ID: 902786629

View in Genome Browser
Species Human (GRCh38)
Location 1:18736892-18736914
Sequence GCTGCTGGTGGCCACTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 1, 2: 2, 3: 56, 4: 387}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902786625_902786629 5 Left 902786625 1:18736864-18736886 CCACATTTCAAGTGCTCAGCAGC 0: 17
1: 157
2: 555
3: 1092
4: 1576
Right 902786629 1:18736892-18736914 GCTGCTGGTGGCCACTGTGCTGG 0: 1
1: 1
2: 2
3: 56
4: 387
902786624_902786629 18 Left 902786624 1:18736851-18736873 CCAGTCGCACTAGCCACATTTCA 0: 1
1: 8
2: 21
3: 72
4: 172
Right 902786629 1:18736892-18736914 GCTGCTGGTGGCCACTGTGCTGG 0: 1
1: 1
2: 2
3: 56
4: 387
902786623_902786629 19 Left 902786623 1:18736850-18736872 CCCAGTCGCACTAGCCACATTTC 0: 1
1: 6
2: 27
3: 70
4: 147
Right 902786629 1:18736892-18736914 GCTGCTGGTGGCCACTGTGCTGG 0: 1
1: 1
2: 2
3: 56
4: 387

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902786629 Original CRISPR GCTGCTGGTGGCCACTGTGC TGG Intronic
900074765 1:804572-804594 GCTCCTGGTGGTTTCTGTGCTGG - Intergenic
900150323 1:1175994-1176016 GCTGCTCCCAGCCACTGTGCAGG + Intronic
900274215 1:1812989-1813011 GCTGCTGCTGGGCAGTGTTCAGG - Intronic
900274942 1:1819015-1819037 GCTGCAGGTAGGCACTGTGAAGG + Intronic
900413031 1:2521690-2521712 GCCCCGGGTGGCCACAGTGCAGG + Intronic
900435639 1:2629364-2629386 GCTGCTGGTGACCGCTGCCCTGG - Exonic
900513867 1:3072307-3072329 ACAGCTGGGGGCCTCTGTGCAGG + Intronic
900952089 1:5863919-5863941 GCTCCGGGTGGTCGCTGTGCAGG + Exonic
900953206 1:5870897-5870919 GCTGGTGGGGGCCACTGGACGGG + Intronic
902219403 1:14955360-14955382 CCTGCTGGTGGCCCCTGAGCTGG + Intronic
902294416 1:15456765-15456787 GCTGCTGCTGTCCACTTTGGTGG + Exonic
902374927 1:16026204-16026226 GCTGCCGGTGGCCAGGGTGCAGG - Exonic
902786629 1:18736892-18736914 GCTGCTGGTGGCCACTGTGCTGG + Intronic
902978067 1:20103560-20103582 GGTGCTGGACGCCACTGAGCAGG + Intergenic
903059085 1:20657126-20657148 GCACCTGGTGTTCACTGTGCTGG - Intronic
903233813 1:21937142-21937164 GCTGCTGGCGGTGAGTGTGCGGG - Exonic
903329321 1:22589079-22589101 CCTGCTGGTGGCCAACCTGCTGG + Exonic
903656686 1:24953566-24953588 GCCCCTGGTGGCTACTGTGTTGG + Intronic
904200840 1:28818141-28818163 GCTGCAGGTGGGCAGAGTGCAGG + Intronic
904659188 1:32072346-32072368 GCTGCTGATGGTCACCGTGTAGG - Intronic
904679879 1:32221980-32222002 GGTGCTGGTGGCCGCTCTGTGGG - Exonic
904715661 1:32465521-32465543 GGTTCTGGTGGCCTCTCTGCAGG + Intronic
905524629 1:38626870-38626892 GCCCCTGGTGGCCTATGTGCAGG - Intergenic
905683945 1:39895653-39895675 GCTGCTGTTGGCTATTATGCTGG - Exonic
905706645 1:40064940-40064962 GCTGCCCTTAGCCACTGTGCTGG + Intronic
905857409 1:41323097-41323119 GCCGCTGGTGGCCAGTGTGTGGG + Intergenic
906296965 1:44654855-44654877 GCTGCTGGTGGCCTTTGCCCTGG - Exonic
906371987 1:45261960-45261982 GCTGCAGGTGCCCTCTGGGCTGG - Intronic
910146474 1:84086122-84086144 GTTGGTGGTGCCCACTGTGCTGG + Intronic
910993724 1:93081724-93081746 GCAGCTAGTGGCTACTGTACTGG - Intronic
911167617 1:94738218-94738240 GCAGCCGGAGGCCATTGTGCAGG - Intergenic
911491595 1:98575785-98575807 GCTGCTGGTGTCCCTTCTGCTGG + Intergenic
912131098 1:106601464-106601486 GCAGCTAGTGGCTACTGTACTGG - Intergenic
912203134 1:107480792-107480814 GCTGCTGCTGACCACGCTGCTGG + Exonic
912421199 1:109543490-109543512 GGGGCTGGTGGCCTCTGTGCTGG + Exonic
914749307 1:150522657-150522679 GTGGCTGGTGGCTACTGTGTTGG - Intergenic
917920837 1:179748298-179748320 GCTGCTGTTGCCCACAGTGGTGG + Intronic
918826894 1:189336409-189336431 ATTGGTGGTGGCCACTCTGCTGG - Intergenic
919729593 1:200904538-200904560 GCGGCTAGTGGCAACTGTGTTGG + Intronic
919930225 1:202216574-202216596 GCGGCTAGTGGCCACTGCGCTGG + Intronic
919984133 1:202661149-202661171 ACTCCTGCTGGGCACTGTGCTGG + Intronic
921315508 1:213886749-213886771 GCAGCTAGTGGCTACTGTACTGG + Intergenic
922270609 1:224029477-224029499 GCTCCTGGTGGTTTCTGTGCTGG - Intergenic
922897057 1:229108689-229108711 GGTGCTGGTGTGCACTGTGCAGG - Intergenic
