ID: 902779027

View in Genome Browser
Species Human (GRCh38)
Location 1:18692802-18692824
Sequence CCATATATTGAGGCCATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902779027_902779038 21 Left 902779027 1:18692802-18692824 CCCTCCATGGCCTCAATATATGG 0: 1
1: 0
2: 0
3: 8
4: 102
Right 902779038 1:18692846-18692868 AAGAGCCTCCCAATGGCTCGAGG 0: 1
1: 0
2: 0
3: 4
4: 67
902779027_902779037 14 Left 902779027 1:18692802-18692824 CCCTCCATGGCCTCAATATATGG 0: 1
1: 0
2: 0
3: 8
4: 102
Right 902779037 1:18692839-18692861 GAAGAGCAAGAGCCTCCCAATGG 0: 1
1: 0
2: 0
3: 23
4: 176
902779027_902779036 -10 Left 902779027 1:18692802-18692824 CCCTCCATGGCCTCAATATATGG 0: 1
1: 0
2: 0
3: 8
4: 102
Right 902779036 1:18692815-18692837 CAATATATGGGAAGGAAGAGGGG 0: 1
1: 0
2: 0
3: 30
4: 389

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902779027 Original CRISPR CCATATATTGAGGCCATGGA GGG (reversed) Intronic
900764833 1:4497827-4497849 CCACAGAGAGAGGCCATGGAAGG - Intergenic
900898564 1:5501586-5501608 AAATAGATTGAGGCCATGGGAGG - Intergenic
902779027 1:18692802-18692824 CCATATATTGAGGCCATGGAGGG - Intronic
908322590 1:62992527-62992549 GCAGATCTTGAGGCCATGGTTGG - Intergenic
909959247 1:81818639-81818661 CCATTTATTAAGGCCATGCCAGG + Intronic
914901536 1:151713825-151713847 TCAAAGGTTGAGGCCATGGAAGG + Intronic
915374144 1:155377397-155377419 CCATATATTGAGAGCTAGGAAGG + Intronic
917708978 1:177665286-177665308 AAATATTTTGGGGCCATGGAAGG - Intergenic
917782090 1:178409106-178409128 CCATACTTTTAGGCCATGGGAGG + Intronic
923238270 1:232056164-232056186 CCATGCTTTGAGGCCATGTAAGG - Intergenic
924376429 1:243414138-243414160 ACATATATTGAGGTCATTGAGGG + Intronic
1063515189 10:6688395-6688417 CCATCTATTCAGGACTTGGAAGG - Intergenic
1064778570 10:18807739-18807761 CTGTATAATGAGGCCAGGGATGG + Intergenic
1066056361 10:31684658-31684680 CCATAGATTGAGGTCATTGGTGG + Intergenic
1069065414 10:63937278-63937300 CTACCTATTGTGGCCATGGAGGG - Intergenic
1070892816 10:79954687-79954709 CCTTCTATTGGGGCCCTGGATGG + Intronic
1071165861 10:82805576-82805598 CCAGATCTTGAGGCCCTGGGAGG + Intronic
1072149226 10:92672163-92672185 CCATTTATTAAGGCAATGGAAGG - Intergenic
1075711493 10:124533229-124533251 CCATAAACTGAGACCATTGAGGG + Intronic
1076704615 10:132294301-132294323 CCATAGGTCGAGGCCAAGGAAGG + Intronic
1077255558 11:1581189-1581211 CCATATCTTGGGACCATGGGGGG + Intergenic
1077255622 11:1581400-1581422 CCATATCTTGGGACCATGGGGGG + Intergenic
1079574683 11:21988859-21988881 CCACATTATGATGCCATGGAAGG - Intergenic
1080556911 11:33426450-33426472 CCATAAATTGAGAGCAAGGAGGG + Intergenic
1081500953 11:43666162-43666184 CCAGATATTGAGAAAATGGAGGG - Intronic
1082100131 11:48166151-48166173 AAATATATTGAGGCCAGGCACGG - Intronic
1084123870 11:67085916-67085938 CAATGTGTTCAGGCCATGGATGG + Intergenic
1091617640 12:2061705-2061727 CCCTATTTTCAGGCCATGAAAGG - Intronic
