ID: 902794596

View in Genome Browser
Species Human (GRCh38)
Location 1:18793061-18793083
Sequence TGGTGATGTAAGCTACTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902794596_902794605 -1 Left 902794596 1:18793061-18793083 CCCAGGAGTAGCTTACATCACCA No data
Right 902794605 1:18793083-18793105 AGGTGAGGGTGGTTGGAGATGGG No data
902794596_902794606 0 Left 902794596 1:18793061-18793083 CCCAGGAGTAGCTTACATCACCA No data
Right 902794606 1:18793084-18793106 GGTGAGGGTGGTTGGAGATGGGG No data
902794596_902794607 21 Left 902794596 1:18793061-18793083 CCCAGGAGTAGCTTACATCACCA No data
Right 902794607 1:18793105-18793127 GGAGCTCTGTTGCCTAGATGCGG No data
902794596_902794608 22 Left 902794596 1:18793061-18793083 CCCAGGAGTAGCTTACATCACCA No data
Right 902794608 1:18793106-18793128 GAGCTCTGTTGCCTAGATGCGGG No data
902794596_902794602 -8 Left 902794596 1:18793061-18793083 CCCAGGAGTAGCTTACATCACCA No data
Right 902794602 1:18793076-18793098 CATCACCAGGTGAGGGTGGTTGG No data
902794596_902794609 23 Left 902794596 1:18793061-18793083 CCCAGGAGTAGCTTACATCACCA No data
Right 902794609 1:18793107-18793129 AGCTCTGTTGCCTAGATGCGGGG No data
902794596_902794610 29 Left 902794596 1:18793061-18793083 CCCAGGAGTAGCTTACATCACCA No data
Right 902794610 1:18793113-18793135 GTTGCCTAGATGCGGGGCCAAGG No data
902794596_902794604 -2 Left 902794596 1:18793061-18793083 CCCAGGAGTAGCTTACATCACCA No data
Right 902794604 1:18793082-18793104 CAGGTGAGGGTGGTTGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902794596 Original CRISPR TGGTGATGTAAGCTACTCCT GGG (reversed) Intergenic