ID: 902784994

View in Genome Browser
Species Human (GRCh38)
Location 1:18727543-18727565
Sequence CTCATCCCCCAGGTGATTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 173}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902784987_902784994 -4 Left 902784987 1:18727524-18727546 CCTTGCCCCAGTCCTGTCACTCA 0: 1
1: 0
2: 1
3: 39
4: 408
Right 902784994 1:18727543-18727565 CTCATCCCCCAGGTGATTCTGGG 0: 1
1: 0
2: 1
3: 16
4: 173
902784988_902784994 -9 Left 902784988 1:18727529-18727551 CCCCAGTCCTGTCACTCATCCCC 0: 1
1: 0
2: 5
3: 32
4: 338
Right 902784994 1:18727543-18727565 CTCATCCCCCAGGTGATTCTGGG 0: 1
1: 0
2: 1
3: 16
4: 173
902784986_902784994 18 Left 902784986 1:18727502-18727524 CCAGAAGTCGAGAGTCAAGGGTC 0: 1
1: 0
2: 0
3: 9
4: 97
Right 902784994 1:18727543-18727565 CTCATCCCCCAGGTGATTCTGGG 0: 1
1: 0
2: 1
3: 16
4: 173
902784989_902784994 -10 Left 902784989 1:18727530-18727552 CCCAGTCCTGTCACTCATCCCCC 0: 1
1: 0
2: 2
3: 16
4: 276
Right 902784994 1:18727543-18727565 CTCATCCCCCAGGTGATTCTGGG 0: 1
1: 0
2: 1
3: 16
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902784994 Original CRISPR CTCATCCCCCAGGTGATTCT GGG Intronic
900518257 1:3093476-3093498 CTCATTCCCCACTTGATTCCAGG - Intronic
900610604 1:3543049-3543071 CTCATCTCCCAGGGGAGGCTGGG - Intronic
900851845 1:5149975-5149997 CTCATCCCCCAAGAGATTAGGGG + Intergenic
901681995 1:10918463-10918485 TTTAGCTCCCAGGTGATTCTAGG + Intergenic
901973331 1:12925327-12925349 CTCAACCACCAGGTGAACCTGGG - Intronic
902011847 1:13276436-13276458 CTCAACCACCAGGTGAACCTGGG + Intergenic
902784994 1:18727543-18727565 CTCATCCCCCAGGTGATTCTGGG + Intronic
904563306 1:31413086-31413108 CACCTGCCCCAGGTGAGTCTGGG + Intronic
905010835 1:34746072-34746094 CCCATCTCCCAGGAGCTTCTTGG - Intronic
906150870 1:43587006-43587028 CTCATGCCCTAGGTGAACCTGGG + Intronic
906180959 1:43818367-43818389 CTCATCACTCAGGTGATCCAGGG + Intronic
906291609 1:44623049-44623071 CACATCTCCCAGGCCATTCTTGG - Intronic
911090218 1:94011776-94011798 CCCCTCCCCTAGGTGACTCTGGG + Intronic
912566279 1:110589754-110589776 TTCTTCCCCCAGGTGATTGAGGG - Intergenic
913171295 1:116234604-116234626 CTTAACTCCCAGGTGATTTTTGG - Intergenic
915555460 1:156658470-156658492 CTCTTCCCCATGGAGATTCTGGG + Intronic
915566969 1:156720272-156720294 CTCGTCTCCCAGGTTTTTCTTGG + Intergenic
915792930 1:158695064-158695086 CTCTACACTCAGGTGATTCTAGG - Intergenic
915913218 1:159927158-159927180 CTGACCCCCTAGGTGAGTCTGGG - Exonic
916435383 1:164773011-164773033 CTCATCTCCAAGGTAATTCTTGG + Intronic
916733415 1:167586299-167586321 CTTTTCCCCCAGGTATTTCTGGG + Intergenic
919038027 1:192341235-192341257 CCCATCCCCCAGGATAATCTAGG + Intronic
919068905 1:192728803-192728825 CTCTTCCTTCAGGTGATCCTGGG + Intergenic
922720550 1:227898245-227898267 CTCATCCTCCCAGTGATTCAAGG + Intergenic
923111950 1:230898067-230898089 TTCATCCCCAGGGTGAGTCTTGG - Intergenic