923087096 1:230710223-230710245 GCTGCTGCTGTCCACGGTGGTGG - Exonic
924520195 1:244799612-244799634 GATGCTGGCTGCTACTGTGCTGG - Intergenic
1063071109 10:2665074-2665096 GCTGCTTTTGGACACTATGCTGG - Intergenic
1064003474 10:11682415-11682437 CCTGCTAGTGTCCTCTGTGCTGG - Intergenic
1064563261 10:16613530-16613552 GATCCTGGTTGCCACTGTGCTGG + Intronic
1064971628 10:21072623-21072645 GCTGCTGGTGGGGACTGGCCTGG - Intronic
1067299239 10:44994056-44994078 GCTGCTGCTGGGCATTGAGCGGG - Exonic
1067706278 10:48608557-48608579 GGTGCTGGTGACCCCTGGGCAGG - Intronic
1069698385 10:70404457-70404479 GTCGCTGATGGCCACGGTGCGGG - Exonic
1069907761 10:71741876-71741898 CCACCTGGTGGCCACTGTGGAGG + Intronic
1069994500 10:72334260-72334282 GCTGGTGGTGGCTCCTGTGAGGG + Exonic
1070140118 10:73732721-73732743 GAAGCTGCTGGCCACCGTGCAGG + Intergenic
1070315105 10:75302829-75302851 GCTGCTGGTTGTCATGGTGCTGG + Intergenic
1071598487 10:86944538-86944560 GCTGCTGATGTCCTCTGAGCAGG + Intronic
1071665281 10:87549450-87549472 GTTGCTGGTGGCTACTGTGTTGG - Intronic
1072026782 10:91467597-91467619 GCTGGTGGGGGCCACTCTGCTGG - Intronic
1075588979 10:123677822-123677844 GTTGCTGGTGGCCCCCGTGCTGG - Intronic
1075657569 10:124172432-124172454 GCTGTTGGCGGCCCCTCTGCCGG + Intergenic
1076032687 10:127172982-127173004 GCAGCTAGTGGCCACTGTATTGG + Intronic
1076314050 10:129528424-129528446 GATGACAGTGGCCACTGTGCAGG + Intronic
1076314159 10:129529079-129529101 GATGACAGTGGCCACTGTGCAGG + Intronic
1077021317 11:418340-418362 GCTCCTGGTGGCCTCTGGACGGG + Exonic
1077145027 11:1040866-1040888 GCTGCTGGGGTCCACCCTGCCGG + Intergenic
1077662490 11:4082330-4082352 GCTGCTGGTGGCCAAGGAGGGGG + Exonic
1078185762 11:9050879-9050901 GCTCCTGGTGGCCCCAGTCCAGG - Intronic
1078605897 11:12775314-12775336 GCTGCGGAGGGCCACTGTGAGGG - Intronic
1079387316 11:19992042-19992064 GTTAATGCTGGCCACTGTGCTGG - Intronic
1082999296 11:59277038-59277060 GCTGCTGGAGGCAACAGTGATGG + Intergenic
1083091718 11:60206942-60206964 GCTGCTGATGACCACTGCCCTGG + Intronic
1083101202 11:60307881-60307903 GCTGCTGATGACCACTGCTCTGG - Intronic
1083296120 11:61716555-61716577 GCTGAGGGTGGGCTCTGTGCTGG + Intronic
1083440342 11:62672006-62672028 GCTATTGCTGGCCACTCTGCAGG + Exonic
1083593137 11:63906830-63906852 GCTGCTGGTGGCAGGGGTGCTGG - Intronic
1083622644 11:64056674-64056696 GCTGCTGGTGGGCACAGCCCCGG - Intronic
1084122383 11:67077334-67077356 GCTGCTGAAGGCTTCTGTGCAGG - Intergenic
1084424690 11:69078072-69078094 GCTGCTGCTGGCCACAGTACAGG + Intronic
1084479840 11:69413493-69413515 GCTGCTGGTCTCTACTGGGCAGG - Intergenic
1084703850 11:70804581-70804603 GCTGCTGGGTTCCAGTGTGCTGG + Intronic
1084935818 11:72586112-72586134 GGTGCTGGTGAGCACGGTGCTGG + Exonic
1084954267 11:72683179-72683201 GCTGCTCCTGGCCCCTCTGCAGG + Intergenic
1085445606 11:76598726-76598748 GCGGCTGGTGGCTACTAAGCTGG - Intergenic
1088599116 11:111460050-111460072 GCTCCTGGTGGCCACAGCCCTGG - Intergenic
1088736979 11:112735880-112735902 GCTGCTGCTGGTCATTGTGGTGG + Intergenic
1089561615 11:119346049-119346071 GCTGCTGGTGGCCATCATCCTGG - Exonic
1090094908 11:123733088-123733110 GCTGCTTGTGGACACTGGTCTGG - Intronic
1090202943 11:124868944-124868966 GGCGCGTGTGGCCACTGTGCGGG + Exonic
1090592577 11:128288497-128288519 GGTGGTGGTGGCCCCGGTGCTGG - Intergenic
1091334668 11:134757471-134757493 TCTGGTGGTGGCCACTGAGCAGG + Intergenic
1091697260 12:2636257-2636279 GCTGCAGTGGGCCACTGTACAGG - Intronic
1091832916 12:3563043-3563065 TCTGCTTGTGGCCATGGTGCTGG + Intronic
1092289549 12:7150993-7151015 GGGGCTGGTGACCACGGTGCAGG - Exonic
1092443475 12:8530672-8530694 GTGGCTGGTGGCTACTGTACTGG + Intergenic
1094498710 12:31005349-31005371 GCTGTCCGTGGCCACTGTGGGGG - Intergenic
1095470762 12:42534430-42534452 ACTGTTGCTGGCCCCTGTGCTGG - Intronic
1096243807 12:49973494-49973516 GCTGGTGGGGGCCACGGTGGGGG + Exonic
1096461612 12:51824552-51824574 GGTGATGCTGGCCACTGGGCAGG + Intergenic
1097017517 12:55997830-55997852 GATGCTGGAGACCAATGTGCTGG - Intronic
1097098721 12:56571004-56571026 GTTGCTGGTGACCACTGTTTAGG + Intronic
