ID: 902774717

View in Genome Browser
Species Human (GRCh38)
Location 1:18667331-18667353
Sequence CCGCATCTTCAGAGAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 203}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902774717 Original CRISPR CCGCATCTTCAGAGAGTGGA AGG Intronic
900485375 1:2920341-2920363 CCCCATCTGCAGTGAGCGGAGGG - Intergenic
901465110 1:9416549-9416571 CCGCATCTTCAAAGATGGGCAGG + Intergenic
902173736 1:14633729-14633751 CTGAATCCTCAGAGAGAGGATGG - Intronic
902774717 1:18667331-18667353 CCGCATCTTCAGAGAGTGGAAGG + Intronic
905387718 1:37615721-37615743 CTGCATCTACAGAGAAGGGATGG + Intronic
907864562 1:58387235-58387257 GTGAACCTTCAGAGAGTGGAGGG - Intronic
908569357 1:65392603-65392625 CCACATCCTCAGGGGGTGGAGGG - Exonic
908679428 1:66643233-66643255 ACTCATCTACAGAGAGAGGAAGG - Intronic
910007049 1:82410727-82410749 CTGCATCCTCACATAGTGGAAGG - Intergenic
915643097 1:157245227-157245249 CCTCCTCTTCAGTGAGTGGTAGG + Intergenic
916015980 1:160750287-160750309 CAGCACCTTCAGAGAATGGGTGG - Exonic
916489997 1:165293747-165293769 CTGTGTCTTCATAGAGTGGAAGG + Intronic
919481872 1:198099979-198100001 CTGCATCATCACACAGTGGAGGG - Intergenic
919625646 1:199907605-199907627 GAGGATCTTCAGAGAGTTGAAGG + Intergenic
920831212 1:209467282-209467304 CTGCATCTTCACACAGTAGAAGG - Intergenic
921214273 1:212923989-212924011 ACCCAACTTCAGAGAGGGGAGGG + Intergenic
922239646 1:223747304-223747326 GCGGACCTTCAGAGGGTGGAGGG - Intronic
922612841 1:226942650-226942672 CTGCATCTTCAGGGAGTGAGTGG + Intronic
923377302 1:233377496-233377518 CAGCAACGTCAGGGAGTGGAAGG + Intronic
1063410823 10:5835304-5835326 CTGCATCTTGAGAGAGCAGAGGG - Intronic
1066147289 10:32574467-32574489 CCAAACCTTCAGAGAGTGGATGG + Exonic
1066746560 10:38607574-38607596 CAGCTTCTTCAGGGAGTAGAGGG + Intergenic
1067065306 10:43101077-43101099 CCGCTTCTCCAGAGAGTTGCAGG - Intronic
1069587696 10:69619505-69619527 CTGCATCTTCACATGGTGGAAGG + Intergenic
1070774490 10:79101844-79101866 TCACATCCTCAGAGAGGGGAGGG - Intronic
1071738881 10:88333852-88333874 CTGCATCCTCACACAGTGGAAGG - Intronic
1072589921 10:96819843-96819865 CTGCATCTTCACATGGTGGAAGG + Intergenic
1074980822 10:118618918-118618940 CCCCATCTTCAGGGAGAGAAAGG + Intergenic
1075355225 10:121766343-121766365 CCTCATCTTCCTGGAGTGGAAGG - Intronic
1075406737 10:122200378-122200400 CCACATCTACAGTGAGAGGACGG + Intronic
1075406755 10:122200468-122200490 CCACATCTACAGTGAGAGGACGG + Intronic
1075406784 10:122200603-122200625 CCACATCTACAGTGAGAGGACGG + Intronic
1075406860 10:122200963-122200985 CCACATCTACAGTGAGAGGACGG + Intronic
1075406870 10:122201008-122201030 CCACATCTACAGTGAGAGGACGG + Intronic
1075406880 10:122201053-122201075 CCACATCTACAGTGAGAGGACGG + Intronic
