ID: 902783092

View in Genome Browser
Species Human (GRCh38)
Location 1:18716942-18716964
Sequence GGCCGGGCGGACCCAAGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902783077_902783092 23 Left 902783077 1:18716896-18716918 CCGCTGCTGGTGGGCTCCGAGGC 0: 1
1: 0
2: 0
3: 26
4: 260
Right 902783092 1:18716942-18716964 GGCCGGGCGGACCCAAGTCCAGG 0: 1
1: 0
2: 1
3: 10
4: 115
902783086_902783092 -5 Left 902783086 1:18716924-18716946 CCGGGCGCGGGCTCCCGAGGCCG 0: 1
1: 0
2: 4
3: 29
4: 214
Right 902783092 1:18716942-18716964 GGCCGGGCGGACCCAAGTCCAGG 0: 1
1: 0
2: 1
3: 10
4: 115
902783083_902783092 7 Left 902783083 1:18716912-18716934 CCGAGGCAGGGACCGGGCGCGGG 0: 1
1: 0
2: 0
3: 32
4: 279
Right 902783092 1:18716942-18716964 GGCCGGGCGGACCCAAGTCCAGG 0: 1
1: 0
2: 1
3: 10
4: 115
902783075_902783092 26 Left 902783075 1:18716893-18716915 CCTCCGCTGCTGGTGGGCTCCGA 0: 1
1: 0
2: 0
3: 10
4: 112
Right 902783092 1:18716942-18716964 GGCCGGGCGGACCCAAGTCCAGG 0: 1
1: 0
2: 1
3: 10
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902783092 Original CRISPR GGCCGGGCGGACCCAAGTCC AGG Intronic
900170495 1:1265985-1266007 GGTCAGGCGTCCCCAAGTCCCGG - Intronic
900349425 1:2227748-2227770 GGCCGAGCGTAGCCGAGTCCCGG + Intergenic
900349431 1:2227769-2227791 GGCCGAGCGGAGCCGAGTCATGG + Intergenic
900654222 1:3747142-3747164 GGCCCCGGGGACCCAAGGCCGGG + Intergenic
902783092 1:18716942-18716964 GGCCGGGCGGACCCAAGTCCAGG + Intronic
903919241 1:26787889-26787911 GGCGGGGCTGCTCCAAGTCCGGG + Intronic
906204363 1:43979269-43979291 GGCCGGGCAGACCCACGGACCGG - Intronic
906696956 1:47829510-47829532 GTCCGGGCTGACCCCAGCCCAGG - Intronic
912354315 1:109042291-109042313 GGCGGGGCGGACCAAAGCCTGGG + Intergenic
912354323 1:109042312-109042334 GGCGGGGCGGACCAAAGCCTGGG + Intergenic
913042568 1:115041478-115041500 GGCAGGGCAGACCCAATTCTTGG + Intergenic
913230357 1:116735966-116735988 GGCCGGGAGTTCCCAAGCCCTGG + Intergenic
922696776 1:227734952-227734974 GGCCGGCGGGACCCAGGCCCGGG - Intronic
1067478091 10:46579226-46579248 GGCGGGGCGGAGGCAAGTGCTGG - Intronic
1067616649 10:47762561-47762583 GGCGGGGCGGAGGCAAGTGCTGG + Intergenic
1077483259 11:2826481-2826503 GGCCTGGCGCACCCAACGCCGGG - Intronic
1077500887 11:2909361-2909383 GGCCGGGGGGACTGGAGTCCAGG + Intronic
1077524857 11:3057813-3057835 GGCAGGGCGGTCCCTAGGCCTGG - Intergenic
1081804935 11:45885493-45885515 GGCGGGGCTGAACCAAGCCCAGG + Intergenic
1081899770 11:46617820-46617842 GGCTGGTCGGTCCCAGGTCCCGG + Exonic
1083257937 11:61508245-61508267 GGCGGGGCGGAGCCAAGCCCTGG + Intergenic
1084539134 11:69775546-69775568 GGCCGGGCGGAGCCAAGGGTGGG - Intergenic
1093894763 12:24563145-24563167 GGCCGGGAGGGGCCAGGTCCTGG - Intergenic
1096623306 12:52877994-52878016 GGCCCGGCAGACCCAGGTGCTGG + Intergenic
1103919581 12:124392555-124392577 AGCCGGGCAGACCCAAACCCAGG + Intronic
1106432414 13:29693783-29693805 GGCAGGGTGGAGCCAAGTGCAGG + Intergenic
1115398953 14:32938023-32938045 GGCAGTCCGGTCCCAAGTCCCGG + Intronic
1115852660 14:37599850-37599872 GGCCGCGGGGACCCAGGTCTGGG - Intronic
1121529370 14:94641596-94641618 GGCCAGCAGGACCCAACTCCTGG + Intergenic
1122647866 14:103207180-103207202 AGCCGGGTGGAAGCAAGTCCAGG + Intergenic
1122651704 14:103230121-103230143 GGCCGGGCGGCCTCATGTGCAGG + Intergenic
1122790679 14:104182993-104183015 GGCAGGGAGGACCCAGGTCCAGG - Intergenic