1097696240 12:62777410-62777432 GCATCTGCTGGGCACTGTGCTGG - Intronic
1098678620 12:73321896-73321918 GGTGCTGGTGGACACAGTTCTGG - Intergenic
1104014428 12:124952693-124952715 CCTGCTGGTGGCCTCTGGGGAGG - Intronic
1104863933 12:131941644-131941666 CCTGGTGGTGGCCATTGTGAAGG + Exonic
1105013869 12:132774161-132774183 GCTGCTGGAGGCAGCTGTTCAGG + Exonic
1105327981 13:19387534-19387556 GCAGGTGCTGGCCACTGTGCTGG - Intergenic
1105402247 13:20105889-20105911 GCTGGGGCTGGCCACTGCGCTGG + Intergenic
1105412777 13:20185139-20185161 GCTGCTGTTGGCCTCTGAGCAGG + Intergenic
1105863926 13:24442155-24442177 GCAGGTGCTGGCCACTGTGCTGG + Intronic
1107419327 13:40232151-40232173 GCAGCTGGTGGCCACCGCACGGG + Intergenic
1108775669 13:53762058-53762080 GCTGCTAATGGCCAGTGTGCTGG - Intergenic
1110246360 13:73328951-73328973 GTTGCTGGTGGCTACTGTAATGG - Intergenic
1110738652 13:78968313-78968335 GTTTCTGGTGGCCACAGTACTGG + Intergenic
1110806833 13:79764832-79764854 AAGGCTGGTGGCCACTGTGTTGG + Intergenic
1111180035 13:84652037-84652059 CCTGCAGATGGCCACTTTGCAGG + Intergenic
1112376285 13:98844607-98844629 GCTGCTGGTGGCCAAGCAGCAGG - Intronic
1112462017 13:99611065-99611087 GCTGCTGGTTTTCACTGTGATGG + Intronic
1112576968 13:100644582-100644604 GCTGCTGCTGGAGACTGTGTGGG - Intronic
1112681690 13:101774257-101774279 GCAGATGGTGACCACTGTCCAGG + Intronic
1113751596 13:112780338-112780360 GCTGCTGATGGCCCCTGCCCGGG - Intronic
1113929053 13:113956884-113956906 GGTGCCTGTGGCCACAGTGCTGG - Intergenic
1114500621 14:23165693-23165715 GATGCTGGTGGCCACAGTGATGG - Intronic
1114566847 14:23639341-23639363 GCAGCTGGTGGCCAAGGTGAGGG + Exonic
1115164856 14:30436882-30436904 GATGCTGGTGGCCTCTATGGAGG - Intergenic
1116045164 14:39734252-39734274 GCTTGTTGTGGCCACTGTGGGGG + Intergenic
1117517286 14:56514470-56514492 GCTGATGATTGCCACTGTCCAGG + Intronic
1117555188 14:56876702-56876724 GGTGCTGGAAACCACTGTGCTGG + Intergenic
1119549644 14:75499155-75499177 ACTGCTGGTTGCCTCTGTGCTGG + Intergenic
1121379468 14:93450274-93450296 GCTGTTTGAGGCCACTGTGGAGG + Intronic
1121615317 14:95310091-95310113 GCTGGAGGTGGGCCCTGTGCTGG + Intronic
1121911806 14:97798554-97798576 GCGGTTTGAGGCCACTGTGCAGG + Intergenic
1122159017 14:99769349-99769371 CCTGCTGGTGCCCACGGTGAGGG - Intronic
1122658447 14:103278908-103278930 GCACCTGGCGGGCACTGTGCGGG + Intergenic
1122689991 14:103527755-103527777 GCAGCTGGTGGCCAGCGTGGTGG + Intergenic
1122769211 14:104090419-104090441 GTTTCCTGTGGCCACTGTGCCGG + Intronic
1122930131 14:104929356-104929378 GCTGCTGGTGGCCACAGCCAGGG - Exonic
1124452510 15:29808969-29808991 GTGGCTGGTGGCTACTGTACTGG - Intronic
1124620913 15:31273436-31273458 CCTGGTATTGGCCACTGTGCAGG - Intergenic
1124630523 15:31334274-31334296 GCTGCCTGTGGCCACAGGGCCGG - Intronic
1124890371 15:33726577-33726599 GGGCCTGGGGGCCACTGTGCTGG - Intronic
1125688529 15:41578310-41578332 GGCTCTGGTGGCCACTGAGCTGG + Exonic
1125893064 15:43280228-43280250 GATGCTGGTGGCCATAGTGATGG - Intronic
1125931285 15:43601841-43601863 ACAGCTGTTAGCCACTGTGCTGG - Intronic
1126405571 15:48319470-48319492 GATCCTGGTGTCCACTGGGCAGG - Intergenic
1126530947 15:49710731-49710753 GATGCTGGTGTCCACAGTGGTGG + Intergenic
1129105507 15:73304657-73304679 CCTCCTGGTGGCCAGAGTGCTGG - Exonic
1129365087 15:75049208-75049230 TCTGCTGGAAGCCACTGTGCTGG - Exonic
1129530149 15:76258930-76258952 GGCTCTGATGGCCACTGTGCTGG - Intronic
1129614478 15:77087421-77087443 CCTGCTGCTGTCCCCTGTGCAGG - Intergenic
1129771000 15:78203592-78203614 TATGCTGGGGGCCACTGGGCAGG + Intronic
1130179143 15:81607370-81607392 GATGATGCTGGCCACTGTGACGG + Intergenic
1130223691 15:82043126-82043148 GCTGCTAGTGCGCACCGTGCTGG - Exonic
1130772997 15:86943885-86943907 GCTGCTCCTGGCCAATGGGCTGG - Intronic
1131015381 15:89053505-89053527 GCTGCTGTTGGTCACAGCGCTGG - Intergenic
1131356661 15:91751135-91751157 GATGCTGTTGGCAACTGTGATGG + Intergenic
1131372854 15:91897737-91897759 GCTGCTGGAGCCCACGCTGCAGG - Intronic