1075406889 10:122201098-122201120 CCACATCTACAGTGAGAGGACGG + Intronic
1075406907 10:122201188-122201210 CCACATCTACAGTGAGAGGATGG + Intronic
1075406917 10:122201233-122201255 CCACATCTACAGTGAGAGGACGG + Intronic
1078442721 11:11380652-11380674 CCGCATCCACAGAGATGGGATGG - Intronic
1078820790 11:14879282-14879304 CTGCATCTTCAGAGGTTGCATGG + Exonic
1079018875 11:16892942-16892964 CTGCATCCTCACATAGTGGAAGG + Intronic
1080691293 11:34560740-34560762 CCTCATCTTCATAGAGTTGCTGG - Intergenic
1080709461 11:34733258-34733280 ACGCATCTTCAGAGAATTGCAGG - Intergenic
1082774559 11:57235451-57235473 CGGCAGCTGCAGAGAGTGGTGGG + Exonic
1083920217 11:65778405-65778427 GCGCAGCTCCAGAGAGTAGATGG + Exonic
1084392150 11:68884460-68884482 GCAAATCTTCAGAGGGTGGAAGG - Intergenic
1088779827 11:113123558-113123580 GCACATCTCCAGAGAGAGGATGG - Intronic
1089683034 11:120130087-120130109 CTGCATCGTCAGAGAGTGTGAGG - Intronic
1090942670 11:131401628-131401650 TAGTATCTTCAGAGAGTAGAGGG - Intronic
1091833640 12:3568764-3568786 CATCATCATCAGCGAGTGGATGG + Exonic
1092293348 12:7178737-7178759 CTGCATCTTCACATGGTGGAAGG - Intergenic
1093503254 12:19836277-19836299 CCGCATCTTCCGCCAGTGGATGG - Intergenic
1099874023 12:88382529-88382551 CCTCGGCTTCAAAGAGTGGAGGG + Intergenic
1101045019 12:100795685-100795707 CAGGCTCTTCAGAGAGTGGTAGG + Intronic
1102070015 12:110010846-110010868 GCGTATCTTCAGAGACTGCAGGG + Intronic
1103301150 12:119927426-119927448 CTGCATCCTCAGACGGTGGAAGG - Intergenic
1106155079 13:27147035-27147057 CAGCACCTTCAGAGAGGGCATGG + Intronic
1106374879 13:29176603-29176625 CCATATCTTCAGATGGTGGAAGG + Intronic
1107982867 13:45750187-45750209 ATGAACCTTCAGAGAGTGGAGGG - Intergenic
1108502182 13:51078617-51078639 CAGCACTTTCAGAGAGTGCAGGG - Intergenic
1109117763 13:58410202-58410224 CAGTATCTTCACAGAGTGGAAGG - Intergenic
1109490520 13:63092530-63092552 CAGCATCTTCAAAGAGTGCATGG + Intergenic
1111925295 13:94457375-94457397 CTGCATCCTCATATAGTGGAGGG - Intronic
1113323540 13:109262099-109262121 GATCATCTTCAGAGAGTGAAAGG + Intergenic
1116802537 14:49458291-49458313 CTGCATCTTCCCATAGTGGAAGG - Intergenic
1118225669 14:63896874-63896896 CCACCACTTCACAGAGTGGAGGG - Intronic
1119761041 14:77152058-77152080 GGGCATGTTCATAGAGTGGATGG + Intronic
1120362693 14:83525703-83525725 CAGCATCTTCAGCTTGTGGATGG - Intergenic
1121240694 14:92427933-92427955 CTGCATCCTCACACAGTGGAAGG - Intronic
1122039978 14:98980284-98980306 CTGTATCTTCACAGGGTGGAAGG - Intergenic
1122110210 14:99494869-99494891 CCGCATCCTCAAATGGTGGAAGG + Intronic
1122346102 14:101061557-101061579 CAGCATCCTCAGAGGGTGGGTGG - Intergenic
1202854589 14_GL000225v1_random:42750-42772 CGGCATGTGCAGAGAGAGGACGG - Intergenic
1123700844 15:22913856-22913878 CCACAGCCACAGAGAGTGGAAGG + Intronic
