ID: 902775295

View in Genome Browser
Species Human (GRCh38)
Location 1:18670786-18670808
Sequence CCCATCAGGCACCACTTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 71}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902775292_902775295 -10 Left 902775292 1:18670773-18670795 CCTGGCTCCTTGTCCCATCAGGC 0: 1
1: 0
2: 3
3: 21
4: 190
Right 902775295 1:18670786-18670808 CCCATCAGGCACCACTTAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 71
902775284_902775295 13 Left 902775284 1:18670750-18670772 CCGGGCCCGTGCGAGTCCCTCCA 0: 1
1: 0
2: 0
3: 11
4: 123
Right 902775295 1:18670786-18670808 CCCATCAGGCACCACTTAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 71
902775282_902775295 29 Left 902775282 1:18670734-18670756 CCATGGAGACGACAGCCCGGGCC 0: 1
1: 0
2: 1
3: 6
4: 154
Right 902775295 1:18670786-18670808 CCCATCAGGCACCACTTAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 71
902775283_902775295 14 Left 902775283 1:18670749-18670771 CCCGGGCCCGTGCGAGTCCCTCC 0: 1
1: 0
2: 0
3: 9
4: 163
Right 902775295 1:18670786-18670808 CCCATCAGGCACCACTTAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 71
902775285_902775295 8 Left 902775285 1:18670755-18670777 CCCGTGCGAGTCCCTCCACCTGG 0: 1
1: 0
2: 1
3: 29
4: 194
Right 902775295 1:18670786-18670808 CCCATCAGGCACCACTTAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 71
902775288_902775295 -3 Left 902775288 1:18670766-18670788 CCCTCCACCTGGCTCCTTGTCCC 0: 1
1: 1
2: 0
3: 54
4: 539
Right 902775295 1:18670786-18670808 CCCATCAGGCACCACTTAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 71
902775290_902775295 -7 Left 902775290 1:18670770-18670792 CCACCTGGCTCCTTGTCCCATCA 0: 1
1: 0
2: 1
3: 26
4: 298
Right 902775295 1:18670786-18670808 CCCATCAGGCACCACTTAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 71
902775289_902775295 -4 Left 902775289 1:18670767-18670789 CCTCCACCTGGCTCCTTGTCCCA 0: 1
1: 0
2: 6
3: 40
4: 463
Right 902775295 1:18670786-18670808 CCCATCAGGCACCACTTAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 71
902775287_902775295 7 Left 902775287 1:18670756-18670778 CCGTGCGAGTCCCTCCACCTGGC 0: 1
1: 0
2: 0
3: 15
4: 195
Right 902775295 1:18670786-18670808 CCCATCAGGCACCACTTAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902775295 Original CRISPR CCCATCAGGCACCACTTAAG AGG Intronic
902775295 1:18670786-18670808 CCCATCAGGCACCACTTAAGAGG + Intronic
903058570 1:20653815-20653837 CCCATCAGGCACCACTGGAAAGG - Intronic
904610430 1:31723054-31723076 TCCATTAGGCACCAATTAAAAGG - Intergenic
909437814 1:75664018-75664040 CACATGATTCACCACTTAAGAGG + Intergenic
1067777985 10:49176780-49176802 CCCATCAGCCTCCACTTACCGGG + Intronic
1079368740 11:19832055-19832077 CCCAACAGGCATCTCTTAATGGG - Intronic
1081256664 11:40905108-40905130 TCCAGCAGGCACCAATTAAAGGG + Intronic
1085298763 11:75446111-75446133 TCCATCAGGGACCACTTGACAGG + Intronic
1089539525 11:119181619-119181641 CATATCAGTCAACACTTAAGGGG - Intronic
1092596225 12:10007863-10007885 CCCAGCATGCACCACTTACCAGG - Intronic
1093401200 12:18748787-18748809 CCCATCAGGCAGATCTTAGGAGG + Intergenic
1098160531 12:67644854-67644876 CCTGCCAGACACCACTTAAGTGG + Intergenic
1105770714 13:23609293-23609315 CCCAGCAGGTACTACTTATGGGG - Intronic
1108589131 13:51896651-51896673 CCCATGAGGCACCCCTGCAGCGG + Intergenic
1108723063 13:53151778-53151800 CCCATCCTGCATCACTTCAGTGG - Intergenic
1109778952 13:67081918-67081940 CCAATCAGGCCCCAATAAAGTGG - Intronic
1110395598 13:75026806-75026828 CTAAACAAGCACCACTTAAGAGG + Intergenic
1112704258 13:102048621-102048643 CCCAGCAGGTAACACTTACGTGG - Intronic
1113393748 13:109923402-109923424 CCCATCAGAAGCTACTTAAGAGG - Intergenic
1122003271 14:98682270-98682292 ACCACCAGGCTCCACTCAAGAGG - Intergenic
1122930634 14:104931665-104931687 CCCACCATGCACCACCTAAGAGG - Intronic