1131765307 15:95669238-95669260 GCTGCTGGAGGCCACGGACCTGG - Intergenic
1132316521 15:100894241-100894263 CCTGCTTGTGGCCACTGAGCTGG + Intronic
1132557996 16:580863-580885 GCTCCTGGTGGTCGCCGTGCAGG + Exonic
1132575275 16:661094-661116 GCTGCTGGGCGCCAGAGTGCAGG - Exonic
1132620816 16:867600-867622 GCTGCTGGTGGCCACGTGGCAGG + Intronic
1132711966 16:1272823-1272845 GCTGCAGGTGGGCACTGGGCAGG + Intergenic
1132715982 16:1289997-1290019 GCTGCTGGAGGTGACTGTCCCGG + Intergenic
1132806049 16:1775607-1775629 GCTACTGGTGGCCTCTTGGCAGG + Exonic
1132863652 16:2083429-2083451 GCTGCTGGTGGACACTAGGGTGG + Intronic
1132892363 16:2210566-2210588 GCTGGTGCTGGCCGCTGTGGGGG - Exonic
1132981918 16:2742645-2742667 CCTGCTGGTGGCCTCTGGGCAGG + Intergenic
1135176049 16:20230256-20230278 GTGGCTGGTGGCCTCTGGGCTGG - Intergenic
1135400589 16:22163836-22163858 GCTGGTGGTGGTCACAGGGCAGG - Intergenic
1136560875 16:31038560-31038582 GCTGCTGGATCTCACTGTGCCGG - Exonic
1137932804 16:52604619-52604641 GGGGCTGGTGTCCACTGTGCAGG + Intergenic
1138348058 16:56331991-56332013 TCTGCTGGTGGCCTCGGTGTGGG - Intronic
1138370741 16:56524556-56524578 GCTGCTGGAGTCTCCTGTGCTGG - Intergenic
1139505738 16:67397324-67397346 TCTGATGGTGGCAGCTGTGCTGG - Intronic
1140682482 16:77398996-77399018 GATGCTGATGGCCACTGAACAGG - Intronic
1141466138 16:84206919-84206941 CCTGCTGCTGGCCACGGGGCTGG + Intergenic
1141543033 16:84741532-84741554 GCTGGTGGTGCCCACTGCACAGG - Intronic
1141706523 16:85668240-85668262 GCTCCTGCTGCCCATTGTGCTGG - Exonic
1141763546 16:86044426-86044448 CCTCCCGGTGCCCACTGTGCTGG + Intergenic
1142195749 16:88738598-88738620 GCTGCTGGTGGCGGCTGGGCGGG - Exonic
1142389863 16:89792227-89792249 GCAGGTGCTGGCCACTGTGAGGG - Intronic
1142614581 17:1126990-1127012 GCTGCTGGTTGCCTGTGGGCTGG - Intronic
1142813167 17:2405726-2405748 TCTGCTGTTCGCCACCGTGCTGG + Intronic
1143095785 17:4477626-4477648 GCTGGGGGTGGGCACTGGGCAGG + Intronic
1143272649 17:5687284-5687306 GGAGTTGGTGGCCACTCTGCTGG - Intergenic
1144684258 17:17215816-17215838 GCTGCTGGTCACCGCTGTGCTGG + Intronic
1145780152 17:27557422-27557444 GCTGCTGGTGCCCACTGTGGTGG + Intronic
1145901000 17:28490501-28490523 GCTGCTGGTGGCCATCGCGGTGG + Exonic
1146254467 17:31382649-31382671 GTGGCTAGTGGCCACTGTCCTGG - Intergenic
1147121336 17:38337049-38337071 GGTGCTGCGGGCCGCTGTGCTGG - Exonic
1147522720 17:41189963-41189985 GCTGCAGGTGGTCACAGTGGTGG - Exonic
1147526258 17:41226731-41226753 GCTGCAGGTGGTCACAGTGGTGG - Exonic
1147526793 17:41232563-41232585 GCTGCAGGTGGTCACAGTGGTGG - Exonic
1147527297 17:41238113-41238135 GCTGCAGGTGGTCACAGTGGTGG - Exonic
1147528421 17:41249797-41249819 GCTGCAGGTGGTCACAGTGGTGG - Exonic
1147528941 17:41255447-41255469 GCTGCAGGTGGTCACAGTGGTGG - Exonic
1147530430 17:41271387-41271409 GCTGCAGGTGGTCACAGTGGTGG - Intergenic
1147530842 17:41275759-41275781 GCTGCAGGTGGTCACAGTGGTGG - Exonic
1147562065 17:41515414-41515436 GCTGCTTGTGGCTAGGGTGCAGG - Intronic
1148218241 17:45845501-45845523 GCTGCAGGCGGCTACTGGGCCGG + Exonic
1148739981 17:49887311-49887333 GCTGCTGGTGGGGGGTGTGCAGG + Intergenic
1148930000 17:51120482-51120504 GCCGCTGGTGGTGGCTGTGCTGG - Exonic
1149370624 17:55990640-55990662 GCTGCTTATGGTCACTGTCCTGG - Intergenic
1149671371 17:58415511-58415533 GCTGCTGATGGCTACCCTGCAGG - Exonic
1149792163 17:59488842-59488864 GCTGCTGGTGACCACTGGCAGGG - Intergenic
1150301503 17:64050862-64050884 GCTGCTGGTCCCCAGTGAGCTGG + Intronic
1151555474 17:74844374-74844396 GCTGCTGGTGGCCATGGGGCTGG - Exonic
1152349360 17:79775704-79775726 GTAGCTGGTGGTCACTGTACTGG - Intergenic
1152645676 17:81467561-81467583 GCTGCTGGGCCCCACTGTTCTGG - Intergenic
1152699644 17:81812609-81812631 GCTGCTCGTGGCCAAGCTGCGGG + Exonic
1152753493 17:82077435-82077457 GCTGCAGGTGGGCAGTGTCCAGG - Intergenic
1152915944 17:83035940-83035962 GCTGGTGGAGGTCACTGGGCTGG + Intronic
1155487424 18:26360980-26361002 GCTGCTAGTGGCCACTATATTGG + Intronic
1156980283 18:43278577-43278599 GCTGCTGCTAGCCAATGTGCAGG - Intergenic
