ID: 902794600

View in Genome Browser
Species Human (GRCh38)
Location 1:18793069-18793091
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902794590_902794600 -2 Left 902794590 1:18793048-18793070 CCCACCCAAGACCCCCAGGAGTA No data
Right 902794600 1:18793069-18793091 TAGCTTACATCACCAGGTGAGGG No data
902794592_902794600 -6 Left 902794592 1:18793052-18793074 CCCAAGACCCCCAGGAGTAGCTT No data
Right 902794600 1:18793069-18793091 TAGCTTACATCACCAGGTGAGGG No data
902794588_902794600 22 Left 902794588 1:18793024-18793046 CCAAGTGAACTTGCTCAGCTGGT No data
Right 902794600 1:18793069-18793091 TAGCTTACATCACCAGGTGAGGG No data
902794593_902794600 -7 Left 902794593 1:18793053-18793075 CCAAGACCCCCAGGAGTAGCTTA No data
Right 902794600 1:18793069-18793091 TAGCTTACATCACCAGGTGAGGG No data
902794591_902794600 -3 Left 902794591 1:18793049-18793071 CCACCCAAGACCCCCAGGAGTAG No data
Right 902794600 1:18793069-18793091 TAGCTTACATCACCAGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type