ID: 902794590

View in Genome Browser
Species Human (GRCh38)
Location 1:18793048-18793070
Sequence TACTCCTGGGGGTCTTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902794590_902794602 5 Left 902794590 1:18793048-18793070 CCCACCCAAGACCCCCAGGAGTA No data
Right 902794602 1:18793076-18793098 CATCACCAGGTGAGGGTGGTTGG No data
902794590_902794601 1 Left 902794590 1:18793048-18793070 CCCACCCAAGACCCCCAGGAGTA No data
Right 902794601 1:18793072-18793094 CTTACATCACCAGGTGAGGGTGG No data
902794590_902794606 13 Left 902794590 1:18793048-18793070 CCCACCCAAGACCCCCAGGAGTA No data
Right 902794606 1:18793084-18793106 GGTGAGGGTGGTTGGAGATGGGG No data
902794590_902794598 -8 Left 902794590 1:18793048-18793070 CCCACCCAAGACCCCCAGGAGTA No data
Right 902794598 1:18793063-18793085 CAGGAGTAGCTTACATCACCAGG No data
902794590_902794605 12 Left 902794590 1:18793048-18793070 CCCACCCAAGACCCCCAGGAGTA No data
Right 902794605 1:18793083-18793105 AGGTGAGGGTGGTTGGAGATGGG No data
902794590_902794600 -2 Left 902794590 1:18793048-18793070 CCCACCCAAGACCCCCAGGAGTA No data
Right 902794600 1:18793069-18793091 TAGCTTACATCACCAGGTGAGGG No data
902794590_902794604 11 Left 902794590 1:18793048-18793070 CCCACCCAAGACCCCCAGGAGTA No data
Right 902794604 1:18793082-18793104 CAGGTGAGGGTGGTTGGAGATGG No data
902794590_902794599 -3 Left 902794590 1:18793048-18793070 CCCACCCAAGACCCCCAGGAGTA No data
Right 902794599 1:18793068-18793090 GTAGCTTACATCACCAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902794590 Original CRISPR TACTCCTGGGGGTCTTGGGT GGG (reversed) Intergenic