1157647290 18:49287861-49287883 GTGGCTAGTGGCCACTGTACTGG - Intronic
1157691540 18:49686274-49686296 GTGGCTGGTGGCTACTGTGTTGG - Intergenic
1158554121 18:58461059-58461081 GCTGCTGGTGTCACCTGTGTAGG + Intergenic
1159017569 18:63114178-63114200 GTGGCTGGTGGCCACCATGCTGG - Intergenic
1159944138 18:74431116-74431138 CCAGCTGGTGGCCAATGTGCTGG - Intergenic
1160038471 18:75322200-75322222 GGTCCTGGTGGCCACTGTGGGGG + Intergenic
1161277174 19:3425016-3425038 GATGCTGGTGGCCCCAGTCCTGG - Intronic
1161580485 19:5078006-5078028 GCTGCTGGTGGAGGCTGTGATGG + Intronic
1161769570 19:6223936-6223958 GCTGCTGCTGGCTTCTGTGCCGG - Intronic
1161838632 19:6665070-6665092 GCTGCTGGTGGCCCGTCCGCAGG + Exonic
1161961365 19:7525145-7525167 GATCCTGGTGGTCACGGTGCAGG + Exonic
1162464512 19:10831894-10831916 GCTGCTGGTGGCTGCTGTGTGGG + Exonic
1163316074 19:16541680-16541702 GCTGCTGGGTGCCACTGTAATGG - Intronic
1163713230 19:18859451-18859473 CCTGCAGGTGGCCACTGTCCAGG + Intronic
1164455574 19:28403978-28404000 GCAGCTGGAGGCCAGTGTGGTGG - Intergenic
1164543518 19:29140266-29140288 GTTGCTGGAGGCCACTGTCTGGG - Intergenic
1165121624 19:33562734-33562756 GCTGCCTGTGGCCACTCAGCAGG + Intergenic
1165342843 19:35224902-35224924 GCTGCTCGTGGTCACCGTCCTGG - Exonic
1165989845 19:39804227-39804249 GTTGCTGGGGGCCATTGTGAGGG - Intergenic
1166623865 19:44331822-44331844 GGTGATGGTGGCAACTTTGCTGG + Intronic
1166644453 19:44520600-44520622 GCTGCAGGTGCTCACTGGGCAGG + Exonic
1166675420 19:44737936-44737958 AATGCTGGTGGCCACAGGGCAGG + Intergenic
1166688208 19:44808585-44808607 GCTGCTGGGGGCCACTGGTCAGG + Intergenic
1167015999 19:46841572-46841594 ACTGCTGGTCGCCACTGTCTGGG + Intronic
1167389255 19:49183018-49183040 GCTGGTGGTGGCCAGTGTTGGGG + Intronic
1167394301 19:49217739-49217761 GATGCTGCTGGCCACGGTGCAGG + Intergenic
1168272422 19:55257673-55257695 GCTGCAGGGGGCCACAGAGCGGG - Intronic
1168354624 19:55693439-55693461 CCTGCTGGTGGCTCCTGGGCTGG + Intronic
1168675662 19:58276260-58276282 AACACTGGTGGCCACTGTGCAGG + Intronic
925719461 2:6813399-6813421 GCTGCTGCTGGGGACTGGGCAGG - Intergenic
926268488 2:11346209-11346231 TCTCCTGGTGGCCTCTGTGGAGG - Intronic
927114001 2:19884324-19884346 CACGGTGGTGGCCACTGTGCTGG + Intergenic
927276674 2:21267875-21267897 ACTGCTGATGGCCACTGAGAGGG - Intergenic
927672649 2:25082063-25082085 GCTGCTGGTGGCCCAGGTGAGGG + Intronic
927673568 2:25089006-25089028 GCTCCTGGAGGCCTCTGTGCTGG + Intronic
928402616 2:30990260-30990282 GCTGCTGGTGACCTGTGTTCTGG - Intronic
929643523 2:43605185-43605207 ACTCATGCTGGCCACTGTGCTGG - Intergenic
929898009 2:45978285-45978307 GCTTCTGGTTCCCACTGGGCTGG + Intronic
930471772 2:51825013-51825035 GGTGCTGGTGGCTACTGATCAGG - Intergenic
931856035 2:66302522-66302544 GCTGCTGGTGGTAGCTGTGCTGG - Intergenic
934736016 2:96690202-96690224 GCGGCTGGTGGCTACTGTATTGG + Intergenic
938092373 2:128441956-128441978 GCTGCTGGTGGGCACTGACGAGG + Intergenic
938892050 2:135715583-135715605 GCTGGTGCTGGCGACTGAGCTGG - Exonic
938950110 2:136247420-136247442 GTGGCTTGTGGCCACTGTGCTGG + Intergenic
939992884 2:148892131-148892153 GATGCTGGAGCCCACTATGCTGG - Intronic
940757269 2:157697865-157697887 TCTGCTGGTGGTCACTGTAAGGG - Intergenic
941230399 2:162904722-162904744 GCTGATGATGGCCACAGAGCAGG + Intergenic
941649458 2:168078364-168078386 GATGTAGGTGGCCACTGGGCAGG + Intronic
946363363 2:219233154-219233176 GCTGCAGCTGGGCACTTTGCTGG + Exonic
946767331 2:223052865-223052887 GCTGCTGGAGGCGGCGGTGCCGG - Exonic
947545815 2:231009429-231009451 GCTGCTGGTTGTCACAGTGACGG + Intronic
948166211 2:235864562-235864584 GCTGCTGGTGACACCTCTGCAGG - Intronic
948662273 2:239514959-239514981 GCGGCGGGTGGCCACGGGGCGGG - Intergenic
948778100 2:240300431-240300453 GCTGGTGTTGGGCTCTGTGCTGG - Intergenic
948910185 2:240998861-240998883 GCTGCTGGTGGCCGCGGCCCTGG + Exonic
1169409553 20:5355982-5356004 GTGGCTGGTGGCTACTGTCCTGG + Intergenic
1170704548 20:18733389-18733411 GCTGCAGGTGACCTCTGGGCTGG + Intronic
1171362536 20:24598163-24598185 GCTGCAGACGGGCACTGTGCAGG + Intronic
