ID: 902794595

View in Genome Browser
Species Human (GRCh38)
Location 1:18793060-18793082
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902794595_902794602 -7 Left 902794595 1:18793060-18793082 CCCCAGGAGTAGCTTACATCACC No data
Right 902794602 1:18793076-18793098 CATCACCAGGTGAGGGTGGTTGG No data
902794595_902794607 22 Left 902794595 1:18793060-18793082 CCCCAGGAGTAGCTTACATCACC No data
Right 902794607 1:18793105-18793127 GGAGCTCTGTTGCCTAGATGCGG No data
902794595_902794605 0 Left 902794595 1:18793060-18793082 CCCCAGGAGTAGCTTACATCACC No data
Right 902794605 1:18793083-18793105 AGGTGAGGGTGGTTGGAGATGGG No data
902794595_902794606 1 Left 902794595 1:18793060-18793082 CCCCAGGAGTAGCTTACATCACC No data
Right 902794606 1:18793084-18793106 GGTGAGGGTGGTTGGAGATGGGG No data
902794595_902794604 -1 Left 902794595 1:18793060-18793082 CCCCAGGAGTAGCTTACATCACC No data
Right 902794604 1:18793082-18793104 CAGGTGAGGGTGGTTGGAGATGG No data
902794595_902794608 23 Left 902794595 1:18793060-18793082 CCCCAGGAGTAGCTTACATCACC No data
Right 902794608 1:18793106-18793128 GAGCTCTGTTGCCTAGATGCGGG No data
902794595_902794610 30 Left 902794595 1:18793060-18793082 CCCCAGGAGTAGCTTACATCACC No data
Right 902794610 1:18793113-18793135 GTTGCCTAGATGCGGGGCCAAGG No data
902794595_902794609 24 Left 902794595 1:18793060-18793082 CCCCAGGAGTAGCTTACATCACC No data
Right 902794609 1:18793107-18793129 AGCTCTGTTGCCTAGATGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902794595 Original CRISPR GGTGATGTAAGCTACTCCTG GGG (reversed) Intergenic