1124101868 15:26703272-26703294 CTGTATCTTCACACAGTGGAAGG + Intronic
1124109142 15:26771793-26771815 CCGCTGCTTCAGAGAGCGGGAGG - Intronic
1124817289 15:33007520-33007542 CCGTATCCTCAGAGAGTGCTGGG - Intronic
1124848598 15:33314411-33314433 CCCCATCTTCAGACAGTCGGTGG + Intronic
1125238902 15:37550447-37550469 CCCCATCTTCAGGCAGAGGAGGG - Intergenic
1125987397 15:44067580-44067602 CTGCATCCTCAGAGGGTGGAGGG + Intronic
1126338604 15:47614688-47614710 CTGGATCTACAGAGACTGGAGGG - Intronic
1126982413 15:54259048-54259070 CTGCATCTTCACATAGTAGAAGG + Intronic
1127996851 15:64158063-64158085 CTGTATCTTGAGAGAGTGGCTGG - Intronic
1128678891 15:69632100-69632122 CCGCATCTGCAGAGAGGAAAAGG + Intergenic
1129114941 15:73360075-73360097 CTGCATCTTCAGAAAGGGGAAGG + Intronic
1130152959 15:81324980-81325002 TCGCATCTTCACAGCGTGAATGG + Intergenic
1130833809 15:87629982-87630004 CCGCATTTTCACATGGTGGAAGG + Intergenic
1130848257 15:87767710-87767732 CAGCATCTACAGAGATTGAAAGG - Intergenic
1131001944 15:88946056-88946078 CTGAATCTTCAGAGGGTGAAGGG - Intergenic
1131065656 15:89433562-89433584 CTGCAGCTTCAGAGTCTGGAGGG + Intergenic
1131084678 15:89566423-89566445 CAGCTTCTCCGGAGAGTGGAAGG - Intergenic
1132001273 15:98182276-98182298 CTGTGTCTTCAGATAGTGGAAGG - Intergenic
1132851998 16:2028988-2029010 CTGGATCTGCAGAGAGGGGAAGG - Intronic
1133466719 16:6034497-6034519 CTGCATCTTCATATGGTGGAAGG + Intronic
1136174551 16:28507923-28507945 TCCCATCTTCAGGGAGAGGATGG + Intronic
1136736504 16:32472061-32472083 CAGCTTCTTCAGGGAGTGGAGGG - Intergenic
1140067044 16:71620437-71620459 CTGCATCTTCACACAGTGGAGGG + Intergenic
1141888003 16:86906119-86906141 CCAAACCTTCAGAGAGTGGATGG - Intergenic
1141901980 16:86996877-86996899 CCTCATCTTTAGAGTGGGGATGG + Intergenic
1203016566 16_KI270728v1_random:357517-357539 CAGCTTCTTCAGGGAGTGGAGGG + Intergenic
1203034901 16_KI270728v1_random:630675-630697 CAGCTTCTTCAGGGAGTGGAGGG + Intergenic
1142824091 17:2496844-2496866 CTGCATCCTCACAGGGTGGAAGG - Intronic
1145262670 17:21364174-21364196 CCGCATGGTGAGATAGTGGATGG + Intergenic
1147150410 17:38510744-38510766 CCTCAACTTCAACGAGTGGAAGG + Exonic
1148889325 17:50796454-50796476 CCACATCATCTGACAGTGGAAGG + Intergenic
1149573587 17:57695456-57695478 CCTCATCTTCAGAAAATGGAGGG - Intergenic
1151331436 17:73411516-73411538 CCACATCTGGAGGGAGTGGACGG + Intronic
1151887166 17:76929946-76929968 CTTCAGCTTCAGAGAGTGGTGGG + Intronic
1152571002 17:81121248-81121270 CTGCTTCTGCAGAGAGCGGAAGG + Exonic
1152583635 17:81179746-81179768 CCACAGCTTCCGAGAATGGAAGG + Intergenic
1153190744 18:2535200-2535222 CAGCATCTTCAGGGAAGGGAAGG + Intergenic
1154398930 18:14016667-14016689 CTGCATCCTCACACAGTGGAAGG + Intergenic