1097964165 12:65561387-65561409 CCAAATATTGTGAGCATGGATGG - Intergenic
1100396409 12:94189741-94189763 CTTGATATTGAGGTCATGGAGGG + Intronic
1113034547 13:106035066-106035088 ACATATTTTTAGGCCATGCATGG + Intergenic
1116409423 14:44604077-44604099 CAATCTATTGAGGGCCTGGATGG - Intergenic
1118027468 14:61784036-61784058 CCCTATATTGAAGCAGTGGAGGG + Intronic
1122499101 14:102183805-102183827 GAATATAATGAGCCCATGGATGG + Intronic
1123932855 15:25180199-25180221 CCATCTCTTGAGTCCATGGAGGG + Intergenic
1130856145 15:87841568-87841590 CCCCATCTTGAGGCCAGGGAGGG - Intergenic
1131566945 15:93494544-93494566 CCATTTTTTGAGGCCGTGCATGG + Intergenic
1140648569 16:77062562-77062584 ACAGAAATTGAGGACATGGAAGG - Intergenic
1143917518 17:10304888-10304910 CCAGAGATTGAAGCCAGGGAGGG + Intronic
1144133318 17:12268508-12268530 CCTTGTGTTAAGGCCATGGAAGG + Intergenic
1146123155 17:30212328-30212350 CCATGTGTTCAGGCCATGCAGGG - Intronic
1153533989 18:6080553-6080575 CCATCTGCAGAGGCCATGGAGGG - Intronic
1155212836 18:23618122-23618144 GCATATTTTTAGGCCATGGTTGG + Intronic
1157000653 18:43519498-43519520 CCAACTATTAAGGCCCTGGAGGG + Intergenic
1157489337 18:48111465-48111487 CCAAATATTGAGGAAATGGGGGG - Intronic
1162231599 19:9271071-9271093 CCCTACCTTCAGGCCATGGAAGG + Intergenic
1165807293 19:38588243-38588265 CTTTATCTTGAGGCCATGGGAGG + Intronic
1166571650 19:43800669-43800691 TCATATATGGAGGCCAGGGGTGG + Intronic
1168079224 19:53997158-53997180 CCAAAAATTGAGGCCAGGAAAGG - Intronic
926387585 2:12352499-12352521 ACATATATTCAGGCCAAAGAAGG - Intergenic
926641394 2:15241457-15241479 CCATATATTCATTCCATGGTTGG - Intronic
928771443 2:34706626-34706648 CCATACACTGAGGACATTGAAGG + Intergenic
929187637 2:39111974-39111996 CCAGAGATAGAGGCCAAGGAGGG - Intronic
930832092 2:55755698-55755720 ACATATTTTGAGGCCATGTTAGG + Intergenic
934665941 2:96170810-96170832 CCCTATAATGAGGTCATGGCCGG + Intergenic
935053823 2:99548168-99548190 GCATCTATTCAGGTCATGGAAGG + Intronic
935540103 2:104338544-104338566 CCTTCCCTTGAGGCCATGGAGGG - Intergenic
944307263 2:198192970-198192992 ACATATTTTGAGGCCAAGGCAGG - Intronic
945943158 2:215969788-215969810 CCCAATATGGAGGTCATGGAGGG + Intronic
1169285774 20:4305941-4305963 CCATCCCTTGGGGCCATGGATGG + Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1172341599 20:34162217-34162239 CCATATGTTGAGGCCTGGCATGG - Intergenic
1173086472 20:39923811-39923833 CAATATATTGAGGACATTGTGGG - Intergenic
951824857 3:26857684-26857706 CAATATATTAAGTCCTTGGAAGG - Intergenic
952105270 3:30062792-30062814 ACATTTATTGAGTCAATGGAGGG - Intergenic
952840937 3:37644760-37644782 CCAGATTTTGAAACCATGGAAGG - Intronic
953162534 3:40434500-40434522 ACATATTTTGAGGCCAGGCATGG + Intergenic
956166048 3:66399059-66399081 CCAGAAATTAAGGCCAGGGAAGG + Intronic
956427000 3:69146049-69146071 CTAAAAGTTGAGGCCATGGATGG + Intergenic
962620922 3:137177638-137177660 GTATATTTTGAGGCCAGGGAAGG - Intergenic
