ID: 902782472

View in Genome Browser
Species Human (GRCh38)
Location 1:18713305-18713327
Sequence CAGTAGGACCACAGGCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 237}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902782466_902782472 10 Left 902782466 1:18713272-18713294 CCACACACCACTGTTGTCAGGGA 0: 1
1: 0
2: 1
3: 16
4: 159
Right 902782472 1:18713305-18713327 CAGTAGGACCACAGGCAGCATGG 0: 1
1: 0
2: 2
3: 24
4: 237
902782468_902782472 3 Left 902782468 1:18713279-18713301 CCACTGTTGTCAGGGACCATGGT 0: 1
1: 0
2: 0
3: 12
4: 151
Right 902782472 1:18713305-18713327 CAGTAGGACCACAGGCAGCATGG 0: 1
1: 0
2: 2
3: 24
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902782472 Original CRISPR CAGTAGGACCACAGGCAGCA TGG Intronic
900502890 1:3015295-3015317 CTGGAGGAACACAGGCAGGAGGG - Intergenic
901238034 1:7678060-7678082 GCGAAGGACCCCAGGCAGCAAGG + Intronic
901899406 1:12345970-12345992 CACTGGGACTACAGGCAGGAAGG - Intronic
902553888 1:17235448-17235470 CGGTAGGACCTCAGGCAGGAGGG + Intronic
902782472 1:18713305-18713327 CAGTAGGACCACAGGCAGCATGG + Intronic
904395597 1:30219390-30219412 CAGCAGGACCAAGGTCAGCAAGG + Intergenic
904492785 1:30870932-30870954 CAGCAGCACCCCAGGGAGCAGGG + Intronic
905282241 1:36856603-36856625 CTGTGGGACCACAGGTACCACGG + Intronic
905295497 1:36951864-36951886 CGGGAGGACCACAGGAGGCAGGG + Intronic
906135814 1:43500095-43500117 CAGCTGCATCACAGGCAGCAGGG - Intergenic
906942455 1:50267411-50267433 CAGCAGGAGCAAAGGCAGGAAGG - Intergenic
909345760 1:74584509-74584531 CAGAAAGACCACAGGGAGCAGGG - Intronic
915803316 1:158817761-158817783 CACTAGGACCTCAGGCACCTGGG + Intergenic
917203682 1:172545555-172545577 CAGAGGTACCACATGCAGCAGGG + Intronic
918183333 1:182105446-182105468 CAGTAGGACCACAGGGAAGGAGG + Intergenic
919777684 1:201205014-201205036 CAGTGTGACCTAAGGCAGCAAGG - Intronic
921067675 1:211634099-211634121 CAGCAAGACCACAGGCAGTGTGG + Intergenic
922616462 1:226963929-226963951 GAGTAGTGCCACAGCCAGCAGGG + Intronic
923772370 1:236948730-236948752 TACAAGGACAACAGGCAGCAGGG - Intergenic
1062824668 10:558895-558917 CAGCAGGACCCCAGACACCACGG + Intronic
1063004196 10:1952734-1952756 GAGTAAGACAACAGGCCGCAAGG - Intergenic
1063759447 10:9056769-9056791 CAGGAGCACCACATGCAGCCTGG - Intergenic
1064749958 10:18518370-18518392 CACTAGGACCACTGGTCGCATGG - Exonic
1065261127 10:23924610-23924632 CAGTAGGACCATAGCGAGCTGGG + Intronic
1066474414 10:35731192-35731214 CAGCAGGAACCCAGGCAGGAGGG - Intergenic
1069007365 10:63333415-63333437 CATTGGGACCACAGCCACCATGG - Intronic
1070962157 10:80506897-80506919 CAGTTTGACCACAGGCCACAGGG + Intronic
1073249641 10:102114023-102114045 CAGCAGGAGTAGAGGCAGCAAGG + Intronic
1075734952 10:124658856-124658878 CAGTGGGGGCACAGGGAGCAGGG - Intronic
