ID: 902794593

View in Genome Browser
Species Human (GRCh38)
Location 1:18793053-18793075
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902794593_902794607 29 Left 902794593 1:18793053-18793075 CCAAGACCCCCAGGAGTAGCTTA No data
Right 902794607 1:18793105-18793127 GGAGCTCTGTTGCCTAGATGCGG No data
902794593_902794608 30 Left 902794593 1:18793053-18793075 CCAAGACCCCCAGGAGTAGCTTA No data
Right 902794608 1:18793106-18793128 GAGCTCTGTTGCCTAGATGCGGG No data
902794593_902794602 0 Left 902794593 1:18793053-18793075 CCAAGACCCCCAGGAGTAGCTTA No data
Right 902794602 1:18793076-18793098 CATCACCAGGTGAGGGTGGTTGG No data
902794593_902794606 8 Left 902794593 1:18793053-18793075 CCAAGACCCCCAGGAGTAGCTTA No data
Right 902794606 1:18793084-18793106 GGTGAGGGTGGTTGGAGATGGGG No data
902794593_902794601 -4 Left 902794593 1:18793053-18793075 CCAAGACCCCCAGGAGTAGCTTA No data
Right 902794601 1:18793072-18793094 CTTACATCACCAGGTGAGGGTGG No data
902794593_902794604 6 Left 902794593 1:18793053-18793075 CCAAGACCCCCAGGAGTAGCTTA No data
Right 902794604 1:18793082-18793104 CAGGTGAGGGTGGTTGGAGATGG No data
902794593_902794605 7 Left 902794593 1:18793053-18793075 CCAAGACCCCCAGGAGTAGCTTA No data
Right 902794605 1:18793083-18793105 AGGTGAGGGTGGTTGGAGATGGG No data
902794593_902794599 -8 Left 902794593 1:18793053-18793075 CCAAGACCCCCAGGAGTAGCTTA No data
Right 902794599 1:18793068-18793090 GTAGCTTACATCACCAGGTGAGG No data
902794593_902794600 -7 Left 902794593 1:18793053-18793075 CCAAGACCCCCAGGAGTAGCTTA No data
Right 902794600 1:18793069-18793091 TAGCTTACATCACCAGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902794593 Original CRISPR TAAGCTACTCCTGGGGGTCT TGG (reversed) Intergenic