1172032895 20:31994185-31994207 GCTGCTGGTGGCAACAGAACCGG + Intronic
1173927512 20:46791955-46791977 GAGGCTGCTGGCCAGTGTGCAGG - Intergenic
1173963636 20:47094087-47094109 GTTCCTGGTGGCCATTCTGCAGG - Intronic
1173971927 20:47159934-47159956 GCTGCAGGAAGCCACTGTGTGGG + Intronic
1174057593 20:47809450-47809472 GCTGCTGGTCCCAGCTGTGCTGG + Intergenic
1174381125 20:50155949-50155971 TCTGGTGCTGGCCACTGTGAGGG - Intergenic
1174603808 20:51745764-51745786 GTGGCTGCTGGCTACTGTGCTGG - Intronic
1174734709 20:52954987-52955009 GCTGCTGGTGATCATTGTGGGGG + Intergenic
1175504089 20:59469767-59469789 GCCGCTGGTGGTCGCTGTGGAGG + Intergenic
1175770728 20:61622554-61622576 GCAGCAGGAGGCTACTGTGCTGG - Intronic
1175873666 20:62219820-62219842 GCTCATCGTGGCCACGGTGCTGG - Exonic
1176026108 20:62986426-62986448 GGTGCAGGTGGGCACTGTTCAGG + Intergenic
1176709434 21:10136683-10136705 GCTGCTGGCTGGAACTGTGCTGG - Intergenic
1176953835 21:15076667-15076689 GCTGCTGATCTCCACTGTACAGG + Intergenic
1178671558 21:34595775-34595797 TCTGATGGGGGCCACTGGGCAGG + Intronic
1179075119 21:38113674-38113696 GCAGCTGATGGCCACTGGCCAGG + Intronic
1179156737 21:38857604-38857626 GCTGCTGCGGGCTGCTGTGCTGG + Intergenic
1179593078 21:42423941-42423963 GCTGTTGGACTCCACTGTGCTGG + Intronic
1180199326 21:46215254-46215276 GCCGCAGGTGGGCACTGTGGTGG + Exonic
1180237565 21:46472919-46472941 GTGGCTGGTGGCCACCATGCTGG - Intronic
1180783544 22:18534834-18534856 GCTGCTGGTCACTACTGTGGTGG - Intergenic
1181111397 22:20605016-20605038 GATGCTGCTGGCGAATGTGCAGG + Intergenic
1181127111 22:20708885-20708907 GCTGCTGGTCACTACTGTGGTGG - Intronic
1181240446 22:21474186-21474208 GCTGCTGGTCACTACTGTGGTGG - Intergenic
1181512361 22:23394630-23394652 GCTGCTGCTGGGCACCCTGCTGG + Intergenic
1181583235 22:23839174-23839196 GAGGCTGGTGGCCAATGGGCAGG + Intergenic
1182240388 22:28911373-28911395 GCTGCTGGAGGACACAGGGCAGG - Intronic
1183003788 22:34883358-34883380 GCTGCTGGTTGGCATGGTGCAGG - Intergenic
1183044902 22:35211736-35211758 GCTGCTGTGGGCTACTGGGCAGG - Intergenic
1184212337 22:43043457-43043479 GGTCCTGATGGCCCCTGTGCTGG - Intronic
1184490259 22:44804229-44804251 GCTGCTGGTGTCTGCTGTGCTGG + Intronic
1184500355 22:44867889-44867911 GGTGCTGGTGGGCGCTGAGCTGG + Intergenic
1184890353 22:47375372-47375394 GCTGCTGGTGGCCTGGCTGCTGG - Intergenic
1185069069 22:48646499-48646521 GCTGCTGGGGGCCCCTCTGTGGG + Intronic
1185089487 22:48757738-48757760 GCTGCTGGTGGGCACTGGCCAGG + Intronic
1185347907 22:50318576-50318598 GCCCCTGGCGGCCACTGTGTGGG + Intronic
949362476 3:3245903-3245925 GCTACTGGTTGCGTCTGTGCCGG + Intergenic
950756736 3:15179595-15179617 GCAGCTGGTGGCCCCTGTATTGG + Intergenic
951727289 3:25774457-25774479 GCTTGTTGTGGCCACTGTGGCGG + Intronic
953143971 3:40256040-40256062 GTGGCTAGTGGCCACTGTACTGG - Intronic
953693520 3:45139828-45139850 GTGGCTGGTGGCCACTCTGTAGG + Intronic
953755952 3:45646078-45646100 GCAGCTTGTGGCTACTGTACTGG - Intronic
954205696 3:49057392-49057414 GCAGCCGGTGGCCACCGTGCTGG - Exonic
954314302 3:49792866-49792888 GGTGCTGGTGGCCACTGTGCTGG + Exonic
954437081 3:50502175-50502197 GCTGCTGGTGGCCAAGGGGAAGG - Intronic
957048961 3:75396897-75396919 GCTGCTGGTGCCTGATGTGCAGG + Intergenic
960891890 3:122457792-122457814 TCTGTTGCTGGCCACTTTGCCGG + Intronic
961448250 3:126991125-126991147 GCAGCTGGGGGCCAGTGTGGAGG - Intronic
963043888 3:141088544-141088566 GCTGCAGGTAGCCACTCAGCCGG + Intronic
963979984 3:151526893-151526915 CAAGCTGGTGGCCACAGTGCAGG - Intergenic
964387411 3:156163199-156163221 GAGGCTAGTGGCTACTGTGCTGG + Intronic
965823822 3:172710861-172710883 GCTGCTGGACGCCACTTTCCGGG - Exonic
968189853 3:196659904-196659926 GCTCCAGGTGGCAGCTGTGCAGG - Exonic
968508285 4:982474-982496 GGTGCTGCTGGCCACACTGCTGG + Intronic
968543235 4:1178869-1178891 GCAGCTGGTCCCCCCTGTGCAGG + Intronic
968850066 4:3073173-3073195 GCTGTTTGTGGCCACAGAGCAGG + Intergenic
968874025 4:3255791-3255813 GCTGCTGGAGGCCATGGTGGAGG + Exonic
968958983 4:3733331-3733353 GCTGCCGGTGGCTGCTGTCCTGG + Intergenic