1076891034 10:133283552-133283574 CCCTAGGACGGCAGGCAGCAAGG + Intronic
1077130534 11:970072-970094 CAGCAGTACAGCAGGCAGCACGG - Intronic
1077273865 11:1694241-1694263 CAGTAGGGCCCAAGGCTGCAGGG - Intergenic
1079259748 11:18866957-18866979 CAGTAGGACCACAAGAATGAGGG + Intergenic
1080761187 11:35250457-35250479 CAGTAGGATCACACCCAGCATGG - Intergenic
1084362388 11:68677480-68677502 CAGGAGGAGGACAGGCAGCTGGG - Intergenic
1084627226 11:70317763-70317785 CAGTAGTAACTCAGGCTGCATGG + Intronic
1087678070 11:101185441-101185463 AAGCAAGACCAGAGGCAGCAAGG + Intergenic
1089539739 11:119182568-119182590 CAGTGGGACCAGAGACAGTAGGG - Intronic
1089742621 11:120595181-120595203 CAGCACGACCACGGGCTGCAAGG - Intronic
1090902651 11:131046410-131046432 CAGGGGAACCACTGGCAGCATGG - Intergenic
1096079687 12:48825197-48825219 CACCAGCACCACAGGCCGCATGG - Exonic
1096147486 12:49289230-49289252 AAATAGGACCACAGGGACCAAGG + Intergenic
1097261481 12:57722867-57722889 CAGATGGACCAGAGGAAGCAGGG - Intergenic
1102181174 12:110913371-110913393 CACTGGCACCCCAGGCAGCAGGG + Intronic
1102474725 12:113181098-113181120 CAGTGGGACCACAGGGGGCAGGG + Intronic
1102566971 12:113803245-113803267 CAGCAGAGCCACAGGCAACAAGG - Intergenic
1104510139 12:129369950-129369972 CAGTGGGAGCACAGCCAGCGTGG + Intronic
1105519177 13:21116242-21116264 GAGCAGGACCACAGGGAGGAAGG - Intergenic
1108319711 13:49276966-49276988 GAGTAGGCCAGCAGGCAGCACGG + Intronic
1112660885 13:101506454-101506476 CTGAAAGACCACATGCAGCAAGG + Intronic
1113672714 13:112185728-112185750 CAGCAGGACGACAGGAAGCTTGG - Intergenic
1114605040 14:23989268-23989290 CAGTTGTGCCAGAGGCAGCAGGG - Intronic
1114610494 14:24036828-24036850 CAGTTGTGCCAGAGGCAGCAGGG - Intergenic
1117050472 14:51854911-51854933 CAGTAAGACCTCAGGCTTCATGG + Intronic
1120475215 14:84978355-84978377 ACGTAGGACCACAGGAAGGATGG - Intergenic
1121820896 14:96964992-96965014 CAGAAAGATCACAGGCACCAGGG - Intergenic
1122027102 14:98886047-98886069 CAGGGTGACCACAGGCTGCAGGG + Intergenic
1122817102 14:104319229-104319251 CAGGAGGGCCACAGGCTGCTGGG + Intergenic
1124203018 15:27694492-27694514 CTGTAGGATTACAGGAAGCATGG - Intergenic
1124580897 15:30954029-30954051 CAGAGGCACCACTGGCAGCAGGG - Intronic
1125423954 15:39531379-39531401 CAGCAGGACCTCAGCCTGCAGGG - Intergenic
1125501231 15:40241336-40241358 CAGGAAGACCCCAGGCAGAACGG - Intronic
1126122348 15:45264992-45265014 CAGTAGGTCCTCAGGACGCATGG + Intronic
1129656036 15:77526418-77526440 GAGAGGGACCACAGGCAGAAGGG + Intergenic
1129705877 15:77793991-77794013 CAGGAGGGCCACAGTCAGCTGGG - Intronic
1129781182 15:78272480-78272502 CAGGAGCTCCACGGGCAGCAGGG + Intronic
1129968538 15:79757813-79757835 CTGGGGGACCAGAGGCAGCACGG + Intergenic