1159025286 18:63177874-63177896 CCGCATCTCCAGAAAGTGCAGGG + Intronic
1160257582 18:77260254-77260276 CTGTATCCTCACAGAGTGGAAGG + Intronic
1163262614 19:16200235-16200257 CCTCATCTTTAGCCAGTGGAAGG + Intronic
1163743663 19:19032621-19032643 CCGCCTCTTCAGTGGGTGGTTGG - Intronic
1165895438 19:39138585-39138607 CGGCATCTTGTGGGAGTGGAGGG - Intronic
1167472598 19:49683985-49684007 CATCATCATCAGCGAGTGGATGG + Exonic
1167719203 19:51167258-51167280 CCGCCTCTGCACAGAGTGGAGGG - Intergenic
1168318020 19:55492563-55492585 CCTCATCTGCAGACAGGGGAGGG - Intronic
925852736 2:8098731-8098753 GCTCATCTGCAAAGAGTGGATGG + Intergenic
926252010 2:11160042-11160064 CTGCAGCTTCTCAGAGTGGAGGG + Intronic
928653112 2:33422584-33422606 CTGCATCTTCACATGGTGGAAGG - Intergenic
928840242 2:35597516-35597538 CAGCATCTTAACAGAGTTGAGGG - Intergenic
929532043 2:42758945-42758967 CAGCAATTTCAGTGAGTGGATGG - Intergenic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
932698613 2:73977856-73977878 TCCCATCTTTAGAGATTGGAAGG + Intergenic
934187663 2:89761182-89761204 CAGCTTCTTCAGGGAGTGGAGGG - Intergenic
934308961 2:91846764-91846786 CAGCTTCTTCAGGGAGTGGAGGG + Intergenic
934698105 2:96415015-96415037 TCAAATCTTCAGAGAGTAGAAGG + Intergenic
935470707 2:103456359-103456381 CAGCATCTTCAGCTTGTGGATGG + Intergenic
936558314 2:113515023-113515045 TAGCATCTTCAGAGAGAGCATGG - Intergenic
939796998 2:146657315-146657337 CTGCATCTTCACAGTCTGGAAGG - Intergenic
941821018 2:169843316-169843338 CTGCATCTTCACATGGTGGAAGG + Intronic
947986967 2:234456516-234456538 TCACACCTTCAGAGAGTGGAAGG - Intergenic
948312208 2:236996203-236996225 CCGCAGCTTCTGAGTGTTGAGGG - Intergenic
1169301440 20:4445171-4445193 CTGCATCATCAGATGGTGGAAGG - Intergenic
1169607405 20:7338111-7338133 TCCCCTCTTCAGAGATTGGAGGG - Intergenic
1173677837 20:44853151-44853173 CTGCATCTTCACATGGTGGAAGG + Intergenic
1177255181 21:18652315-18652337 CTGCATCTTCATATGGTGGAAGG - Intergenic
1177367218 21:20153695-20153717 CCGCTGCTTCAGAGGGTGCAAGG - Intergenic
1178226252 21:30722596-30722618 CCTCATCTTCTGAGACTGAAGGG - Intergenic
1179042544 21:37816710-37816732 CCGCCTCTGCTGAGTGTGGATGG + Intronic
1180001685 21:44998080-44998102 CCCCATCTTCTGAGGGTGGGAGG + Intergenic
1180536044 22:16393859-16393881 CAGCTTCTTCAGGGAGTGGAGGG + Intergenic
1182067327 22:27439828-27439850 CTGCAGCCCCAGAGAGTGGATGG + Intergenic
1183300403 22:37056363-37056385 CCGCATCATCAAAGACCGGATGG + Exonic
1185240093 22:49737713-49737735 CCGCATATACAGAGAGGAGAGGG + Intergenic
1185240099 22:49737744-49737766 CCGCATATACAGAGAGGAGAGGG + Intergenic
1185240117 22:49737837-49737859 CCGCATATACAGAGAGGAGAGGG + Intergenic
950877497 3:16289397-16289419 AAGCATTTTCACAGAGTGGAGGG + Intronic
950934677 3:16826278-16826300 TCCCATCTAAAGAGAGTGGATGG - Intronic
