ID: 902794598

View in Genome Browser
Species Human (GRCh38)
Location 1:18793063-18793085
Sequence CAGGAGTAGCTTACATCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902794590_902794598 -8 Left 902794590 1:18793048-18793070 CCCACCCAAGACCCCCAGGAGTA No data
Right 902794598 1:18793063-18793085 CAGGAGTAGCTTACATCACCAGG No data
902794591_902794598 -9 Left 902794591 1:18793049-18793071 CCACCCAAGACCCCCAGGAGTAG No data
Right 902794598 1:18793063-18793085 CAGGAGTAGCTTACATCACCAGG No data
902794588_902794598 16 Left 902794588 1:18793024-18793046 CCAAGTGAACTTGCTCAGCTGGT No data
Right 902794598 1:18793063-18793085 CAGGAGTAGCTTACATCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902794598 Original CRISPR CAGGAGTAGCTTACATCACC AGG Intergenic
No off target data available for this crispr