1066435237 10:35391511-35391533 CTCATCGCCCACTTGCTTCTAGG - Intronic
1070179460 10:73999354-73999376 CTCATAACCGAGGTGATTCCTGG + Intronic
1072614056 10:97037896-97037918 CTCCTCCCATAAGTGATTCTGGG - Intronic
1073187400 10:101624892-101624914 CTCATTCCCTAGGGGATTGTGGG + Intronic
1073485052 10:103812014-103812036 CTCTTCCCCTAGAAGATTCTGGG + Intronic
1073984189 10:109189446-109189468 CACATACCCCAAGTAATTCTGGG - Intergenic
1075288266 10:121205724-121205746 TTCTTCCCCTAAGTGATTCTGGG + Intergenic
1075427860 10:122355899-122355921 CTCACCCCCCAGGTAAAGCTTGG - Intergenic
1076330807 10:129664740-129664762 CTCTTCCCCCTGCTAATTCTGGG - Intronic
1076414441 10:130275471-130275493 CTCCTCCTCCAGGTGGCTCTGGG + Intergenic
1077285104 11:1762101-1762123 CTCATCCCACATCTGTTTCTGGG + Intronic
1077354251 11:2107750-2107772 CTCATCACCCAGGCTAATCTGGG + Intergenic
1077528966 11:3086381-3086403 CCCATCCTCCAGGTGGTTCGGGG + Intergenic
1077907749 11:6547045-6547067 CTCAGCCCCCAGGAGTTCCTGGG + Exonic
1078187868 11:9067914-9067936 CTCGCCCCGCAGGTGAGTCTTGG + Intronic
1078443992 11:11390483-11390505 CTCTTCCCCCAGAGGATGCTCGG - Intronic
1080920777 11:36707498-36707520 CTCACTCCCCAGCTGATCCTTGG - Intergenic
1081527187 11:43935109-43935131 CTCATCCTCCAGAGGATTCTAGG + Intronic
1081655232 11:44852859-44852881 CTCACCTCCCAGGAGACTCTTGG + Intronic
1081695155 11:45104615-45104637 CTCAGCCCCAAGGTGACTCATGG + Intronic
1084494303 11:69495217-69495239 CCCAACCCCCCGGTGCTTCTAGG + Intergenic
1085269277 11:75260716-75260738 CCCACCCCCCAGGGAATTCTAGG - Intergenic
1090507224 11:127329636-127329658 CTCCTTCCCCAAGTGTTTCTTGG - Intergenic
1094255189 12:28416084-28416106 CTCCTCACCCAGCTGCTTCTTGG + Intronic
1097393549 12:59045251-59045273 CTCATCCCCACCGTGATTCCTGG + Intergenic
1099024376 12:77447445-77447467 CTGATCCCTCACCTGATTCTTGG - Intergenic
1102680633 12:114688136-114688158 CTCATACCCCCGGTGAATCTTGG - Intergenic
1103808213 12:123591459-123591481 TTCATCCTCCAGGTAGTTCTTGG + Intronic
1104295246 12:127505863-127505885 CTCCCCCCCCAGGTGATGATGGG + Intergenic
1104536131 12:129620052-129620074 CTCATCCTCCAAGTGATCCACGG + Intronic
1107016565 13:35712147-35712169 ATCATCCCCTTGGTGAATCTGGG + Intergenic
1108354284 13:49616267-49616289 CTCATCACCCAGATTAGTCTTGG + Intergenic
1108579061 13:51813311-51813333 CTCTTCCCCCAGGGTATTCAAGG + Intergenic
1109575998 13:64259583-64259605 TTCATTCCCCAGGTAATTCTAGG - Intergenic
1110888229 13:80666005-80666027 CTCCTCCCCCAGGTGTTATTAGG - Intergenic
1113793116 13:113041197-113041219 TTCATCCCTCTGGTGACTCTGGG + Intronic
1119428845 14:74552625-74552647 CCCATCTCCCAGGTTATTGTGGG - Intronic
1119910910 14:78348551-78348573 CTCTTCCCCCATATGGTTCTTGG + Intronic
1122359115 14:101148432-101148454 CTCCTTCCCCAGGTCTTTCTTGG + Intergenic
1123721214 15:23063600-23063622 CTCCTTCCCCAGGAGATGCTAGG - Intergenic
1125195898 15:37045640-37045662 CTCATCCTCCCCGTGTTTCTGGG - Intronic
1129270799 15:74418299-74418321 CCCTTCCCCCAGGTGAATATCGG - Exonic