969239526 4:5889420-5889442 GGGGCTGGTGTCCACAGTGCTGG - Intronic
969300828 4:6295972-6295994 TCTGCTGGGGCCCCCTGTGCTGG - Intronic
969390509 4:6888815-6888837 ACTGCTGGTGCCCACTGTGAGGG - Intergenic
969395348 4:6917068-6917090 GCTGCTGGTGTGCACTCTCCGGG + Intronic
969867545 4:10085522-10085544 CCTGCTGGTGGGGGCTGTGCTGG - Intronic
970180259 4:13384252-13384274 GCCCCTGCTGGCTACTGTGCTGG - Intronic
972630188 4:40835753-40835775 ACTGCTGGGGGCCACTGCGGTGG + Intronic
972790702 4:42368765-42368787 GCTACTGGTAGCTACTGTGTTGG - Intergenic
972801544 4:42481212-42481234 CCTTCTGTTGGCCACTCTGCTGG - Intronic
973218419 4:47697791-47697813 GGTGCTGCTGGGCACTGTGCTGG + Intronic
974386079 4:61202491-61202513 GCTGGTAGTGGGCACTGGGCGGG + Intronic
978374328 4:108059245-108059267 GCTGCATGCGGCCACTGCGCTGG + Intronic
981874194 4:149520952-149520974 TCTGCTGGTGGCTTCTATGCAGG + Intergenic
982272341 4:153603981-153604003 GCTGCTGGCCGCAGCTGTGCTGG - Exonic
983953302 4:173667974-173667996 GCAGCTAGTGGCTACTGTGCTGG + Intergenic
989755993 5:44955023-44955045 GCTGGTGGTGGCTACAGGGCCGG + Intergenic
990317921 5:54601612-54601634 GCTGCTGCTGGTCACTGTCCTGG - Intergenic
991604194 5:68383862-68383884 GCTCCTGGTGCCCACAGTTCAGG + Intergenic
992191567 5:74296918-74296940 GCTGCTGGCAGCCACTGCTCAGG + Intergenic
992233471 5:74685308-74685330 GCTGCTGTTGGCGACACTGCTGG + Exonic
992626143 5:78637480-78637502 GCTGTTGGGAGCCACTGTGCAGG - Intronic
992761792 5:79956892-79956914 TCTGATGGTGGCCCCTGGGCAGG - Intergenic
997349929 5:133223453-133223475 CCTGCTGCTGCCCACTGAGCTGG + Intronic
997627163 5:135338975-135338997 GCTGATGGTGGCCGCAGTACTGG - Intronic
998269926 5:140697284-140697306 GCTGCTGGTGGGCGCTATGATGG + Exonic
998821690 5:146063151-146063173 GCTACTAGTGGCCAGTGTACAGG - Intronic
999136069 5:149320082-149320104 ACTGCTGGTGGTGACTGAGCTGG - Intronic
1000024001 5:157343173-157343195 GGTGCTGATGGCCATTCTGCTGG - Exonic
1000514048 5:162218581-162218603 GTCGCTGGTGGCCACTGTGTTGG + Intergenic
1000776165 5:165422865-165422887 GATGCTGGTGGTCCATGTGCTGG + Intergenic
1001042940 5:168349756-168349778 GCTGCCGTGGGCCACTGGGCGGG + Intronic
1001561750 5:172674349-172674371 GCTGCAGCTGGACTCTGTGCAGG - Intronic
1002106352 5:176881186-176881208 CCTGGTGGCGGCCACAGTGCGGG - Exonic
1002633654 5:180596652-180596674 GCTGCTGCTGGCCGCTGTGGTGG - Intergenic
1002900690 6:1407468-1407490 GCTGGTGGCTGCCACTGTGCTGG - Intergenic
1003171255 6:3723552-3723574 TCTGATGCTGTCCACTGTGCTGG - Exonic
1003398210 6:5771066-5771088 GCTGCTGGTTTCCACTGGGGTGG - Intronic
1004100588 6:12606193-12606215 GCGGCTGGTGGCAACAGTTCCGG + Intergenic
1005992916 6:30914448-30914470 ACTGCAGGAGGCCCCTGTGCAGG + Exonic
1007685380 6:43664482-43664504 GCTGCTGGTGGCTTGTGAGCAGG + Intronic
1007721583 6:43888389-43888411 GCTGGGGGTGGCCACGCTGCAGG + Intergenic
1011631702 6:89332649-89332671 GTGGCTGGTGGCTACTGTGTTGG + Intronic
1011636132 6:89375569-89375591 CCTGCTGGTCTCCACTGGGCAGG + Intronic
1014027672 6:116668565-116668587 GCAGCTGCTGGCCTCTGGGCCGG - Exonic
1015163362 6:130177209-130177231 GCTGCTGCTTGCTACTGTTCGGG + Intronic
1016172867 6:141041570-141041592 TCTGCCCGTGGCCCCTGTGCGGG - Intergenic
1017480521 6:154849679-154849701 ACAGGTGGGGGCCACTGTGCTGG + Intronic
1018742739 6:166743151-166743173 GCTGGTGGGGGCCACGGAGCTGG - Intronic
1019125495 6:169837929-169837951 GCTGCTGATGGCTGCTGTGGCGG - Intergenic
1019498898 7:1354711-1354733 TCTGCTGATGCCCACTGAGCCGG + Intergenic
1019538341 7:1540287-1540309 GCTGGTGGTGGCCACCTTGGAGG - Exonic
1019568627 7:1697365-1697387 GCTGCTGGAGGGGCCTGTGCAGG + Intronic
1019876022 7:3811624-3811646 GCTGCTGTTGGCCATGGTGCTGG + Intronic
1022495455 7:30850316-30850338 GCTGCAGGTGGCCCCTCTGCAGG + Intronic
1023831286 7:44040225-44040247 GCTCCTGTTGGCCAAGGTGCGGG - Intergenic
1024553872 7:50586110-50586132 GTGGCTGGTGGCTACTGTGTTGG - Intergenic
1026467377 7:70665991-70666013 GCGGCTGGGGGCCTCTGAGCTGG + Intronic
1027160504 7:75799005-75799027 GCAGCTGGTGGGCACAGTTCTGG - Intergenic
