ID: 902774252

View in Genome Browser
Species Human (GRCh38)
Location 1:18664445-18664467
Sequence CTGGGGAAGGGGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4808
Summary {0: 2, 1: 4, 2: 73, 3: 556, 4: 4173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902774239_902774252 -1 Left 902774239 1:18664423-18664445 CCTGGAAGAGGGAACACCATGCC 0: 1
1: 0
2: 2
3: 36
4: 390
Right 902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG 0: 2
1: 4
2: 73
3: 556
4: 4173
902774234_902774252 30 Left 902774234 1:18664392-18664414 CCGGGAGGCGTAACAAATGGGGA 0: 1
1: 0
2: 0
3: 4
4: 60
Right 902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG 0: 2
1: 4
2: 73
3: 556
4: 4173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902774252 Original CRISPR CTGGGGAAGGGGAGGGAGGA GGG Intronic
Too many off-targets to display for this crispr