ID: 902788354

View in Genome Browser
Species Human (GRCh38)
Location 1:18747463-18747485
Sequence TTAACGCATCTGGCCAACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902788342_902788354 30 Left 902788342 1:18747410-18747432 CCCCTTCAGAAAGAGGCCCTTGA 0: 1
1: 0
2: 1
3: 17
4: 169
Right 902788354 1:18747463-18747485 TTAACGCATCTGGCCAACTTGGG 0: 1
1: 0
2: 0
3: 3
4: 64
902788346_902788354 14 Left 902788346 1:18747426-18747448 CCCTTGACCCTGATAGGTTCTCT 0: 1
1: 0
2: 0
3: 7
4: 138
Right 902788354 1:18747463-18747485 TTAACGCATCTGGCCAACTTGGG 0: 1
1: 0
2: 0
3: 3
4: 64
902788349_902788354 6 Left 902788349 1:18747434-18747456 CCTGATAGGTTCTCTCTAAAACC 0: 1
1: 0
2: 1
3: 7
4: 96
Right 902788354 1:18747463-18747485 TTAACGCATCTGGCCAACTTGGG 0: 1
1: 0
2: 0
3: 3
4: 64
902788344_902788354 28 Left 902788344 1:18747412-18747434 CCTTCAGAAAGAGGCCCTTGACC 0: 1
1: 0
2: 0
3: 20
4: 160
Right 902788354 1:18747463-18747485 TTAACGCATCTGGCCAACTTGGG 0: 1
1: 0
2: 0
3: 3
4: 64
902788343_902788354 29 Left 902788343 1:18747411-18747433 CCCTTCAGAAAGAGGCCCTTGAC 0: 1
1: 0
2: 0
3: 19
4: 148
Right 902788354 1:18747463-18747485 TTAACGCATCTGGCCAACTTGGG 0: 1
1: 0
2: 0
3: 3
4: 64
902788347_902788354 13 Left 902788347 1:18747427-18747449 CCTTGACCCTGATAGGTTCTCTC 0: 1
1: 0
2: 0
3: 11
4: 141
Right 902788354 1:18747463-18747485 TTAACGCATCTGGCCAACTTGGG 0: 1
1: 0
2: 0
3: 3
4: 64
902788348_902788354 7 Left 902788348 1:18747433-18747455 CCCTGATAGGTTCTCTCTAAAAC 0: 1
1: 0
2: 0
3: 10
4: 120
Right 902788354 1:18747463-18747485 TTAACGCATCTGGCCAACTTGGG 0: 1
1: 0
2: 0
3: 3
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902788354 Original CRISPR TTAACGCATCTGGCCAACTT GGG Intronic
902788354 1:18747463-18747485 TTAACGCATCTGGCCAACTTGGG + Intronic
918399166 1:184146321-184146343 TAGAGGCATCTGGCCACCTTGGG + Intergenic
922781994 1:228259918-228259940 TTATCCCTTCTGGCCAACCTCGG - Intronic
922995908 1:229961296-229961318 TTACAGCATCTGGCAAAATTGGG - Intergenic
1067938074 10:50627968-50627990 TAAACTCTTCTGGCCAACCTGGG + Intergenic
1069716082 10:70522396-70522418 CTGACGCACCTGGCCAGCTTCGG - Intronic
1073348777 10:102804099-102804121 TCACCACACCTGGCCAACTTAGG - Intronic
1074498402 10:114000233-114000255 TTTACTCATGTGGCCACCTTTGG - Intergenic
1075285807 10:121184713-121184735 TTAAAGAATCAGGCCAAATTTGG - Intergenic
1076372564 10:129964700-129964722 TGCATGCATCTGGGCAACTTGGG - Intergenic
1077447835 11:2608222-2608244 TTCACTCATCTGGCCCTCTTGGG + Intronic
1079298748 11:19258467-19258489 TGACCGCACCTGGCCCACTTGGG + Intergenic
1084695309 11:70750052-70750074 TTAACGCAGCTAGCAAACCTGGG + Intronic
1086861411 11:91928977-91928999 TTCAGGCATCTGACCCACTTTGG + Intergenic
1089593262 11:119558697-119558719 AGAAAGCAACTGGCCAACTTGGG - Intergenic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1095148961 12:38767838-38767860 TTAATGCAAATGGCCAAGTTTGG + Intronic
1095718776 12:45377389-45377411 ATAACGTATCTGGCCAAATAAGG - Intronic
1098872781 12:75835434-75835456 TCAACGTATCAGCCCAACTTGGG + Intergenic
1102439212 12:112948701-112948723 CTAACGCACATGGCCATCTTTGG - Intronic
1117610476 14:57478149-57478171 TTAAAGCAGCTGGCAGACTTTGG - Intronic
1119298109 14:73549657-73549679 TTAGAGCATCTGGGCCACTTGGG + Intronic