1124250489 15:28103930-28103952 GGAGGGGCTGGCCCAAGTCCCGG + Intergenic
1127973813 15:63982726-63982748 GGCCGTGTGGACTCAAGTCCTGG + Intronic
1128579147 15:68796726-68796748 GGCAAGGCGGACCAAAGCCCAGG - Intronic
1130260275 15:82348960-82348982 GGGCTGGGGGACCCAGGTCCTGG + Intronic
1130268455 15:82430473-82430495 GGGCTGGGGGACCCAGGTCCTGG - Intronic
1130280958 15:82520047-82520069 GGGCTGGGGGACCCAGGTCCTGG - Intergenic
1130472328 15:84236228-84236250 GGGCTGGGGGACCCAGGTCCTGG - Intronic
1130479819 15:84350799-84350821 GGGCTGGGGGACCCAGGTCCTGG - Intergenic
1130483951 15:84387232-84387254 GGGCTGGGGGACCCAGGTCCTGG - Intergenic
1130491951 15:84437330-84437352 GGGCTGGGGGACCCAGGTCCTGG + Intergenic
1130503565 15:84516370-84516392 GGGCTGGGGGACCCAGGTCCTGG + Intergenic
1130594626 15:85240864-85240886 GGGCTGGGGGACCCAGGTCCTGG - Intergenic
1136024523 16:27461247-27461269 GGCTCGGCAGACCCAAGGCCAGG + Exonic
1136544871 16:30949209-30949231 AGCCGGGCCGGCCCAAGCCCGGG - Exonic
1137926524 16:52546750-52546772 GCCCCGGCGAACCCCAGTCCCGG - Exonic
1139602166 16:67993458-67993480 GGCTGGGCGGATCCCTGTCCTGG + Exonic
1148562547 17:48614223-48614245 GGCCGGAAGGGCCCAAGGCCTGG - Intronic
1148591067 17:48817110-48817132 GGCCGGGCGGACCCAAAGTTAGG - Exonic
1150477679 17:65487350-65487372 GGCCGGGAAGACCAAAGTCACGG + Intergenic
1150958963 17:69893617-69893639 AGCTGGGCAGTCCCAAGTCCAGG + Intergenic
1151469642 17:74309984-74310006 GGCCGGGCAGACCCAGGTAGAGG - Intronic
1152066102 17:78113269-78113291 GGCTGGGCGCAGCCAAGGCCCGG + Intronic
1152296319 17:79469290-79469312 TGCTGGGCGGGCTCAAGTCCAGG + Intronic
1155160257 18:23189733-23189755 AGCCAGGCGCTCCCAAGTCCTGG - Intronic
1160518564 18:79491531-79491553 GGCCGATCGGACACAAGGCCAGG + Intronic
1160709014 19:542247-542269 GGCCTGTCTGACCCAAGTCATGG - Intergenic
1161337340 19:3721693-3721715 GGCGGGGCTGACCCGAGACCTGG + Intronic
1161400758 19:4065606-4065628 GGGCGGGCGGACCCAGATCCGGG - Intronic
1162952842 19:14082038-14082060 GGCAGGGGGCACTCAAGTCCAGG - Intronic
1162967446 19:14162615-14162637 GGTCGGGCGGCCCGAACTCCAGG + Exonic
1163427427 19:17246863-17246885 GGTCGGGCGGGCCCCAGCCCCGG - Intronic
1163685851 19:18711248-18711270 GGCTGAGCTGACCCAAGGCCTGG - Intronic
1164989408 19:32673695-32673717 GGCCAGGAGTACCCAAGCCCTGG + Intronic
1165420096 19:35718182-35718204 GGCCGGGCGGAGCCGAGCCCGGG + Exonic
1166857921 19:45792482-45792504 GGCAGGGCGGGCCCGGGTCCGGG + Exonic
1168655670 19:58125807-58125829 GGCCTGGCTGACCCCAGTCCTGG + Intergenic
925754274 2:7118942-7118964 GGCAGGGCAGACCCATGACCAGG + Intergenic
931180618 2:59896685-59896707 GGCTTGGCTGACTCAAGTCCTGG + Intergenic
931516913 2:63055417-63055439 CGCCCCGCGGACCCAACTCCCGG - Intronic
934558738 2:95301252-95301274 GGCCTGGCTGACTCAAGTCAGGG + Intronic
937894904 2:126971366-126971388 GGCCAGGCCGACCCAAGGGCAGG - Intergenic
940450076 2:153826116-153826138 GGCTGGGAGGACCCAGGTCAAGG + Intergenic
943756590 2:191563587-191563609 GGCTGGGAAGAGCCAAGTCCAGG - Intergenic
946170691 2:217893681-217893703 GGCAGGGAGGAACCAAGTCCTGG - Intronic
946339985 2:219060615-219060637 GGCCGGCGGGACTCAAGTGCGGG + Intergenic
946431039 2:219627607-219627629 GGCCGGGCGGACGCAGGCGCCGG - Exonic
947625235 2:231614580-231614602 GGCTGGGAGGACGCAGGTCCTGG - Intergenic