1131225744 15:90623354-90623376 CACTAGGAAGACATGCAGCAGGG - Intronic
1132375345 15:101325047-101325069 CTGTAGGAGCAAAGGCAGGAGGG + Intronic
1132556971 16:576812-576834 CTGAAGGCCCAGAGGCAGCATGG - Intronic
1134376741 16:13682972-13682994 CATTAGGATCACAGGCTGCAGGG - Intergenic
1135586633 16:23676699-23676721 TAGTAGGACCACATGCAAAAGGG - Exonic
1136385797 16:29925433-29925455 GAGTAGTACTGCAGGCAGCAGGG + Intronic
1137529642 16:49270364-49270386 AAGTAAGACAAAAGGCAGCAAGG + Intergenic
1137575835 16:49599750-49599772 CACAAGGACCACAGGATGCATGG + Intronic
1137643726 16:50056503-50056525 GAGTTGGTCAACAGGCAGCAGGG + Intergenic
1138646859 16:58431867-58431889 CAGTAAGCACCCAGGCAGCAAGG - Intergenic
1139311317 16:66030546-66030568 CAGAAGAACCACATCCAGCAAGG - Intergenic
1139909834 16:70390966-70390988 CACTAGGAACACAGGGAGCCAGG + Intronic
1141288916 16:82699321-82699343 CAGGAGGACCACCGGTAGTAGGG + Intronic
1142196888 16:88743126-88743148 CAGTGGGGCCACAGGCAGCTGGG - Intronic
1142234485 16:88915371-88915393 CAGGAGCTCCACAAGCAGCATGG + Intronic
1143842799 17:9746742-9746764 CTGTAGTACTACAGGTAGCAAGG + Intergenic
1145250724 17:21295628-21295650 CAGGAGGGCCACAGGCTCCATGG - Intronic
1147794058 17:43030218-43030240 CAGTGGGACCAGAGCCAGGAAGG - Intergenic
1149601968 17:57898990-57899012 CAGCAGGAGCACAGGCAGAGTGG + Intronic
1151549229 17:74812295-74812317 CTGAAGGACCACAGGCTTCAGGG - Intronic
1152064775 17:78104805-78104827 GAGCAGGTCCCCAGGCAGCAGGG - Exonic
1152400903 17:80065610-80065632 CTGCAGGGCCACAGGCAGCGAGG + Intronic
1152562312 17:81084716-81084738 CCCTGTGACCACAGGCAGCAGGG - Intronic
1153665803 18:7366990-7367012 GAGTGGCACCACTGGCAGCATGG - Intergenic
1154331164 18:13430003-13430025 GAGCACGGCCACAGGCAGCAAGG - Intronic
1155204233 18:23543810-23543832 CACTCGGAACACAGGCGGCAGGG + Intronic
1156160295 18:34350944-34350966 CAGGAGGGGCAGAGGCAGCAGGG - Intergenic
1157386243 18:47261562-47261584 AAGTAGGACCAGGGGCAGGAGGG + Intergenic
1157618606 18:49002438-49002460 CAGCAGAAACAGAGGCAGCAGGG - Intergenic
1157913888 18:51645488-51645510 CAGTGGGTCCAGAAGCAGCATGG + Intergenic
1158178895 18:54689482-54689504 CAGTAGGACTTCAGAGAGCAAGG - Intergenic
1159384930 18:67710793-67710815 CAGTAGGACACCACGCAGCAGGG - Intergenic
1159583423 18:70260749-70260771 CTGCAGGTCCACAGGCAGGAAGG + Intergenic
1159961105 18:74556345-74556367 CAGCAGCAGCACAGCCAGCAGGG - Exonic
1160537952 18:79604918-79604940 CAGGGGGACCACAGGCCTCAGGG + Intergenic
1160974244 19:1784894-1784916 CAGCAGGACCACCAGCAGGATGG + Exonic
1162013803 19:7832796-7832818 CAGGAGGACCACGGGGAACAGGG + Intronic
1162373696 19:10293130-10293152 CAGCAGGCCCAGAGCCAGCACGG - Exonic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1165258789 19:34596309-34596331 CTGCAGGACCACAGGTGGCAGGG - Exonic