1119302398 14:73581841-73581863 TTAGAGCATCTGGGCCACTTGGG + Intergenic
1120363592 14:83537813-83537835 TTAAGACATATGGCCAAATTGGG + Intergenic
1131102606 15:89704915-89704937 TAAAGGCATCTGGCCCACTGTGG - Intronic
1147349379 17:39828223-39828245 TTACCCCATCTGGCAAAATTGGG + Intronic
1164859858 19:31554388-31554410 TTAAAGCATCTGGCCTCCTTAGG + Intergenic
926119501 2:10234543-10234565 TTCAGGCATCTGGCCACCTGCGG - Intergenic
929980681 2:46677026-46677048 TCAAGGGATCTGGCCACCTTGGG - Intergenic
930724394 2:54668254-54668276 ATGGCGCATCTGGCCAACTGAGG - Intronic
933281157 2:80334022-80334044 TTAGCCCATGTGGCCAACTGTGG + Intronic
937138133 2:119573072-119573094 TTAAAGCATCTGGGCCACATGGG + Intronic
937877423 2:126836186-126836208 TTAATGGTTCTGGCAAACTTGGG - Intergenic
938054050 2:128200001-128200023 TTAACACATCTGGTTAAGTTGGG + Intergenic
943637647 2:190323955-190323977 TCACCGCACCTGGCCAAATTGGG + Intronic
945968810 2:216216649-216216671 TTAACGTATCTGGCAAAGATGGG - Intergenic
946831333 2:223731065-223731087 TTAAAGCTTTTGTCCAACTTTGG - Intergenic
1168877749 20:1182934-1182956 TGAAAGAATCTGGCCACCTTAGG + Intronic
1169082853 20:2807697-2807719 TTAATGCATCTGATCAACCTAGG - Intergenic
1170128923 20:12998014-12998036 CCACCGCATCTAGCCAACTTTGG - Intergenic
1177445424 21:21189436-21189458 CCAACACATCTGGCCAAGTTTGG - Intronic
951424993 3:22534111-22534133 TTCACTCATCTGACCATCTTAGG + Intergenic
953999880 3:47547681-47547703 TTAATGCATCTGACCAAGTTAGG + Intergenic
957682271 3:83452153-83452175 TCAACCTATCTGGCCAATTTTGG + Intergenic
961835050 3:129650926-129650948 TTAGCGTAAGTGGCCAACTTGGG + Exonic
963287126 3:143444224-143444246 TCTAGGCATCTGGCCAATTTAGG - Intronic
964046404 3:152332926-152332948 TTAACCCAGATGGCCCACTTTGG + Intronic
982675517 4:158371097-158371119 TTAACTCATTTGGCCAATTCTGG - Intronic
994746246 5:103681946-103681968 TTAGGCCATCTGCCCAACTTGGG - Intergenic
995513179 5:112928165-112928187 CTACTGCACCTGGCCAACTTTGG + Intergenic
1000793161 5:165631750-165631772 TTAAAGCATCCAGCCTACTTTGG + Intergenic
1003754693 6:9103938-9103960 TTAAAGTATCTGGCCCAATTTGG + Intergenic
1006281540 6:33058178-33058200 TTAAAGAATCTGGTCAAGTTTGG - Intergenic
1017691001 6:156964153-156964175 TTAACTCATCTTGCAACCTTTGG + Intronic
1021833515 7:24643187-24643209 TTAAGGAAACTGGCCACCTTAGG + Intronic
1025003889 7:55340734-55340756 TTAAAGCCTCTGGACAACTGTGG - Intergenic
1030124316 7:106140072-106140094 TTAGCACTTCTGGCAAACTTTGG - Intergenic
1031484816 7:122313185-122313207 TTAGAGAATATGGCCAACTTTGG - Intergenic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1048469334 8:134693330-134693352 TTAACACAACTGGCCAAATATGG + Intronic
1053340248 9:37320363-37320385 CCACCGCACCTGGCCAACTTCGG + Intronic
1054922787 9:70558654-70558676 TTAATGCAGCTGGGAAACTTTGG + Intronic
1057307143 9:93919023-93919045 TTAAGGCAGCTGCCCATCTTGGG + Intergenic
1186059766 X:5691381-5691403 TGACCGCATCTGGCCAACTGAGG + Intergenic
1189516344 X:41716743-41716765 TTATCCCATCTGGCAAAATTGGG + Intronic
1194252590 X:91595819-91595841 TTAAAGCAGCTTGCAAACTTTGG + Intergenic
1196483320 X:116176700-116176722 TTAACTCATCTTGTCAAGTTTGG - Intergenic
1200571522 Y:4837077-4837099 TTAAAGCAGCTTGCAAACTTTGG + Intergenic