948291045 2:236825065-236825087 AGCCAGGCGAACCCAAGGCCTGG + Intergenic
949004502 2:241637528-241637550 GGCCGGGCCGACGCGAGCCCCGG - Intronic
1172277010 20:33685452-33685474 GGCGGGGCGGAGGAAAGTCCTGG - Intronic
1172992656 20:39047819-39047841 GGCCAGGCGGGCCCCACTCCGGG - Intergenic
1175891989 20:62319774-62319796 GGCCGTGGGGACCCGAGACCAGG - Exonic
1175902777 20:62366637-62366659 TCCCTGGCGGCCCCAAGTCCGGG - Intronic
1178597835 21:33970867-33970889 GGCCTTCAGGACCCAAGTCCCGG + Intergenic
1179576311 21:42310532-42310554 GGCCGGGGGGACCACAGTGCAGG + Intergenic
1179882739 21:44300280-44300302 GGCCGGGCCGGCCCGAGACCCGG - Intronic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
1181064705 22:20299871-20299893 GCCCTGGCCGACCCACGTCCTGG - Intergenic
1182451710 22:30425796-30425818 GGCCGGGCAGACCCAAGTGCCGG + Exonic
1183370227 22:37427809-37427831 GGCCTGGCGGACCCCTGTCCCGG + Intergenic
1183379061 22:37481701-37481723 GGCCGGGCAGTCCCAGGGCCGGG - Intronic
1183591230 22:38780400-38780422 GGCCTGGCCGACCCAAAGCCTGG + Intronic
1185271207 22:49929922-49929944 GGCCCTGCAGACCCCAGTCCTGG - Intergenic
951806419 3:26649192-26649214 GGCCAGGCTGTCCCAAGTACAGG + Intronic
952287433 3:31981713-31981735 GGCCGGGCGGGTCCATATCCGGG - Intronic
956902399 3:73730306-73730328 GGCTTGGCTGACCCAAGACCAGG - Intergenic
958462556 3:94418135-94418157 GGGCGGGCAGAGACAAGTCCTGG - Intergenic
977908292 4:102501663-102501685 GCCCGGGCGGGCCCGAGTGCGGG - Exonic
984801830 4:183723063-183723085 GGCGGGGCGCACCGTAGTCCTGG - Intergenic
985515644 5:343523-343545 GGCGGGGCGCAGCCAAGGCCTGG - Intronic
985547887 5:519192-519214 GGCCCTGTGGACCCCAGTCCTGG - Intronic
995854127 5:116574844-116574866 TCCCGGGCGGAGCCAAGTCCCGG + Exonic
996242054 5:121215873-121215895 GGCCGGGCTGGCCTAACTCCAGG + Intergenic
998364311 5:141618899-141618921 CGCCGGGCGGCTCCATGTCCCGG + Exonic
1001213321 5:169831554-169831576 GGCCTGCCTGACTCAAGTCCAGG - Intronic
1002139797 5:177132170-177132192 AGCCGGGCGGTCCCGTGTCCCGG + Intergenic
1002196454 5:177504147-177504169 GGCCGGGCCAGCTCAAGTCCTGG + Exonic
1002312377 5:178322779-178322801 GACAGGGCTGACCCAACTCCCGG - Intronic
1002645084 5:180649047-180649069 GGAAGTGCGCACCCAAGTCCGGG + Intronic
1011955034 6:93016036-93016058 GGCCAGGTGCACCAAAGTCCTGG - Intergenic
1026964614 7:74431247-74431269 GGCCGGGCTGCCCCAGGGCCAGG + Intergenic
1029605735 7:101598527-101598549 GGCCGGGCGGGCCCACTTTCAGG + Intergenic
1032018370 7:128393568-128393590 GGCCGGGGGGGCCCAAACCCAGG + Intronic
1035729163 8:1842471-1842493 GGCCAGGCGGGCCCATGCCCAGG - Intronic
1039979154 8:42391943-42391965 GGCCGCGCGGGCTCCAGTCCCGG + Intronic
1057058580 9:91983092-91983114 TGCCTGCTGGACCCAAGTCCTGG + Intergenic
1061346208 9:130027672-130027694 GGCTGGGGGGACCCAACTGCTGG + Intronic
1061582385 9:131545906-131545928 GGCAGGGCGGGCCCAGGCCCGGG + Intergenic
1062558693 9:137129481-137129503 CGCCGGGCGGACCGAGGCCCGGG - Intergenic
1187406963 X:19013080-19013102 GCCCGTGCGGACCCAAGCCTGGG + Intronic
1192632879 X:72790683-72790705 GGCCAGGCAGACTCGAGTCCTGG - Intronic
1192648830 X:72930118-72930140 GGCCAGGCAGACTCGAGTCCTGG + Intronic
1200216382 X:154369846-154369868 GGCTGGGGGAACCCAAGTCTTGG + Intronic
1202374128 Y:24218064-24218086 GGGCTGGGGGACCCAGGTCCTGG + Intergenic
1202496653 Y:25452056-25452078 GGGCTGGGGGACCCAGGTCCTGG - Intergenic