1027205505 7:76094652-76094674 GATGCTGCTGAGCACTGTGCAGG + Intergenic
1028845061 7:95471139-95471161 GGTGCTGCTGGCAATTGTGCAGG - Intergenic
1029595505 7:101535560-101535582 GCTGCTGGAGGCCATGGAGCTGG - Intronic
1029702412 7:102256084-102256106 CCTCTTGGTGACCACTGTGCTGG + Exonic
1029741616 7:102494531-102494553 GCTCCTGTTGGCCAAGGTGCGGG - Exonic
1029759607 7:102593700-102593722 GCTCCTGTTGGCCAAGGTGCGGG - Exonic
1030871203 7:114758339-114758361 GCTGCTGGTGGCCAATGACTAGG - Intergenic
1031887832 7:127259275-127259297 GGTGCTGGTGGTCACTATGATGG - Intergenic
1032242002 7:130169592-130169614 GGGGCTGGTGGCTACTGTGCTGG + Intronic
1032731421 7:134646916-134646938 GCTGCTGGTGGCCCCTTTGCAGG + Exonic
1035231817 7:157469976-157469998 GGCGCTGGGGGCCACTGTGGTGG - Intergenic
1035319635 7:158020406-158020428 GCTGCAGGTGGCCTCTGCCCAGG - Intronic
1035388796 7:158491343-158491365 GATGGTGGTGGGCACTGGGCTGG - Intronic
1035540879 8:436912-436934 GCTCCTGGTGGTTTCTGTGCTGG + Intronic
1037181517 8:16012529-16012551 GCTGCTGGTGGGGACGGTGGTGG + Intergenic
1037185205 8:16054727-16054749 GGGACTGGTGGCCACTGTACAGG + Intergenic
1037991587 8:23324994-23325016 GCAGCTGGTGGCTCCTGTACTGG - Intronic
1044675070 8:94720098-94720120 GCTGCTGGTGGCCGCGGTCGCGG + Intronic
1045539994 8:103075068-103075090 GTGGCTGGTGGCTACTGCGCTGG + Intergenic
1049015998 8:139920513-139920535 GCTCCTGGCTGCCACTGTGTAGG - Intronic
1049181003 8:141222144-141222166 GCTGCTGAAGGCCACTTTGAGGG + Intronic
1049320487 8:141993645-141993667 TCTGCTGCTGGCCGCTGTGAAGG + Intergenic
1049387531 8:142351145-142351167 ACTGCTCGTGGCCAGTGTGGCGG - Intronic
1049566590 8:143343433-143343455 GCTGCTGGTGACCCACGTGCTGG + Intronic
1049695289 8:143981278-143981300 GATGATGGTGGCCACGGTGGTGG + Intronic
1049769974 8:144375221-144375243 GCTGCTCATGGCCAGTGAGCAGG + Intronic
1052969884 9:34370945-34370967 GCTGCTTGTGGCCCCGGTGCTGG - Exonic
1053138220 9:35665025-35665047 GGGGCTGGTGGCCACGGTGGGGG - Exonic
1053715727 9:40885335-40885357 GCTGCTGGTGCCTGATGTGCGGG + Intergenic
1054076822 9:60545403-60545425 GCTGCTGGTGCCTGATGTGCAGG - Intergenic
1054748539 9:68880831-68880853 GCTGCAGGTGTCCCCAGTGCAGG - Intronic
1055076002 9:72215722-72215744 GCTGCTGCTGGACATTGAGCTGG + Intronic
1055532038 9:77194195-77194217 GCTGGTGGAGGCCCATGTGCAGG + Intronic
1056899385 9:90583951-90583973 GCTGCTGCTGGCCACCCTGTGGG + Intergenic
1057036591 9:91816175-91816197 GTTGCTGGTGGCTACCGTGAGGG - Intronic
1057050210 9:91917794-91917816 CCTACTGGAGGCCACAGTGCAGG + Intronic
1057368303 9:94445047-94445069 TGTGCTGGTGGCCACAGTGGTGG + Exonic
1057736573 9:97667709-97667731 GCAGCTAGTGGCTACTGTGTTGG - Intronic
1060872561 9:127054565-127054587 CCTGCTGCTGCCCACTGTCCTGG - Intronic
1062053826 9:134460545-134460567 CCTGCTGGACGCCACTTTGCTGG + Intergenic
1062323635 9:136002592-136002614 GCTTCAACTGGCCACTGTGCAGG + Intergenic
1203768140 EBV:37089-37111 GCTGGTGGTGGCAATTGTGAGGG - Intergenic
1187411608 X:19055520-19055542 GTGGCTGGTGGCCACTGTTTTGG + Intronic
1187895105 X:23973401-23973423 AATTCTGTTGGCCACTGTGCTGG + Intergenic
1187913829 X:24134678-24134700 AATTCTGTTGGCCACTGTGCTGG + Intergenic
1188024046 X:25189762-25189784 CCTCATGGTGGCCACTGTGCAGG - Intergenic
1188125110 X:26357874-26357896 GCTGCTGGTGGACTCAGTGTGGG - Intergenic
1189102477 X:38205915-38205937 ATTGTCGGTGGCCACTGTGCAGG - Intronic
1193601004 X:83508527-83508549 GGGGCTGGTGGCCAGTGTGGAGG - Exonic
1194667501 X:96691747-96691769 ACAGCTGGTGGCCAATATGCTGG - Intronic
1196735022 X:118975383-118975405 CTTGATGGTGGCCACTGGGCGGG + Exonic
1197263945 X:124346696-124346718 GCTCCTGCTTGCCACTGGGCTGG + Exonic
1197582739 X:128304564-128304586 GCAGCTGGAGGCCACTATACTGG + Intergenic
1198264622 X:134997926-134997948 GCTGGTGTAGGCTACTGTGCTGG - Intergenic
1199777726 X:151030249-151030271 GCTGCTGATGGCTTCTGTGAAGG + Intergenic
1200384591 X:155877880-155877902 GCTGCTTGTAGCCATGGTGCTGG - Intergenic
1202603870 Y:26622078-26622100 GCAGGTGCTGGCCACTGTGCTGG + Intergenic