1165324733 19:35107889-35107911 CAGTAGGCCCACAGACAGAAAGG - Intergenic
1166154252 19:40899041-40899063 CTGTATGAACACAAGCAGCAGGG + Intergenic
1166173856 19:41051541-41051563 CTGTATGAACACAAGCAGCAGGG - Intergenic
1168073024 19:53963123-53963145 CAGTTTGACCACGGGCAGCCGGG - Exonic
925796851 2:7554868-7554890 CAGCTGAAGCACAGGCAGCATGG + Intergenic
927082375 2:19643202-19643224 CAGTTTCACCAAAGGCAGCATGG - Intergenic
927739665 2:25557186-25557208 AAGTAGATCCACAGGCAGCCAGG + Intronic
928306736 2:30176513-30176535 CAGTAGGACCAATGGGAGCCGGG - Intergenic
930755371 2:54967555-54967577 CAAGAGGACCACAGGGAACAGGG + Intronic
931356726 2:61543586-61543608 CAGTAGGACCACTTGGAGCCAGG - Intergenic
932803400 2:74762559-74762581 CAGGAGGACTAAAGGCAGCAAGG - Intergenic
937124511 2:119464864-119464886 CAGAAGGAACACAGGCTGCGGGG + Intronic
937158958 2:119742093-119742115 GAGTAGGGCCCCAGGCACCAAGG - Intergenic
937905371 2:127050370-127050392 CAGGGGGACCACAGGCATCCTGG - Intronic
937956895 2:127426711-127426733 CAGTGGGACCACAGCCAGGACGG + Intronic
938564271 2:132503910-132503932 CATTAGGACTACAGGCTGCTTGG - Intronic
939041972 2:137200761-137200783 CAGGAGGACCACTGGAAGCCAGG - Intronic
942401643 2:175609453-175609475 CAGTAGGAACAAAGGAAGCTGGG - Intergenic
942563458 2:177244502-177244524 AAGTAGAAGCCCAGGCAGCATGG + Intronic
945932261 2:215866759-215866781 CAGTGGGACGACAGAAAGCAGGG + Intergenic
947425641 2:229980741-229980763 CAGCAGGAACACAGCCAGCAGGG - Intronic
948124423 2:235554486-235554508 CAGCAGGCCCACATGCAGCAGGG - Intronic
948309011 2:236971276-236971298 CAGTCGGAGCCCAGGCAGCCAGG - Intergenic
1168948426 20:1780355-1780377 GAGAAGGACCTCAGGCAGGAAGG + Intergenic
1172193103 20:33074213-33074235 CACTAGCACCCCAGGAAGCAAGG + Intergenic
1174009639 20:47439201-47439223 CACCAGGACCACAGACACCAAGG - Intergenic
1174538394 20:51270622-51270644 CAGAAGTACCCCAGGCAGCATGG - Intergenic
1174545413 20:51321545-51321567 CAGTCTGACCACAGACACCACGG - Intergenic
1176241151 20:64076543-64076565 CAGCACCAGCACAGGCAGCAGGG + Exonic
1178508719 21:33184224-33184246 GAGAGGTACCACAGGCAGCAAGG - Intergenic
1179544283 21:42104106-42104128 CTGGAGGACACCAGGCAGCAGGG - Intronic
1179591961 21:42414899-42414921 CAGCATGAACCCAGGCAGCATGG - Intronic
1180695750 22:17750425-17750447 CAGGAAGACCTCAGGCATCAGGG + Intronic
1180927823 22:19568259-19568281 CAGTAGGAACGCAAGCAGGAAGG + Intergenic
1183316964 22:37142180-37142202 CAGCAGGAGCAGAGGCAGAATGG + Intronic
1184126659 22:42492103-42492125 CAGGAGGACAAGAGGCAGGACGG - Intergenic
1184786921 22:46676492-46676514 CACTGGGCACACAGGCAGCAGGG - Intronic
1185122460 22:48980463-48980485 CAGGTGGACCCCTGGCAGCAGGG - Intergenic