1130676617 15:85958433-85958455 CACTTCCCTCAGGTGCTTCTGGG - Intergenic
1133581851 16:7152157-7152179 CTCACCCCTGAGCTGATTCTTGG + Intronic
1136024497 16:27461131-27461153 CCCATCCCCCAGGCTCTTCTGGG - Exonic
1136580858 16:31149998-31150020 CTCCTCCCCCTTGTGATGCTTGG - Exonic
1136748433 16:32612640-32612662 CTCTCCCCCCTGGTGATTCCTGG - Intergenic
1136871013 16:33808329-33808351 CGCATCACCCATGTTATTCTCGG - Intergenic
1138448845 16:57081103-57081125 CTCATCCCCGAGGAGATTCCAGG - Exonic
1140881821 16:79205303-79205325 GTCATTCCCCAGGTGACACTAGG - Intronic
1141428868 16:83960710-83960732 GCCATCCCCCACGTGGTTCTGGG + Exonic
1203050568 16_KI270728v1_random:871845-871867 CTCTCCCCCCTGGTGATTCCTGG - Intergenic
1203101159 16_KI270728v1_random:1307729-1307751 CGCATCACCCATGTTATTCTCGG + Intergenic
1146297454 17:31661004-31661026 ACCAGCCCTCAGGTGATTCTAGG - Intergenic
1149491406 17:57087302-57087324 CCCATCTCCCAGTTGTTTCTAGG + Intronic
1149919865 17:60647880-60647902 CCCTTCCCCCAGGTGATTTGTGG + Exonic
1150373769 17:64662800-64662822 CTCCTCCACCAGGTGAGTCCCGG - Intergenic
1151320959 17:73352160-73352182 CTCATCACCCAGGACATTCATGG - Intronic
1151482779 17:74380075-74380097 CCCATCCCCCAGCTGAGCCTGGG + Intergenic
1151567202 17:74905312-74905334 CTCATACCCCAGGTAGTTCATGG - Intergenic
1152080918 17:78186808-78186830 CTTCTCTCCTAGGTGATTCTCGG - Exonic
1152337798 17:79707992-79708014 GTCAGCCCCCAGGTGCTCCTGGG + Intergenic
1154501795 18:15001076-15001098 CTCACCCCCCAGCTGGCTCTGGG - Intergenic
1154508794 18:15071483-15071505 CCCCTGCCCCTGGTGATTCTTGG - Intergenic
1162544849 19:11322817-11322839 CTCATCACACAGGTGATTACAGG + Exonic
1164955880 19:32384020-32384042 CTCATCCCCTAAGGGATTTTTGG - Exonic
1166300388 19:41909265-41909287 CTCACCCCTGAGGTGAGTCTGGG - Intronic
1166392036 19:42413774-42413796 GTCATCCCCCAGGTGGCCCTGGG + Intronic
1167998959 19:53429616-53429638 CCCTGCCCCCAGGTGATTCTAGG + Intronic
1168136024 19:54352354-54352376 CTCTTCCCCCAGGTGGTGCTTGG + Exonic
1168311592 19:55463577-55463599 CTCTTCCCCCAGGGCATGCTGGG + Intergenic
1168327265 19:55544794-55544816 CTCACCCCCCTGGTGAGGCTGGG + Exonic
927699755 2:25260281-25260303 GCCAGCCCCCAGATGATTCTGGG - Intronic
930938162 2:56981639-56981661 AGCATCCCCCAGGTGATGTTCGG + Intergenic
937318060 2:120944533-120944555 CTGATCCCCAAGGTGACTCTGGG - Intronic
937447972 2:121974953-121974975 CTCCTCCCTCATGTGATTCTTGG + Intergenic
938500974 2:131831243-131831265 CGCATCCCCCAGCTGGCTCTGGG - Intergenic
940266017 2:151839145-151839167 TATATCCCCCAGGTGATCCTCGG + Exonic
940984665 2:160040598-160040620 ACTATCTCCCAGGTGATTCTAGG + Intronic
943823313 2:192355893-192355915 CTCAGCATCCAGGTGTTTCTAGG - Intergenic
948015275 2:234684393-234684415 CTCCTCTGCCTGGTGATTCTTGG + Intergenic
948116276 2:235495763-235495785 CTGGTGCCCCAGGTGAGTCTTGG - Intronic
1170016219 20:11785316-11785338 CTCAGCCCTAAGGTGATCCTTGG + Intergenic
