85967682-85967704 CCTGGGAGAAGCAGCCAGGATGG + Intergenic
1142239451 16:88938535-88938557 GCTCTAAGACCCACCCAGGAAGG + Intronic
1203078824 16_KI270728v1_random:1136234-1136256 CCTGGAAGACACAGCTTTGAGGG - Intergenic
1143112577 17:4560560-4560582 CCTCTGAGACACAGCCGGAAAGG - Exonic
1143294921 17:5863771-5863793 CCTCCAAGACACTGACAAGACGG - Intronic
1144388953 17:14776041-14776063 TCTGAAGGACACAGCCAGGATGG + Intergenic
1145840922 17:27993650-27993672 CCTTGGAGACACCTCCAGGAAGG + Intergenic
1147847830 17:43417681-43417703 GCGCGAAGACAGAGCCAGGGAGG - Intergenic
1150523675 17:65897977-65897999 CCTGGAAGCCACAGCAAAGAGGG - Intronic
1151241068 17:72758268-72758290 TCTGGAAGACACAGTCAAGAAGG + Intronic
1151320312 17:73348846-73348868 CCTGGAAGGCAGACCCAGGAAGG - Intronic
1151326855 17:73385032-73385054 CCTTGAAGACAAAGCCAGGAGGG - Intronic
1152200714 17:78944375-78944397 CTTGGGAGACACAGCCAGGCTGG + Intergenic
1152653375 17:81507285-81507307 CCTGGATGACAGAGCCAGGATGG + Intergenic
1153768216 18:8394876-8394898 CATGGAAGGCACTGCCAGGAAGG - Intronic
1157327829 18:46681555-46681577 CCTCCTGGACACAGCCAGGTAGG + Intronic
1157740314 18:50087157-50087179 CCTTAAAGCCACAGCCAGGTAGG + Intronic
1159559537 18:69978747-69978769 CCTCACAGACACACCCAGGATGG + Intergenic
1160397658 18:78583984-78584006 CCTGGAAGACTCACGCAGGAGGG + Intergenic
1160477408 18:79204740-79204762 CCCTGCAGACACAGCCTGGATGG - Intronic
1160981225 19:1817487-1817509 CCAAGAAGACACAGGGAGGACGG + Intronic
1161019241 19:2000236-2000258 CCTTGAGGACGCGGCCAGGAGGG - Intronic
1164604671 19:29589222-29589244 CCTGGTACACAGAGCCAGGATGG - Intergenic
1164767274 19:30781613-30781635 CCTGCAAAGCACAGCCAGGATGG + Intergenic
1165118412 19:33543490-33543512 ACTCAAGGACACAGCAAGGATGG + Intergenic
1165394497 19:35557032-35557054 CGTCGAAGGCATAGCCAGGCGGG + Exonic
1167728348 19:51234640-51234662 CCTAGAAGGCACAGCCAGGCAGG + Intronic
1168189510 19:54727487-54727509 ACACGGAGACACAGACAGGAAGG + Intronic
925247956 2:2401528-2401550 CCTCCAAACCACAGACAGGAAGG + Intergenic
926987207 2:18638273-18638295 CCTCACAGACACACCCAGGAAGG - Intergenic
928082811 2:28325720-28325742 CCTCAAACACCCAGCCAGGGGGG + Intronic
928241574 2:29591387-29591409 CCGGGCAGCCACAGCCAGGATGG + Intronic
933763586 2:85692487-85692509 CCACCAACACACAGCTAGGAAGG - Intronic
935622640 2:105143423-105143445 CCTCGCAGGCCCAGGCAGGATGG + Intergenic
936058546 2:109279772-109279794 CCTCGCTGACAGAGCCAGGCCGG + Intronic
936842995 2:116796329-116796351 CCTCTAGAACACAGCCAAGAAGG - Intergenic
946248704 2:218400692-218400714 CCTCGGAGGCACAGAGAGGACGG + Intronic
947640285 2:231703807-231703829 CCTCTAAGAAACAGAGAGGACGG - Intergenic