1185343417 22:50301355-50301377 CAGGAGGTCCTCAGGAAGCACGG - Intronic
949931174 3:9079614-9079636 CTGTAGGACCATAGGCAGGTGGG - Intronic
950446795 3:13043209-13043231 CAGAGGGACCCCAGGCAGAATGG + Intronic
951025434 3:17823830-17823852 CAGCAGGTTCACAGGCAACAAGG - Intronic
951674244 3:25218712-25218734 CATAAGGATCACAGGGAGCAGGG - Intronic
952698435 3:36298205-36298227 CAGTGGCACAATAGGCAGCAAGG + Intergenic
953301888 3:41785866-41785888 GAGTTGGAGCACAGCCAGCAGGG - Intronic
953933676 3:47021168-47021190 CAGTAAGACCTTAGGTAGCAAGG + Intronic
954139302 3:48596653-48596675 CAATAGGAAAGCAGGCAGCATGG - Intergenic
955800465 3:62680996-62681018 CAGCAGGATCACAGGGAACATGG - Intronic
956111980 3:65878976-65878998 CAGCAGGAGCTCAGGCAGCAGGG - Intronic
958991625 3:100852616-100852638 CAGCAGGACCAGAAACAGCAGGG + Intronic
961450004 3:126998409-126998431 CTGTGGGGACACAGGCAGCAGGG - Intronic
961966410 3:130909176-130909198 CCTTAGTACCACAGGCAGTAAGG + Intronic
964611300 3:158618888-158618910 CAGTCTGGCCACAGGCAGTAAGG - Intergenic
967509814 3:190296960-190296982 CAGTAGGACCACAGTCAGAATGG + Intergenic
969156211 4:5212382-5212404 CAGTAAGCCCACAGACAGTAGGG - Intronic
969433057 4:7167235-7167257 CAGGAGCAGCACAGTCAGCAAGG - Intergenic
970176032 4:13340247-13340269 CAGTAGCAGCACATGCACCATGG - Intergenic
970820209 4:20203445-20203467 CAAAAGGACCAAAGGCAGAAAGG + Intergenic
970885210 4:20980106-20980128 CAGTAGAAGCACAGGTAGAAAGG - Intronic
977976143 4:103268997-103269019 CTTTAGGACTACAGGCTGCATGG - Intergenic
981195904 4:141920110-141920132 CAGTGGGACCACAGGGAGTGGGG - Intergenic
984587034 4:181576623-181576645 CAGCAGAACCACAGGAAGGAAGG + Intergenic
990599831 5:57347042-57347064 CATAAGGACCATAGGCAGCATGG + Intergenic
991359357 5:65803378-65803400 CAGTAGGGGCTGAGGCAGCAAGG + Intronic
992634950 5:78718379-78718401 CAGCAGGACAGCAGGCAGCATGG - Intronic
994322868 5:98413506-98413528 CAATAATACCACAGTCAGCATGG + Intergenic
997517963 5:134504294-134504316 CAGGAAGCCCACAGGTAGCAAGG + Intergenic
998098231 5:139409902-139409924 CACTAGGACCAAAGCCAGCAAGG + Intronic
998528191 5:142861456-142861478 CACTAATACCACAGGAAGCAAGG - Intronic
1000778801 5:165453690-165453712 CAGGAGGACCACTTGCAGCCAGG + Intergenic
1001152247 5:169242264-169242286 CATTAGAAACACAGGCAGCTGGG - Intronic
1002069106 5:176668312-176668334 CTCTGGGACCACAGGCAGGAAGG - Intergenic
1002292062 5:178206741-178206763 CAGAAGGAGCACAGGCTGGATGG + Exonic
1003485514 6:6573724-6573746 GAATTGGACAACAGGCAGCATGG + Intergenic
1004037275 6:11935643-11935665 CAGCATGTCAACAGGCAGCAGGG - Intergenic
1006079370 6:31556426-31556448 AAGTAGGTCCACAGGAAGGAAGG + Intronic
1006285294 6:33088704-33088726 CAGCAGGATCAAAGGCAGCCAGG + Intergenic
1006290389 6:33130940-33130962 CAGGAGGATCATAGGCAGCCAGG + Intergenic