1173136168 20:40441084-40441106 CTATCTCCCCAGGTGATTCTAGG - Intergenic
1175877143 20:62235738-62235760 CTCATCCTGCAGGTGATTTGGGG - Intronic
1176789280 21:13300266-13300288 CCCCTGCCCCTGGTGATTCTTGG + Intergenic
1177988443 21:28008424-28008446 CCCCTGCCCCTGGTGATTCTTGG + Intergenic
1178559609 21:33626322-33626344 ATCATGCCCCATGGGATTCTGGG + Intronic
1181384478 22:22533881-22533903 CTCAACTCCCAGGTGACTCCGGG + Intergenic
1181553355 22:23653498-23653520 CTCACTCCCAAGGTGACTCTGGG - Intergenic
1182287065 22:29254850-29254872 CTCAGGCCCCAGGGGACTCTGGG + Intronic
1184931327 22:47683325-47683347 TTCATCCTTCAGATGATTCTAGG + Intergenic
1185065680 22:48630733-48630755 CTCATCGCCCCCGTGATTCAGGG - Intronic
953378359 3:42447589-42447611 CCCATCCCCCAGGTGCTTATTGG + Intergenic
953461666 3:43086123-43086145 CCAAGCTCCCAGGTGATTCTGGG + Intronic
953683922 3:45061172-45061194 CACCACCTCCAGGTGATTCTGGG - Intergenic
954235677 3:49255408-49255430 CTCAAACACCAGGTCATTCTGGG - Exonic
956869153 3:73399409-73399431 CCACTCCCCCAGGGGATTCTAGG + Intronic
957871257 3:86093071-86093093 TTCATCCCACAGGTGCTTTTTGG + Intergenic
960247594 3:115416609-115416631 CTCATCCTCCAGGAGCTTCCTGG + Intergenic
960418845 3:117418390-117418412 CTTATCTCCCAGGTTATTCTTGG - Intergenic
961042125 3:123684900-123684922 CTCATTCTCCTGGTGAGTCTTGG + Intronic
961506827 3:127375606-127375628 CAAGTTCCCCAGGTGATTCTCGG + Intergenic
961650336 3:128413855-128413877 CTCCTCCCACAGGTGATGTTGGG - Intergenic
961790244 3:129370975-129370997 AGCAGCCCCCACGTGATTCTGGG - Intergenic
963774377 3:149423253-149423275 ACCATCCCCCAGGTGATGCCTGG - Intergenic
970202151 4:13620909-13620931 CTCATCCCCCAAGGGACGCTTGG + Intronic
973250853 4:48058459-48058481 CTCATCCCCCAGGGGACATTTGG + Intergenic
980526109 4:133992844-133992866 AGCATCCCCCAGGTGATGTTCGG + Intergenic
982668836 4:158296676-158296698 AGCATCCCCCAGGTGATGTTTGG - Intergenic
983468319 4:168123509-168123531 CTCATCCCCCAAGTGATGGCTGG - Intronic
990776765 5:59312612-59312634 CTAGTCCCTCAGGAGATTCTGGG - Intronic
995027869 5:107445499-107445521 CTCATCCTCCAAGTGATTTATGG + Intronic
995638175 5:114219579-114219601 CTCATCTACCAGCTGAGTCTGGG + Intergenic
998257731 5:140601378-140601400 CTATTGCCCCAGGTGATTCAAGG + Intergenic
1001600218 5:172923644-172923666 GTCATCCCCCAGCTGACTGTGGG + Intronic
1001722515 5:173868315-173868337 CTCTATCCCCACGTGATTCTTGG - Intergenic
1001788113 5:174431259-174431281 CACAACCCCCAGCTGGTTCTGGG + Intergenic
1001990307 5:176111028-176111050 CTCTCCCCCCTGGTGATTCCTGG - Intronic
1002226565 5:177727112-177727134 CTCTCCCCCCTGGTGATTCCTGG + Intronic
1002267279 5:178044101-178044123 CTCTCCCCCCTGGTGATTCCTGG - Intronic
1004568775 6:16824773-16824795 CTCATCCTCCAGGATTTTCTTGG - Intergenic
1004885825 6:20050629-20050651 CCCATCCCTCAAGGGATTCTGGG + Intergenic
1006389303 6:33749093-33749115 CTCATCCCTGTGGTGGTTCTGGG - Intergenic