948146019 2:235708557-235708579 CACTGAAGACCCAGCCAGGATGG - Intronic
1169189710 20:3650465-3650487 TCCTGAGGACACAGCCAGGACGG + Exonic
1170858969 20:20085020-20085042 CCTCCAAGACACATTCAGAATGG + Intronic
1173494203 20:43507392-43507414 GCTCGAAGAGAGAGCCTGGAGGG - Intergenic
1179091322 21:38268704-38268726 CCTGGAATTCACATCCAGGAAGG - Intronic
1180745139 22:18083320-18083342 GCTCGAGGACACAGTGAGGAGGG + Intronic
1180755435 22:18157704-18157726 CTGCGAGGACTCAGCCAGGATGG - Exonic
1183056171 22:35307530-35307552 CCTGGGGGACACAGCCGGGAAGG - Intronic
1183338356 22:37264089-37264111 CACCGAGGCCACAGCCAGGAAGG + Intergenic
1183746853 22:39697170-39697192 AAGGGAAGACACAGCCAGGAGGG - Intergenic
1184349684 22:43935618-43935640 CCTGTAGGACACAGACAGGATGG + Intronic
1185137549 22:49081278-49081300 GCTAGGAGACAGAGCCAGGAAGG + Intergenic
952946330 3:38479933-38479955 CCTCGGACACACAGCAAGCAGGG - Intronic
953186674 3:40644077-40644099 CCAAGATGACACAGCCAGTAAGG - Intergenic
956878993 3:73491314-73491336 CATGGAAGATGCAGCCAGGAGGG + Intronic
957007238 3:74963789-74963811 GCTCGATGACACAGACAGAAGGG - Intergenic
959481098 3:106873543-106873565 GCTCCCAGACACAGCCAGGAAGG - Intergenic
959849743 3:111072036-111072058 CCTCCAGGACACAGCGGGGACGG - Exonic
962381472 3:134901619-134901641 CCTCTAAGCTACAGCCAGCAGGG + Intronic
963482756 3:145897198-145897220 CCTTGAAGACAGAGCCCGGCAGG + Intergenic
963590692 3:147254349-147254371 CCTGGAAGTCAGAGTCAGGAGGG - Intergenic
964542148 3:157791311-157791333 CCTCATAGAGACAGGCAGGAAGG + Intergenic
969603814 4:8191912-8191934 CCTGGAAAACACAGCCCGGCCGG - Intronic
971512615 4:27445917-27445939 TCTGGAAGACAAAGCCAGGGCGG + Intergenic
976117931 4:81748034-81748056 CCTCCAAGAAGCAGCCAAGATGG - Intronic
976405816 4:84659564-84659586 CCTAGCAGACAGATCCAGGAGGG - Intergenic
977961372 4:103088881-103088903 CTTCTAAGACACAGCAAGGTGGG + Intronic
979078661 4:116306227-116306249 CCACAAAGTGACAGCCAGGAGGG + Intergenic
980091495 4:128447633-128447655 GGTGGAAGACACAGCCAGCATGG + Intergenic
980807455 4:137831821-137831843 CCTGGCAGACTCTGCCAGGAAGG - Intergenic
980878509 4:138686261-138686283 CCTGGAAGGCACAGGGAGGACGG + Intergenic
980888626 4:138790043-138790065 CATTGACCACACAGCCAGGATGG + Intergenic
982335417 4:154231710-154231732 TCTAGAAAACACAGCAAGGAGGG + Intergenic
982419981 4:155183439-155183461 ACTCCAAGAGACAGCCTGGAAGG + Intergenic
984956301 4:185049421-185049443 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
986216838 5:5727204-5727226 CCTCCAAGAGACAGCCAGTGAGG + Intergenic
986758043 5:10855958-10855980 CCTCGGAGGCACAGAGAGGATGG - Intergenic
987550407 5:19372734-19372756 CCTGGAAGACTCAGCCAGTCTGG - Intergenic