962974328 3:140433103-140433125 CCATCTTTTGAGGCCATTGGAGG + Intronic
964091738 3:152885242-152885264 CCAAATGTGGAGGCCAAGGAAGG - Intergenic
966491464 3:180532037-180532059 CCCCATCTTTAGGCCATGGAGGG + Intergenic
967687011 3:192429312-192429334 CCATATTTTGATGGAATGGAAGG + Intronic
967962199 3:194934782-194934804 CCATATATTTAGGCCAAGCTGGG - Intergenic
968835172 4:2958531-2958553 CAAAATCTTGATGCCATGGAAGG + Intronic
981127153 4:141119930-141119952 CCTTATATTGAAGGTATGGAAGG - Intronic
981663160 4:147190675-147190697 CCATACATTAAGGTCATGGAGGG - Intergenic
985191271 4:187376050-187376072 CTATATAGTGAGGCTATGAAAGG - Intergenic
987978084 5:25042223-25042245 GAATATATAGAGGCCATGGAAGG - Intergenic
992356841 5:75994519-75994541 CCATAAAGTGAGGGCATTGAAGG + Intergenic
992973450 5:82086494-82086516 CCATGTAGAGAGGCCATGTAGGG - Intronic
996106917 5:119516142-119516164 CCATATAATCAGGTGATGGAGGG + Intronic
999982160 5:156968064-156968086 GCATATATTGAGGCCGGGTATGG + Intergenic
1006421184 6:33935188-33935210 CCTTCTATGGAGGCCATGGTGGG - Intergenic
1008712649 6:54247483-54247505 CCATATAGTCAGACCATGTAGGG + Intronic
1009192438 6:60645637-60645659 ACATATATTCAGCCAATGGAAGG - Intergenic
1012117471 6:95321154-95321176 TCATATGTTAAGGCCATGGCTGG - Intergenic
1013036257 6:106386858-106386880 CCAAATCCTGGGGCCATGGACGG - Intergenic
1013294096 6:108743356-108743378 CCATTTCCTGAGGCCATGGGGGG + Intergenic
1014430734 6:121367218-121367240 TCACATATGGAGGCCAAGGAGGG + Intergenic
1014805850 6:125828493-125828515 CCAAATATTCAGGCCTTGGCAGG + Intronic
1017000896 6:149996353-149996375 CCATATATTTAGGTGATGAAGGG + Intergenic
1031748615 7:125539974-125539996 GCACATTTTGAGGCCAAGGAAGG + Intergenic
1032580624 7:133099991-133100013 CCACATAGAGAGGCCATGTATGG + Intergenic
1040698199 8:50028059-50028081 CCATATATTGATGCCAGTGGTGG - Intronic
1048582762 8:135743977-135743999 CCAAACATTCAGGCCATGCAGGG - Intergenic
1048869010 8:138782091-138782113 CAGAATGTTGAGGCCATGGAAGG - Intronic
1051619279 9:19034975-19034997 CCCTCTATTGAGGGCATGGATGG - Intronic
1052810727 9:33056778-33056800 TGATATAATGAGGCCATGGAGGG - Intronic
1053069639 9:35093496-35093518 CCACAAATGGAGACCATGGAGGG - Exonic
1055460514 9:76515794-76515816 ACAAATATTGAGGCCAAGCATGG - Intergenic
1055777346 9:79780681-79780703 CCAGAGATTGAGGCCAAGAAGGG - Intergenic
1056275652 9:84991904-84991926 CCCTGGACTGAGGCCATGGAAGG - Intronic
1186715976 X:12251730-12251752 ACATATATTTAGGCCAGGCAGGG + Intronic
1187474745 X:19601085-19601107 CCATATATGAAGACTATGGAAGG - Intronic
1188024661 X:25195489-25195511 CCATATACTGAGGGCAGGGAGGG + Intergenic
1189508901 X:41641439-41641461 CTATATATTAAGGCTATAGAGGG + Intronic
1190405937 X:50087694-50087716 CCCTGTATTGAGGGGATGGATGG - Intronic
1190470927 X:50778706-50778728 GCACTTATTGAGGGCATGGATGG - Intronic
1201529513 Y:14976788-14976810 GCATTCATTGAGTCCATGGATGG + Intergenic