ID: 902794592

View in Genome Browser
Species Human (GRCh38)
Location 1:18793052-18793074
Sequence AAGCTACTCCTGGGGGTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902794592_902794606 9 Left 902794592 1:18793052-18793074 CCCAAGACCCCCAGGAGTAGCTT No data
Right 902794606 1:18793084-18793106 GGTGAGGGTGGTTGGAGATGGGG No data
902794592_902794607 30 Left 902794592 1:18793052-18793074 CCCAAGACCCCCAGGAGTAGCTT No data
Right 902794607 1:18793105-18793127 GGAGCTCTGTTGCCTAGATGCGG No data
902794592_902794602 1 Left 902794592 1:18793052-18793074 CCCAAGACCCCCAGGAGTAGCTT No data
Right 902794602 1:18793076-18793098 CATCACCAGGTGAGGGTGGTTGG No data
902794592_902794601 -3 Left 902794592 1:18793052-18793074 CCCAAGACCCCCAGGAGTAGCTT No data
Right 902794601 1:18793072-18793094 CTTACATCACCAGGTGAGGGTGG No data
902794592_902794604 7 Left 902794592 1:18793052-18793074 CCCAAGACCCCCAGGAGTAGCTT No data
Right 902794604 1:18793082-18793104 CAGGTGAGGGTGGTTGGAGATGG No data
902794592_902794600 -6 Left 902794592 1:18793052-18793074 CCCAAGACCCCCAGGAGTAGCTT No data
Right 902794600 1:18793069-18793091 TAGCTTACATCACCAGGTGAGGG No data
902794592_902794605 8 Left 902794592 1:18793052-18793074 CCCAAGACCCCCAGGAGTAGCTT No data
Right 902794605 1:18793083-18793105 AGGTGAGGGTGGTTGGAGATGGG No data
902794592_902794599 -7 Left 902794592 1:18793052-18793074 CCCAAGACCCCCAGGAGTAGCTT No data
Right 902794599 1:18793068-18793090 GTAGCTTACATCACCAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902794592 Original CRISPR AAGCTACTCCTGGGGGTCTT GGG (reversed) Intergenic