ID: 902794588

View in Genome Browser
Species Human (GRCh38)
Location 1:18793024-18793046
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902794588_902794602 29 Left 902794588 1:18793024-18793046 CCAAGTGAACTTGCTCAGCTGGT No data
Right 902794602 1:18793076-18793098 CATCACCAGGTGAGGGTGGTTGG No data
902794588_902794600 22 Left 902794588 1:18793024-18793046 CCAAGTGAACTTGCTCAGCTGGT No data
Right 902794600 1:18793069-18793091 TAGCTTACATCACCAGGTGAGGG No data
902794588_902794598 16 Left 902794588 1:18793024-18793046 CCAAGTGAACTTGCTCAGCTGGT No data
Right 902794598 1:18793063-18793085 CAGGAGTAGCTTACATCACCAGG No data
902794588_902794589 -3 Left 902794588 1:18793024-18793046 CCAAGTGAACTTGCTCAGCTGGT No data
Right 902794589 1:18793044-18793066 GGTACCCACCCAAGACCCCCAGG No data
902794588_902794601 25 Left 902794588 1:18793024-18793046 CCAAGTGAACTTGCTCAGCTGGT No data
Right 902794601 1:18793072-18793094 CTTACATCACCAGGTGAGGGTGG No data
902794588_902794599 21 Left 902794588 1:18793024-18793046 CCAAGTGAACTTGCTCAGCTGGT No data
Right 902794599 1:18793068-18793090 GTAGCTTACATCACCAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902794588 Original CRISPR ACCAGCTGAGCAAGTTCACT TGG (reversed) Intergenic