951407167 3:22315204-22315226 CAGCATCTTAGTAGAGTGGATGG + Intronic
951681094 3:25295364-25295386 CTGCATCCTCACATAGTGGAAGG - Intronic
959442492 3:106395408-106395430 CTGCATCTTCACAGGGTGAAGGG + Intergenic
960178544 3:114546699-114546721 AAACATCTTCAGGGAGTGGAGGG - Intronic
964082261 3:152773619-152773641 CCACATCCTCACAGAGTGGATGG - Intergenic
966058909 3:175732174-175732196 GCAAACCTTCAGAGAGTGGAGGG - Intronic
966758877 3:183397331-183397353 CCGCATCCTCACATGGTGGAAGG + Intronic
966936562 3:184713619-184713641 CCGCATCTCCACAGAGTGCTAGG - Intergenic
967750990 3:193116114-193116136 CTGCATCCTCACATAGTGGAAGG - Intergenic
969129237 4:4979249-4979271 CTGCATCTTCACATTGTGGAAGG - Intergenic
969820639 4:9717550-9717572 TAGCATCTTCAGAGAGAGCATGG + Intergenic
971784097 4:31078123-31078145 GCGCATCTTCAGAAAGTGGAAGG + Intronic
972936356 4:44140837-44140859 CTGCATCCTCACATAGTGGAAGG + Intergenic
973208490 4:47587674-47587696 CTGCACCTTCAGATGGTGGAAGG + Intronic
975761548 4:77625197-77625219 CCGCAGCCTCACAGGGTGGAAGG - Intergenic
979137378 4:117126986-117127008 CAGCTTCTTCACAGAGTGGTTGG - Intergenic
979519746 4:121652693-121652715 CCATGTCTTCAGATAGTGGAAGG + Intergenic
981180469 4:141736596-141736618 TGGCATTTTCATAGAGTGGAAGG + Intergenic
982563876 4:156964976-156964998 CCCCATCTTCAGAAAATGTAAGG + Intronic
983346921 4:166538646-166538668 CCTTATCTTCAGAAAGGGGATGG + Intergenic
983697074 4:170545465-170545487 CCACATCATCAGAGCTTGGAGGG - Intergenic
984320230 4:178186428-178186450 CCACATCTGGAGAGAGTGGTGGG - Intergenic
987828318 5:23062525-23062547 CTGCATCCTCATATAGTGGAAGG + Intergenic
987969744 5:24927243-24927265 CTCCATCTTCATATAGTGGAAGG - Intergenic
988794066 5:34636045-34636067 CCGCATCATCAGATGGTGAAAGG + Intergenic
992083925 5:73260934-73260956 CCACAACTTCATAGAGTGAAGGG + Intergenic
993295396 5:86132570-86132592 CTACATCCTCACAGAGTGGAAGG - Intergenic
995063268 5:107834706-107834728 CTGCAGCTTCTGACAGTGGAAGG - Intergenic
996092160 5:119361989-119362011 CCCCATCTTCAGAGAGTTTTTGG + Intronic
997366038 5:133325699-133325721 CTGCAGCTCCAGAGAGTGGCTGG - Intronic
997600302 5:135134325-135134347 CGGCATCTTCAGGGAGCTGAAGG + Intronic
998114403 5:139525145-139525167 ACACATCTTCAGAGAGGGGGTGG + Intergenic
1002674371 5:180898765-180898787 CCTGAACTTCAGAGAATGGAGGG + Intergenic
1004863233 6:19827715-19827737 GCGTATGTTCAGAGAGTGGCTGG - Intergenic
1008717386 6:54305554-54305576 CCTTATCTTCAGAGTCTGGAAGG + Intergenic
1010451017 6:76002938-76002960 CCCCAGCTTGAGACAGTGGACGG - Exonic
1014703204 6:124715050-124715072 CAGCATTTTCAGGGAGTGGGTGG - Intronic
1016527693 6:145021167-145021189 GAGCATCTGCAGAAAGTGGAGGG - Intergenic
1017114081 6:150960432-150960454 CGGAAGCTTCAGGGAGTGGACGG + Intronic