1132326866 15:100977689-100977711 CCCACCAGGCAGCAATGAAGGGG + Intronic
1136036373 16:27543681-27543703 CCCACCAGCCAACATTTAAGTGG + Intronic
1136547519 16:30964135-30964157 CCCAGCAGGCACCACTGCGGTGG + Exonic
1137616854 16:49853976-49853998 TCCTTCAGGAGCCACTTAAGAGG - Intronic
1143519022 17:7435232-7435254 TCCATCAGGCACTACTTCAGCGG + Intergenic
1144934197 17:18884933-18884955 CCCACCGGGCATCCCTTAAGAGG - Intronic
1152013665 17:77735798-77735820 CCCATCAGGGGCCATTTAAGGGG - Intergenic
1154409275 18:14127896-14127918 CCCACCAGGCTTCACTTTAGAGG - Intronic
1155558142 18:27044378-27044400 CACTTCAGGCACCACAAAAGGGG - Intronic
1160399047 18:78595849-78595871 CCCATGAGGCATCAGTTAATGGG - Intergenic
1164698900 19:30268212-30268234 CTCATCAGGACCCACTTTAGTGG + Intronic
1168649652 19:58085245-58085267 CCCGTCGGGCACCACTGAGGAGG - Exonic
924996490 2:366219-366241 CCCATCAGGATTCACTTCAGGGG - Intergenic
925180063 2:1811771-1811793 CCCATCAGGGAGGACTGAAGAGG - Intronic
932687444 2:73884542-73884564 CCAATCAGAAACCACTTACGTGG + Intergenic
935674155 2:105579960-105579982 CCCACCCTGCACCACTGAAGTGG + Intergenic
940410524 2:153358460-153358482 CCCATCAGGTACCAATTATCTGG - Intergenic
948856114 2:240731470-240731492 CCCAGCTGGCACAACTTCAGGGG - Intronic
1171459679 20:25291538-25291560 CCTGCCAGGCACCACTAAAGAGG - Intronic
1175394044 20:58646458-58646480 CCCAACAGGCCCCACCTAAATGG - Intergenic
1179507641 21:41852447-41852469 CCCAGCAGGCACCACCACAGGGG + Intronic
952055125 3:29434871-29434893 CCCACCAGGCACCACTGACCAGG + Exonic
953538621 3:43794877-43794899 CCCAACAGGCAACATTTCAGGGG + Intergenic
953929258 3:46997804-46997826 CCTTTCAGGCCCCACTCAAGTGG - Intronic
954884216 3:53857792-53857814 GCCAGCAGACACCAGTTAAGTGG + Intronic
955047910 3:55377194-55377216 CCCATGAGGCACCAGCCAAGTGG - Intergenic
959533381 3:107458788-107458810 TCCCTCAGGGACCACTTTAGAGG + Intergenic
961961767 3:130862854-130862876 CCTATCAGGTAGCACTGAAGTGG - Intronic
962080548 3:132134958-132134980 CCCATATGGCATCACTTAAGGGG - Intronic
975878434 4:78871501-78871523 CCCAGAAGACACCACTGAAGGGG + Intronic
977169545 4:93743753-93743775 CCCATTAGGCCCCACCTAATGGG + Intronic
978538424 4:109787973-109787995 CCACTCAGGCCCCACTTCAGAGG + Intronic
985702896 5:1384204-1384226 CCCACCTGTCACCACTTGAGAGG - Intergenic
997430267 5:133833267-133833289 CCCATCAGAGACCATTTCAGAGG - Intergenic
1002328990 5:178428845-178428867 CCCACGAGGCACCACTCCAGGGG - Intronic
1004555653 6:16695069-16695091 CCCAAGAGCCACCACTTCAGTGG - Intronic
1006597436 6:35203683-35203705 CCCATAAGCCCCCACTAAAGGGG + Intergenic
1008334996 6:50292569-50292591 ATCCTCAGGCACAACTTAAGAGG + Intergenic
1010347114 6:74824801-74824823 TCCTCCAGGCACCACGTAAGGGG + Intergenic
1019906902 7:4071719-4071741 CCCTTCAGGGACCAGTTCAGTGG + Intronic
1024388551 7:48781226-48781248 GCCATCCTGTACCACTTAAGGGG - Intergenic
1027348638 7:77288038-77288060 CCCACCAGGCACCACTAGTGAGG + Intronic
1027911117 7:84252219-84252241 CCCACCAGGTAACAATTAAGTGG - Intronic
1028679747 7:93512115-93512137 CCTTTCAGCCACCACTGAAGAGG - Intronic
1033285209 7:140035537-140035559 CCCGTCAGACACCACCTAACAGG + Intronic
1045277862 8:100722746-100722768 CCCAGCAGGCACCGCTTCTGCGG - Intronic
1049432769 8:142573017-142573039 CACAGAAGGCTCCACTTAAGAGG - Intergenic
1052211897 9:25914086-25914108 TCCATCAGGCCCGAGTTAAGTGG - Intergenic
1052461959 9:28776217-28776239 CTCATCTTTCACCACTTAAGTGG - Intergenic
1057644298 9:96858765-96858787 GCCATCAGGCTCCACTTCTGTGG - Intronic
1057678622 9:97154937-97154959 CCGATCAGGCCCCACTAAGGCGG + Intergenic
1187219807 X:17312909-17312931 CACATGAGGCACCATTTATGGGG - Intergenic
1189148027 X:38674871-38674893 CCCATCAGGAATCACTAAGGGGG + Intronic
1192198661 X:69049372-69049394 CACACCAGCCACCACTGAAGGGG + Intergenic
1198092286 X:133343426-133343448 CATATTATGCACCACTTAAGAGG - Intronic
1199768075 X:150954801-150954823 GACCTCAGCCACCACTTAAGTGG + Intergenic