ID: 902794597

View in Genome Browser
Species Human (GRCh38)
Location 1:18793062-18793084
Sequence CTGGTGATGTAAGCTACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902794597_902794608 21 Left 902794597 1:18793062-18793084 CCAGGAGTAGCTTACATCACCAG No data
Right 902794608 1:18793106-18793128 GAGCTCTGTTGCCTAGATGCGGG No data
902794597_902794609 22 Left 902794597 1:18793062-18793084 CCAGGAGTAGCTTACATCACCAG No data
Right 902794609 1:18793107-18793129 AGCTCTGTTGCCTAGATGCGGGG No data
902794597_902794602 -9 Left 902794597 1:18793062-18793084 CCAGGAGTAGCTTACATCACCAG No data
Right 902794602 1:18793076-18793098 CATCACCAGGTGAGGGTGGTTGG No data
902794597_902794605 -2 Left 902794597 1:18793062-18793084 CCAGGAGTAGCTTACATCACCAG No data
Right 902794605 1:18793083-18793105 AGGTGAGGGTGGTTGGAGATGGG No data
902794597_902794606 -1 Left 902794597 1:18793062-18793084 CCAGGAGTAGCTTACATCACCAG No data
Right 902794606 1:18793084-18793106 GGTGAGGGTGGTTGGAGATGGGG No data
902794597_902794604 -3 Left 902794597 1:18793062-18793084 CCAGGAGTAGCTTACATCACCAG No data
Right 902794604 1:18793082-18793104 CAGGTGAGGGTGGTTGGAGATGG No data
902794597_902794607 20 Left 902794597 1:18793062-18793084 CCAGGAGTAGCTTACATCACCAG No data
Right 902794607 1:18793105-18793127 GGAGCTCTGTTGCCTAGATGCGG No data
902794597_902794610 28 Left 902794597 1:18793062-18793084 CCAGGAGTAGCTTACATCACCAG No data
Right 902794610 1:18793113-18793135 GTTGCCTAGATGCGGGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902794597 Original CRISPR CTGGTGATGTAAGCTACTCC TGG (reversed) Intergenic