1017753918 6:157513812-157513834 CCTCATCTTCAGAGTCCGGAAGG - Intronic
1018390094 6:163335548-163335570 CCGCAGCTTCCCAGAGTGGGAGG - Intergenic
1021279691 7:18702385-18702407 CAGCACCTCCAGAGAGTGGATGG + Intronic
1021510785 7:21429670-21429692 CCACAACTTCAGACAGTGGAAGG + Exonic
1022539101 7:31119699-31119721 CCGTGTCCTCATAGAGTGGAAGG + Intergenic
1022955967 7:35380652-35380674 CTCCATCTTCAGAAGGTGGAGGG - Intergenic
1031016708 7:116583260-116583282 CCTTCTCTACAGAGAGTGGATGG + Intergenic
1031882400 7:127211709-127211731 CTGCATCTTCACAGGGTGGAAGG - Intronic
1032118187 7:129135268-129135290 ACTTATCTTCAGGGAGTGGATGG + Intergenic
1034949720 7:155288911-155288933 CTTCATCTTCAGAGAGTGACTGG + Intergenic
1035443145 7:158920659-158920681 CCACATGTTCAAGGAGTGGAGGG + Intronic
1036711457 8:11082093-11082115 CAGCATCTTCTGGCAGTGGAAGG - Intronic
1036767252 8:11556856-11556878 CCGCATCCTCAGAGCGAGGCGGG + Intronic
1037941939 8:22958192-22958214 CCACATCTTTGGAGAGGGGAGGG - Intronic
1040603732 8:48909835-48909857 CTCCATCTTCAGAGATTAGATGG - Intergenic
1041804808 8:61838462-61838484 GTGAACCTTCAGAGAGTGGAGGG - Intergenic
1044068581 8:87727154-87727176 CAGCATCTTCATGGAGTGGAAGG + Intergenic
1045379879 8:101612449-101612471 TAGCATCTTCAGAGTGTGGATGG + Intronic
1048427589 8:134337030-134337052 CCACCTCTTCAGACGGTGGACGG + Intergenic
1049894550 9:101243-101265 TAGCATCTTCAGAGAGAGCATGG + Intergenic
1050989716 9:12134642-12134664 ATGCATCTTCAGAGAGTAAAAGG - Intergenic
1053735756 9:41101233-41101255 TAGCATCTTCAGAGAGAGCATGG + Intergenic
1054692620 9:68330165-68330187 TAGCATCTTCAGAGAGAGCATGG - Intronic
1057339539 9:94187549-94187571 CTGCATCCTCACATAGTGGAAGG + Intergenic
1057402641 9:94738368-94738390 GGACATATTCAGAGAGTGGAAGG - Intronic
1057564862 9:96158716-96158738 ACGCATCCTCTGAGAGTGGTTGG - Intergenic
1059793371 9:117664453-117664475 CTGCATCGTCATATAGTGGAAGG + Intergenic
1060000968 9:119958372-119958394 CCACATCTGCAGAGTGAGGATGG - Intergenic
1188459389 X:30405882-30405904 CTGCATTTTAAGAGAGGGGAAGG + Intergenic
1190770717 X:53511709-53511731 GTGAATCTTCAGAGAGTGAAGGG + Intergenic
1191885635 X:65885031-65885053 CTGCATCCTCAGATGGTGGAAGG - Intergenic
1192047296 X:67689320-67689342 CAGATTATTCAGAGAGTGGAGGG + Intronic
1194624982 X:96216575-96216597 CAGTTTCTTCAGAGTGTGGATGG - Intergenic
1196250871 X:113458740-113458762 CTGTATCTTCAGATAGTGGGAGG + Intergenic
1196293798 X:113976663-113976685 GTGAATCTTCAGAGAGTGAAGGG + Intergenic
1196366187 X:114927030-114927052 CCGAAACTTCAGAGGGTGAAGGG - Intergenic
1198881902 X:141291109-141291131 CTGCATCTTCACATGGTGGAAGG + Intergenic
1200112209 X:153746718-153746740 CAGCTTCTTCAGGGAGTGGAGGG + Intergenic
1200932177 Y:8706951-8706973 CAGGAATTTCAGAGAGTGGAAGG - Intergenic