1006375049 6:33667399-33667421 CAGTAGGGCACCAGACAGCAGGG + Intronic
1007838442 6:44696318-44696340 CTGTAGGACAACAGGCAACATGG + Intergenic
1008206911 6:48671479-48671501 CAGTAGACCCAGAGTCAGCAAGG + Intergenic
1009681761 6:66902675-66902697 CTGTATGACCATAGGCAGCACGG - Intergenic
1009850892 6:69196879-69196901 CAGAAGGAGCACAGGCATTAGGG + Intronic
1010101315 6:72111713-72111735 GAGTAGGATGCCAGGCAGCAGGG + Intronic
1011541202 6:88432125-88432147 CAGTAGGAGCAGAGGCAGAGAGG - Intergenic
1012549659 6:100455367-100455389 CAGGAGGACCCCAGGGACCAGGG - Intronic
1013393689 6:109713284-109713306 CAGCAGCAGCAGAGGCAGCATGG + Intronic
1013604199 6:111732828-111732850 CAGCAGGACCACAGGATGGAAGG + Intronic
1016848564 6:148593539-148593561 CAATGGGGCCCCAGGCAGCAGGG - Intergenic
1016967033 6:149728723-149728745 CGGTTGGAGCTCAGGCAGCAGGG - Intronic
1017864886 6:158434764-158434786 TAGGAGGACCACACTCAGCATGG - Intronic
1019353801 7:568621-568643 CTGCAGGACCACAGCCACCACGG + Intronic
1019474782 7:1238818-1238840 CTGCAGGACCCCAGGAAGCAGGG - Intergenic
1019640041 7:2098472-2098494 TGGTGGGACCCCAGGCAGCAGGG - Intronic
1020341583 7:7116927-7116949 CAGCAGGACCACAGGCAATTTGG + Intergenic
1022368768 7:29751173-29751195 TAGGAGGGGCACAGGCAGCAAGG - Intergenic
1022666243 7:32413983-32414005 CAGGAGGACCACTTGCAGCCAGG + Intergenic
1023159303 7:37282196-37282218 CAGGAGGTCCACAGGGAGGAAGG + Intronic
1023520776 7:41048197-41048219 CACTAGGACCCCAAGCAGCTTGG + Intergenic
1023996120 7:45159950-45159972 CAATATGACCACAGGTAACATGG - Intronic
1024983877 7:55179549-55179571 CAGGAGGACCAGAGGCTGGAGGG + Intronic
1025854788 7:65267404-65267426 GGGAAGGAGCACAGGCAGCAGGG - Intergenic
1026261088 7:68755974-68755996 GAGTTGGTCAACAGGCAGCAGGG + Intergenic
1029431423 7:100533446-100533468 CAGGGGGAGCACAGCCAGCATGG - Intergenic
1030553678 7:110996464-110996486 CTGTAGGATGACAAGCAGCAAGG + Intronic
1031500279 7:122506081-122506103 AAGTGGGAGCACAGGGAGCAGGG - Intronic
1032472141 7:132186247-132186269 CAGTAGGACCAGGGGAGGCAAGG + Intronic
1032893991 7:136230717-136230739 CAGTAGCACCAAATGCTGCAAGG - Intergenic
1033014777 7:137661217-137661239 CAGTAGGAAAAGAGCCAGCATGG + Intronic
1033261878 7:139851034-139851056 CAGTAAGACCAACGGGAGCAAGG - Intronic
1033763865 7:144466046-144466068 GCGTAGGGACACAGGCAGCAGGG - Intronic
1033910744 7:146260383-146260405 CAGTAGATCCACAGACAGCTTGG + Intronic
1035741496 8:1931183-1931205 TGGTAGGAACACAGGCAGCAGGG - Intronic
1035877471 8:3207002-3207024 CAGTCAGGCCACAGCCAGCATGG - Intronic
1036661358 8:10711126-10711148 CAGGAAGACCACATGCTGCAGGG + Intronic
1037821593 8:22137726-22137748 CAGTGGGAGCACAGGCAGGAGGG - Intergenic
1037962131 8:23105548-23105570 CAGAAGGACAACTGGAAGCATGG - Intronic
