ID: 902794599

View in Genome Browser
Species Human (GRCh38)
Location 1:18793068-18793090
Sequence GTAGCTTACATCACCAGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902794591_902794599 -4 Left 902794591 1:18793049-18793071 CCACCCAAGACCCCCAGGAGTAG No data
Right 902794599 1:18793068-18793090 GTAGCTTACATCACCAGGTGAGG No data
902794588_902794599 21 Left 902794588 1:18793024-18793046 CCAAGTGAACTTGCTCAGCTGGT No data
Right 902794599 1:18793068-18793090 GTAGCTTACATCACCAGGTGAGG No data
902794593_902794599 -8 Left 902794593 1:18793053-18793075 CCAAGACCCCCAGGAGTAGCTTA No data
Right 902794599 1:18793068-18793090 GTAGCTTACATCACCAGGTGAGG No data
902794590_902794599 -3 Left 902794590 1:18793048-18793070 CCCACCCAAGACCCCCAGGAGTA No data
Right 902794599 1:18793068-18793090 GTAGCTTACATCACCAGGTGAGG No data
902794592_902794599 -7 Left 902794592 1:18793052-18793074 CCCAAGACCCCCAGGAGTAGCTT No data
Right 902794599 1:18793068-18793090 GTAGCTTACATCACCAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902794599 Original CRISPR GTAGCTTACATCACCAGGTG AGG Intergenic