990767122 5:59196465-59196487 CCTATATGACACAGCCAGAAGGG - Intronic
991630100 5:68648027-68648049 CCTCAAAGAAACAGCTAGAAAGG + Intergenic
999933500 5:156459466-156459488 CCTCCAAGACACAGGCAAAATGG - Intronic
1001798631 5:174524040-174524062 CCTAGAAGAGGCAGACAGGAGGG - Intergenic
1002200247 5:177524033-177524055 CTAGGAAGACACAGCCAGGAGGG + Intronic
1002382705 5:178841586-178841608 GCTCGAAGACAGAGCCAGTGGGG - Intergenic
1006294438 6:33163804-33163826 CCCTGAAGACACAGCAAGGCCGG - Exonic
1010716133 6:79232679-79232701 CCTTGAATAAACAGCAAGGAAGG + Intronic
1014559287 6:122871493-122871515 CGTCACAGACACACCCAGGAAGG + Intergenic
1017006381 6:150030526-150030548 CCCAGAAGCCACAGGCAGGATGG - Intergenic
1023795437 7:43788245-43788267 ACTGGAAGACAGAGGCAGGAGGG + Intronic
1023856774 7:44188929-44188951 GCTGGACGACAGAGCCAGGATGG - Intronic
1024269996 7:47635104-47635126 CCCAGACGACACAGCTAGGACGG + Intergenic
1026954983 7:74371490-74371512 ACTGGAACACACTGCCAGGAGGG + Intronic
1028433724 7:90777739-90777761 CTTCCAAGAGACTGCCAGGATGG + Intronic
1029460365 7:100690881-100690903 CAGCCAAGACACAGCCAGGATGG - Intergenic
1032164273 7:129533369-129533391 CTTCACAGACACACCCAGGAGGG - Intergenic
1035091754 7:156318876-156318898 CATGGAGCACACAGCCAGGAAGG + Intergenic
1035909311 8:3548453-3548475 CCTCGAGGACTCAGGCAGAAAGG - Intronic
1038951479 8:32419966-32419988 CCACAAAAACACAGCCGGGATGG + Intronic
1042982453 8:74545861-74545883 TCTCTAAGACTCAGCCATGAAGG - Intergenic
1047521567 8:125599049-125599071 CTGCGTAGACACGGCCAGGATGG - Intergenic
1047735410 8:127760912-127760934 CCTCCAGGGCAGAGCCAGGATGG - Intergenic
1048773242 8:137918483-137918505 CTTCGAAGACAGAGGCAGGAGGG + Intergenic
1054949543 9:70834769-70834791 TCTTGAGGTCACAGCCAGGATGG - Intronic
1056061910 9:82892165-82892187 CCTAGTAGACAAAGCAAGGAGGG - Intergenic
1056593208 9:87981458-87981480 CCTCAAAAACACAGCCACAAAGG + Intergenic
1057187066 9:93062899-93062921 CAGCGAACTCACAGCCAGGATGG - Intronic
1057714119 9:97476042-97476064 CCTGGAAGACACAGACAGGAAGG - Intronic
1059421604 9:114195937-114195959 CCTGGAAGACACAGACAAGGTGG - Exonic
1060033122 9:120232739-120232761 GCTGGAAGCCACAGACAGGATGG + Intergenic
1060771767 9:126337124-126337146 CCTCGCAGCCACAGCTGGGATGG + Intronic
1061388453 9:130303930-130303952 CCTCCAAGTCCCGGCCAGGATGG + Intronic
1061634656 9:131899690-131899712 TCTCGATGGCAGAGCCAGGAGGG - Intronic
1062282647 9:135758922-135758944 CCACGAGGACACAGGCAGGTGGG - Intronic
1185679888 X:1879932-1879954 CCTCGCAGACACACCCAGTCTGG + Intergenic
1192055465 X:67769101-67769123 CCTGGAAGACTCACCCAGGGAGG - Intergenic
1200103456 X:153699915-153699937 CCTGGAAGACACAGCTCTGAGGG + Intergenic