1038055485 8:23853832-23853854 CAGGAGGGAGACAGGCAGCAGGG + Intronic
1040697753 8:50022749-50022771 CAGTGGGAACAGAGGCAACATGG - Intronic
1041132708 8:54719142-54719164 CAGAGGGGCCATAGGCAGCATGG - Intergenic
1047429269 8:124776495-124776517 GAGTGGTACCCCAGGCAGCAAGG - Intergenic
1048918994 8:139210775-139210797 CAGGAAGACCAGAGGCATCACGG + Intergenic
1049545216 8:143227694-143227716 CAGCAGGACCACCGGCACCCAGG + Intergenic
1049838203 8:144753981-144754003 CAGTGGGGCCACTGGCAACAGGG + Intronic
1050181900 9:2932421-2932443 CAGTAGTACCATGGGCAACAAGG + Intergenic
1050663062 9:7904968-7904990 CAGTATGAACCCAGGCAGCCTGG + Intergenic
1051586494 9:18732327-18732349 CAGTTAGACAACAGGAAGCAGGG + Intronic
1051842546 9:21414614-21414636 GAGAAGGGCCACAGGGAGCATGG + Intronic
1052043320 9:23766397-23766419 GAGCAGGACCACACCCAGCAGGG + Intronic
1052337845 9:27337941-27337963 CTCTAGGACCACAGGCAGCATGG - Intronic
1053334855 9:37258347-37258369 CAGGATGATCACAGTCAGCATGG + Intronic
1053366778 9:37528434-37528456 CAGCATGAGCAAAGGCAGCAGGG - Intronic
1053664546 9:40308308-40308330 AAGTGGGACCACAGGCACAATGG - Intronic
1054520068 9:66067976-66067998 AAGTGGGACCACAGGCACAATGG + Intergenic
1057206003 9:93173112-93173134 CAGTGGGGCCCCAGGCAGCCTGG - Intergenic
1058552706 9:106132537-106132559 CAGTTGCACCACAGGCATCATGG + Intergenic
1059283582 9:113154433-113154455 CAGTTTGAACAGAGGCAGCAAGG - Intronic
1060268410 9:122125592-122125614 CAGTGGGGCCCCAGGCAGGACGG + Intergenic
1060791154 9:126486603-126486625 CATTAGGCCCACAGGCAGGCCGG - Intronic
1061339375 9:129966890-129966912 CAGTTGGACCACTGGCCACAGGG + Intronic
1061471094 9:130826622-130826644 CATTAGTACCACAGAAAGCAGGG + Intronic
1062006181 9:134239622-134239644 CAGTGGGAACACAGGCGGGATGG - Intergenic
1062176135 9:135164112-135164134 CAGGAGGGGCACTGGCAGCAGGG + Intergenic
1187117899 X:16372180-16372202 TAGTAGGACGAGGGGCAGCAAGG - Intergenic
1187621749 X:21063379-21063401 CAGTAGCAGCACAGGCCACAGGG + Intergenic
1189318570 X:40073500-40073522 CAGTAGCAGCACCAGCAGCAAGG - Exonic
1190098794 X:47504381-47504403 CAGTAGGACCCCATGCAGCCAGG - Intergenic
1192336152 X:70221524-70221546 AAGTAGGACCTCAGGGATCAAGG + Intergenic
1194346719 X:92773995-92774017 CAGCAGCAGCAAAGGCAGCATGG - Intergenic
1196929306 X:120665204-120665226 CTATAGGACCACAGGCATGAAGG + Intergenic
1198299834 X:135324695-135324717 CATTAGTATCACCGGCAGCAGGG + Intronic
1198506114 X:137302921-137302943 CAGCTGGACCACAGGAAGCAGGG - Intergenic
1199634401 X:149802137-149802159 CAGTAGGACCTGACACAGCAGGG + Intergenic
1200055079 X:153456015-153456037 CAGGAGGACCACGTGCGGCAAGG + Intronic
1200655052 Y:5890639-5890661 CAGCAGCAGCAAAGGCAGCATGG - Intergenic
1201362550 Y:13168650-13168672 CAGCAGGGCCACATGCATCAGGG + Intergenic