1013370945 6:109470519-109470541 GTCATGCCCCATGTTATTCTGGG - Intronic
1016797851 6:148136865-148136887 CTCATCCCTCAGGTCTTTCTTGG + Intergenic
1018848969 6:167574105-167574127 CTCCTTCCCCAGGTCTTTCTGGG - Intergenic
1018889755 6:167975381-167975403 GCCAACCCCCAGGTGATGCTGGG - Intergenic
1019913293 7:4114765-4114787 CTCTTCCACAAGGTGATTCAGGG + Intronic
1020336100 7:7063465-7063487 CTCACCCCCCACTTGATACTAGG - Intergenic
1021049680 7:15967244-15967266 CTCATTCCCATGGTGATTTTGGG + Intergenic
1026378396 7:69774850-69774872 TTAATGCCCCAGGTGGTTCTTGG + Intronic
1026389930 7:69890285-69890307 CTCATCCCACAGCTGAGTTTAGG + Intronic
1031832319 7:126642822-126642844 CTCAAGAGCCAGGTGATTCTGGG + Intronic
1032095341 7:128935366-128935388 CTCTGGCCCCAGATGATTCTTGG + Intergenic
1032198669 7:129804415-129804437 CCCACCGCCCAGGTCATTCTCGG + Intergenic
1036402334 8:8420651-8420673 CTAATATCCCAGGTAATTCTTGG - Intergenic
1036607898 8:10323988-10324010 CTCATCTCCCAGTGGAATCTAGG - Intronic
1037724249 8:21470006-21470028 CTCTTCCTCCAGGTGAAACTCGG + Intergenic
1038337384 8:26656267-26656289 GTCATCACCCAGCTGATTCCGGG + Exonic
1039297941 8:36177945-36177967 TCCATCCCCCAGCTGATTTTAGG - Intergenic
1042350915 8:67776745-67776767 CTCATCCCCCAAGAGACTCTAGG - Intergenic
1044119840 8:88381275-88381297 CTCATCACCTATGTGATTCTGGG - Intergenic
1046717122 8:117579998-117580020 CCCAACCCCCAGGTAACTCTGGG - Intergenic
1047703509 8:127473671-127473693 CTCAACCCCCAGGTGACTCTTGG + Intergenic
1048648535 8:136449385-136449407 TTCATACCCCAGGTGATTTGTGG + Intergenic
1049655850 8:143796939-143796961 GTCATTCCCAAGGTTATTCTTGG - Intronic
1050937258 9:11413915-11413937 CCCATCCCCTAGCTGAGTCTGGG - Intergenic
1050980328 9:12003545-12003567 CACAAGCTCCAGGTGATTCTAGG - Intergenic
1052379850 9:27758234-27758256 CTCCGCCTACAGGTGATTCTGGG - Intergenic
1055086070 9:72315348-72315370 CTCTTCCCCAAGGTGAGACTGGG - Intergenic
1059057232 9:110996555-110996577 CTCAAGCCCCAGGAAATTCTTGG - Intronic
1060857577 9:126927173-126927195 CTGATGCCCCAGGAGATACTTGG + Intronic
1061172563 9:128968666-128968688 CTCATCCACCAGGTGCCTATTGG - Exonic
1061287819 9:129634190-129634212 CTCCTCCCCCAGGTAGGTCTTGG - Exonic
1061397515 9:130351485-130351507 CTCATCCCCCACGTGACTGCCGG - Intronic
1061986111 9:134131293-134131315 CTCTTCCCCCAGGTGGTGCTGGG - Intergenic
1189366328 X:40391678-40391700 CTCAGCCACTAGGTGAATCTGGG + Intergenic
1191184440 X:57593652-57593674 CACATCCTGCAGGTGTTTCTTGG - Exonic
1191212949 X:57908807-57908829 CACATCCTGCAGGTGTTTCTTGG + Exonic
1193325756 X:80177280-80177302 CTCATCCTTCTGGGGATTCTGGG - Intergenic
1193492964 X:82171989-82172011 TTCATCACCCAGGTGACTATTGG - Intergenic
1195691627 X:107630643-107630665 CTGCTCCCCCAGGTGACTCTTGG + Intronic
1195727918 X:107936391-107936413 CACATCCCCCACGGGCTTCTCGG - Intergenic
1195966957 X:110437660-110437682 CTCATTCCCAAGGAGATTCATGG - Intronic
1200286437 X:154827415-154827437 CTCCTCCACAAGGTGATTCAGGG + Intronic